Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 1 crisprs c2c9_V-U4 0 5 3 0
NZ_CP017749 Cupriavidus sp. USMAA2-4 chromosome 2, complete sequence 2 crisprs csa3,DEDDh 0 0 3 0
NZ_CP017748 Cupriavidus sp. USMAA2-4 chromosome 1, complete sequence 3 crisprs cas3,WYL,csa3,RT,DEDDh,DinG 0 0 5 0

Results visualization

1. NZ_CP017750
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017750_1 282407-282714 TypeV-U4 NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017750_1 1.1|282431|23|NZ_CP017750|CRISPRCasFinder 282431-282453 23 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 282431-282453 0 1.0
NZ_CP017750_1 1.2|282478|49|NZ_CP017750|CRISPRCasFinder 282478-282526 49 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 282478-282526 0 1.0
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 282551-282573 0 1.0
NZ_CP017750_1 1.4|282598|46|NZ_CP017750|CRISPRCasFinder 282598-282643 46 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 282598-282643 0 1.0
NZ_CP017750_1 1.5|282668|23|NZ_CP017750|CRISPRCasFinder 282668-282690 23 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 282668-282690 0 1.0
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 274614-274636 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 136366-136388 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NC_023727 Mycobacterium phage Vista, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NC_027985 Mycobacterium phage UncleHowie, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MH371107 Mycobacterium phage Doddsville, complete genome 8771-8793 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MH051264 Mycobacterium phage Cobra, complete genome 8771-8793 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 KM363597 Mycobacteriophage Zonia, complete genome 8770-8792 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MG770212 Mycobacterium phage Haimas, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MH825705 Mycobacterium phage Mesh1, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MT952849 Mycobacterium phage Windsor, complete genome 8772-8794 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MK112555 Mycobacterium phage Zelda, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NC_028803 Mycobacterium phage OSmaximus, complete genome 8772-8794 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 JN638752 Mycobacterium phage Murdoc, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MG925346 Mycobacterium phage LeeLot, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MK112544 Mycobacterium phage Keitherie, complete genome 8770-8792 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MK279850 Mycobacterium phage Durga, complete genome 8770-8792 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MN585965 Mycobacterium phage Duggie, complete genome 8773-8795 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MT897901 Mycobacterium phage Adriana, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 KP027208 Mycobacterium phage Pipsqueak, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MF919519 Mycobacterium phage Longacauda, complete genome 8773-8795 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MK279858 Mycobacterium phage JakeO, complete genome 8773-8795 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MT310867 Mycobacterium phage Chaelin, complete genome 8772-8794 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MH590594 Mycobacterium phage PinheadLarry, complete genome 8774-8796 2 0.913
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NZ_CP011600 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-215, complete sequence 20204-20226 3 0.87
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NZ_AP018757 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_1, complete sequence 184484-184506 3 0.87
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 75584-75606 3 0.87
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 363204-363226 3 0.87
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 NZ_CP026189 Enterobacteriaceae bacterium ENNIH2 plasmid pENT-812c, complete sequence 70025-70047 3 0.87
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 KR053197 Gordonia phage GRU3, complete genome 5214-5236 3 0.87
NZ_CP017750_1 1.3|282551|23|NZ_CP017750|CRISPRCasFinder 282551-282573 23 MH588544 Caulobacter phage CcrBL10, complete genome 140954-140976 3 0.87

1. spacer 1.1|282431|23|NZ_CP017750|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggcttctccgtgcttcctgacc	CRISPR spacer
tggcttctccgtgcttcctgacc	Protospacer
***********************

2. spacer 1.2|282478|49|NZ_CP017750|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtttttggagccagcggcttcccgccgatcaaccagcaatggcagca	CRISPR spacer
tggtttttggagccagcggcttcccgccgatcaaccagcaatggcagca	Protospacer
*************************************************

3. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgacgctgcg	Protospacer
***********************

4. spacer 1.4|282598|46|NZ_CP017750|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcaaccccaggttatctcgccatcctgtcggagcctatagcctcc	CRISPR spacer
ttcaaccccaggttatctcgccatcctgtcggagcctatagcctcc	Protospacer
**********************************************

5. spacer 1.5|282668|23|NZ_CP017750|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cagacgagcccgggaatcagctc	CRISPR spacer
cagacgagcccgggaatcagctc	Protospacer
***********************

6. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
tggcgttggccgccgacgctgcg	Protospacer
.*** ******************

7. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccggcgacgccgcg	Protospacer
************ ******.***

8. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

9. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

10. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

11. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

12. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

13. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

14. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

15. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

16. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

17. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

18. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

19. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MG925346 (Mycobacterium phage LeeLot, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

20. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

21. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

22. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

23. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

24. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

25. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

26. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

27. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

28. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 2, identity: 0.913

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgcctctgcg	Protospacer
*************** * *****

29. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NZ_CP011600 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-215, complete sequence) position: , mismatch: 3, identity: 0.87

cggccttggccgccgacgctgcg	CRISPR spacer
tggcctcggccgccgacgctgcc	Protospacer
.*****.*************** 

30. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NZ_AP018757 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_1, complete sequence) position: , mismatch: 3, identity: 0.87

cggccttggccgccgacgctgcg	CRISPR spacer
tggcctcggccgccgacgctgcc	Protospacer
.*****.*************** 

31. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 3, identity: 0.87

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgacgccacc	Protospacer
*******************..* 

32. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 3, identity: 0.87

cggccttggccgccgacgctgcg	CRISPR spacer
cggccttggccgccgacgccggc	Protospacer
*******************.*  

33. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to NZ_CP026189 (Enterobacteriaceae bacterium ENNIH2 plasmid pENT-812c, complete sequence) position: , mismatch: 3, identity: 0.87

cggccttggccgccgacgctgcg	CRISPR spacer
tggcctcggccgccgacgctgcc	Protospacer
.*****.*************** 

34. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to KR053197 (Gordonia phage GRU3, complete genome) position: , mismatch: 3, identity: 0.87

cggccttggccgccgacgctgcg	CRISPR spacer
acgcctcggccgccgacgctgcg	Protospacer
  ****.****************

35. spacer 1.3|282551|23|NZ_CP017750|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 3, identity: 0.87

cggccttggccgccgacgctgcg	CRISPR spacer
acgccttggccgccgacggtgcg	Protospacer
  **************** ****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18864 : 84899 58 Salmonella_phage(20.0%) integrase,transposase attL 13562:13577|attR 35033:35048
DBSCAN-SWA_2 321201 : 373589 44 Salmonella_phage(15.38%) integrase,transposase attL 318388:318405|attR 374505:374522
DBSCAN-SWA_3 450280 : 514781 55 Bacillus_phage(18.75%) integrase,transposase attL 450862:450881|attR 483002:483021
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017749
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017749_1 2242540-2242636 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017749_2 3082763-3082865 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6006 : 18507 17 Pseudomonas_phage(36.36%) integrase attL 5244:5259|attR 22887:22902
DBSCAN-SWA_2 3579477 : 3618469 52 Burkholderia_phage(50.0%) head,terminase,tail NA
DBSCAN-SWA_3 3626829 : 3651822 36 Burkholderia_phage(31.82%) integrase,tail attL 3623291:3623304|attR 3639728:3639741
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP017748
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017748_1 2265899-2265992 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017748_2 2298980-2299088 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017748_3 2627308-2627442 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 168408 : 175451 9 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_2 444527 : 478656 26 Erwinia_phage(25.0%) transposase NA
DBSCAN-SWA_3 1281551 : 1290500 8 Tupanvirus(16.67%) NA NA
DBSCAN-SWA_4 3499606 : 3560496 53 Bacillus_phage(16.67%) transposase,tRNA,integrase attL 3492242:3492258|attR 3565133:3565149
DBSCAN-SWA_5 4429002 : 4478717 65 Pseudomonas_phage(25.81%) plate,coat,integrase,tail,terminase attL 4426075:4426091|attR 4437830:4437846
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage