Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 1 crisprs csa3,cas1,cas3-cas2,cas8f,cas5f,cas7f,cas6f 0 15 2 0
NZ_CP015170 Acetobacter ascendens strain LMG 1591 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP015168 Acetobacter ascendens strain LMG 1591 chromosome, complete genome 0 crisprs cas3,c2c9_V-U4,DinG,WYL,DEDDh 0 0 15 0
NZ_CP015171 Acetobacter ascendens strain LMG 1591 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP015169
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015169_1 64197-65125 TypeI-F I-F
15 spacers
cas1,cas3-cas2,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015169_1 1.1|64225|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64225-64256 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64225-64256 0 1.0
NZ_CP015169_1 1.2|64285|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64285-64316 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64285-64316 0 1.0
NZ_CP015169_1 1.3|64345|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64345-64376 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64345-64376 0 1.0
NZ_CP015169_1 1.4|64405|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64405-64436 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64405-64436 0 1.0
NZ_CP015169_1 1.5|64465|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64465-64496 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64465-64496 0 1.0
NZ_CP015169_1 1.6|64525|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64525-64556 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64525-64556 0 1.0
NZ_CP015169_1 1.7|64585|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64585-64616 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64585-64616 0 1.0
NZ_CP015169_1 1.8|64645|33|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64645-64677 33 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64645-64677 0 1.0
NZ_CP015169_1 1.9|64706|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64706-64737 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64706-64737 0 1.0
NZ_CP015169_1 1.10|64766|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64766-64797 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64766-64797 0 1.0
NZ_CP015169_1 1.11|64826|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64826-64857 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64826-64857 0 1.0
NZ_CP015169_1 1.12|64886|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64886-64917 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64886-64917 0 1.0
NZ_CP015169_1 1.13|64946|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64946-64977 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 64946-64977 0 1.0
NZ_CP015169_1 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65006-65037 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 65006-65037 0 1.0
NZ_CP015169_1 1.15|65066|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65066-65097 32 NZ_CP015169 Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence 65066-65097 0 1.0
NZ_CP015169_1 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65006-65037 32 MH576962 Streptomyces phage Satis, complete genome 141214-141245 8 0.75
NZ_CP015169_1 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65006-65037 32 MK620894 Streptomyces phage Kradal, complete genome 140877-140908 8 0.75
NZ_CP015169_1 1.3|64345|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64345-64376 32 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 118260-118291 9 0.719
NZ_CP015169_1 1.11|64826|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64826-64857 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 649764-649795 9 0.719
NZ_CP015169_1 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65006-65037 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1482147-1482178 9 0.719
NZ_CP015169_1 1.6|64525|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64525-64556 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1354281-1354312 10 0.688
NZ_CP015169_1 1.9|64706|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64706-64737 32 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 490250-490281 10 0.688
NZ_CP015169_1 1.9|64706|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 64706-64737 32 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 443690-443721 10 0.688
NZ_CP015169_1 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65006-65037 32 NZ_CP020927 Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence 156698-156729 10 0.688
NZ_CP015169_1 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65006-65037 32 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 182062-182093 10 0.688
NZ_CP015169_1 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65006-65037 32 NZ_CP042821 Octadecabacter sp. SW4 plasmid pow42, complete sequence 74976-75007 10 0.688
NZ_CP015169_1 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65006-65037 32 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 142940-142971 10 0.688
NZ_CP015169_1 1.15|65066|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT 65066-65097 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 30818-30849 10 0.688

1. spacer 1.1|64225|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

atccagcggaacagttggacataagcccggaa	CRISPR spacer
atccagcggaacagttggacataagcccggaa	Protospacer
********************************

2. spacer 1.2|64285|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcgtcaaaagcccgtatgcggtggaacgtca	CRISPR spacer
ttcgtcaaaagcccgtatgcggtggaacgtca	Protospacer
********************************

3. spacer 1.3|64345|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ataatctgacgccaagaacacctgatcctttt	CRISPR spacer
ataatctgacgccaagaacacctgatcctttt	Protospacer
********************************

4. spacer 1.4|64405|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaatgagagcattagccgcaactgtctggtt	CRISPR spacer
gcaatgagagcattagccgcaactgtctggtt	Protospacer
********************************

5. spacer 1.5|64465|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaaccgtgcccagtctcttgcggcatcttggt	CRISPR spacer
aaaccgtgcccagtctcttgcggcatcttggt	Protospacer
********************************

6. spacer 1.6|64525|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gctgccgcacgttggggtattggcatcactga	CRISPR spacer
gctgccgcacgttggggtattggcatcactga	Protospacer
********************************

7. spacer 1.7|64585|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

atcaatccaatttttccggcgctccatccaac	CRISPR spacer
atcaatccaatttttccggcgctccatccaac	Protospacer
********************************

8. spacer 1.8|64645|33|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcagcagatatgttctagggactgcccaagca	CRISPR spacer
tgcagcagatatgttctagggactgcccaagca	Protospacer
*********************************

9. spacer 1.9|64706|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tctttttgccggtaaagtctggaaggtagccg	CRISPR spacer
tctttttgccggtaaagtctggaaggtagccg	Protospacer
********************************

10. spacer 1.10|64766|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaccggggcggattttcacgcgcaacgtatt	CRISPR spacer
tgaccggggcggattttcacgcgcaacgtatt	Protospacer
********************************

11. spacer 1.11|64826|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

atgcagcgaaatctgcaagagaggccgcaacc	CRISPR spacer
atgcagcgaaatctgcaagagaggccgcaacc	Protospacer
********************************

12. spacer 1.12|64886|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tacgagcagggcagtgggactgtttacgttct	CRISPR spacer
tacgagcagggcagtgggactgtttacgttct	Protospacer
********************************

13. spacer 1.13|64946|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatacaacgggccaacgacgatatcagtgc	CRISPR spacer
aacatacaacgggccaacgacgatatcagtgc	Protospacer
********************************

14. spacer 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcaatggtgggcgacgcggccccggccttt	CRISPR spacer
tcgcaatggtgggcgacgcggccccggccttt	Protospacer
********************************

15. spacer 1.15|65066|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015169 (Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caaggctctgacgtaaatattgaatgggttgc	CRISPR spacer
caaggctctgacgtaaatattgaatgggttgc	Protospacer
********************************

16. spacer 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 8, identity: 0.75

tcgcaatggtgggcgacgcggccccggccttt	CRISPR spacer
cgaccatggtgggcgacgcggccagggccgct	Protospacer
. .* ******************  **** .*

17. spacer 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 8, identity: 0.75

tcgcaatggtgggcgacgcggccccggccttt	CRISPR spacer
cgaccatggtgggcgacgcggccagggccgct	Protospacer
. .* ******************  **** .*

18. spacer 1.3|64345|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 9, identity: 0.719

ataatctgacgccaagaacacctgatcctttt	CRISPR spacer
ttcccgagacgccaagaacacctgattcatta	Protospacer
 *  .  *******************.* ** 

19. spacer 1.11|64826|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 9, identity: 0.719

atgcagcgaaatctgcaagagaggccgcaacc	CRISPR spacer
gcgcagcgatatctgcacgagaggcaagactc	Protospacer
..******* ******* ******* . * .*

20. spacer 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcaatggtgggcgacgcggccccggccttt	CRISPR spacer
tccgtttgctgggcgacgcagccccggccgga	Protospacer
**    ** **********.*********   

21. spacer 1.6|64525|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688

gctgccgcacgttggggtattggcatcactga	CRISPR spacer
gctgccgcacgttgaggtactggtggggcgcc	Protospacer
**************.****.***..  .*   

22. spacer 1.9|64706|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tctttttgccggtaaagtctggaaggtagccg	CRISPR spacer
cgatttagccgggaaagtctggaaggcgatct	Protospacer
.  *** ***** *************....* 

23. spacer 1.9|64706|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 10, identity: 0.688

tctttttgccggtaaagtctggaaggtagccg	CRISPR spacer
cgatttagccgggaaagtctggaaggcgatct	Protospacer
.  *** ***** *************....* 

24. spacer 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020927 (Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcaatggtgggcgacgcggccccggccttt	CRISPR spacer
gagcagtggtgggcgatgcggccccccctccc	Protospacer
  ***.**********.********  *....

25. spacer 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcaatggtgggcgacgcggccccggccttt	CRISPR spacer
gagcagtggtgggcgatgcggccccccctccc	Protospacer
  ***.**********.********  *....

26. spacer 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042821 (Octadecabacter sp. SW4 plasmid pow42, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcaatggtgggcgacgcggccccggccttt	CRISPR spacer
acacaatggtggccgacacggccccgtttggc	Protospacer
 *.********* ****.******** ..  .

27. spacer 1.14|65006|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcaatggtgggcgacgcggccccggccttt	CRISPR spacer
gagcagtggtgggcgatgcggccccccctccc	Protospacer
  ***.**********.********  *....

28. spacer 1.15|65066|32|NZ_CP015169|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

caaggctctgacgtaaatattgaatgggttgc	CRISPR spacer
gaccatgctgacattaatattgaatgggttca	Protospacer
 *  .. *****.* ***************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 94378 : 124730 20 Streptococcus_phage(62.5%) transposase NA
DBSCAN-SWA_2 129676 : 195756 55 Streptococcus_phage(35.0%) integrase,tRNA,transposase attL 124777:124795|attR 201281:201299
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015170
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6025 : 74721 55 Streptococcus_phage(33.33%) integrase,tRNA,transposase attL 3509:3523|attR 13019:13033
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP015168
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 83990 : 210358 103 Aeromonas_phage(18.75%) transposase,tail,plate,terminase NA
DBSCAN-SWA_2 219761 : 269809 48 Paenibacillus_phage(50.0%) transposase NA
DBSCAN-SWA_3 373109 : 485391 114 Paenibacillus_phage(12.0%) transposase,tail,tRNA,portal,protease,integrase attL 393729:393744|attR 418664:418679
DBSCAN-SWA_4 799024 : 850297 40 Enterobacteria_phage(18.75%) transposase,tRNA,protease,integrase attL 841685:841744|attR 854510:855054
DBSCAN-SWA_5 1048110 : 1089223 38 Leptospira_phage(12.5%) transposase,integrase attL 1045972:1045989|attR 1088876:1088893
DBSCAN-SWA_6 1136345 : 1244480 89 Paenibacillus_phage(29.41%) transposase,tRNA,bacteriocin NA
DBSCAN-SWA_7 1269207 : 1335955 44 uncultured_Mediterranean_phage(30.77%) transposase,tRNA,protease NA
DBSCAN-SWA_8 1342130 : 1400552 42 Streptococcus_phage(55.56%) transposase,tRNA NA
DBSCAN-SWA_9 1495701 : 1671815 162 Streptococcus_phage(10.64%) transposase,tail,plate,head,capsid,terminase,tRNA,portal,protease,integrase attL 1628670:1628684|attR 1659470:1659484
DBSCAN-SWA_10 1819516 : 1889524 56 Streptococcus_phage(18.18%) transposase,tRNA,protease NA
DBSCAN-SWA_11 1900008 : 1969007 51 Streptococcus_phage(36.36%) transposase,tRNA NA
DBSCAN-SWA_12 1983296 : 2059667 51 Streptococcus_phage(41.18%) transposase NA
DBSCAN-SWA_13 2067406 : 2160807 52 Streptococcus_phage(33.33%) transposase,tRNA NA
DBSCAN-SWA_14 2207552 : 2249818 38 Bacillus_phage(18.18%) transposase,integrase attL 2218348:2218370|attR 2251763:2251785
DBSCAN-SWA_15 2633557 : 2685787 45 Prochlorococcus_phage(11.11%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage