Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017415 Acidihalobacter prosperus strain F5 chromosome, complete genome 1 crisprs DEDDh,csa3,DinG,cas14j,c2c9_V-U4,cas3,PrimPol,RT 0 1 6 0

Results visualization

1. NZ_CP017415
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017415_1 244492-244571 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017415_1 1.1|244517|30|NZ_CP017415|CRISPRCasFinder 244517-244546 30 NZ_CP046917 Paraburkholderia sp. DHF22 plasmid p1, complete sequence 19196-19225 8 0.733

1. spacer 1.1|244517|30|NZ_CP017415|CRISPRCasFinder matches to NZ_CP046917 (Paraburkholderia sp. DHF22 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

aattttcctcggcagctaacgcgccttgct	CRISPR spacer
tctgcttatcggcatctaacgcgccttgcc	Protospacer
  * .*. ****** **************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22513 : 74202 58 Virus_Rctr41k(11.11%) transposase,integrase,protease attL 21495:21511|attR 80037:80053
DBSCAN-SWA_2 1381611 : 1446789 51 Bacillus_phage(23.53%) transposase,integrase,tRNA attL 1422140:1422156|attR 1437463:1437479
DBSCAN-SWA_3 1507322 : 1544614 35 Leptospira_phage(20.0%) transposase NA
DBSCAN-SWA_4 1558911 : 1606314 43 Acidithiobacillus_phage(20.0%) transposase,tRNA NA
DBSCAN-SWA_5 1968114 : 2038517 56 uncultured_Caudovirales_phage(13.33%) transposase,integrase,tRNA attL 1962714:1962729|attR 2029532:2029547
DBSCAN-SWA_6 2098667 : 2141129 49 Microcystis_virus(18.18%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage