1. spacer 1.1|463002|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
2. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
3. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
4. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
5. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
6. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
7. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
8. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
9. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
10. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
11. spacer 1.1|463002|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
12. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
13. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
14. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
15. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
16. spacer 1.1|463002|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
17. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
18. spacer 1.1|463002|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
19. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
20. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
21. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
22. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
23. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
24. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
25. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
26. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
27. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
28. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
29. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
30. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
31. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
32. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
33. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
34. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
35. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
36. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
37. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
38. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
39. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
40. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
41. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
42. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
43. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
44. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
45. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
46. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
47. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
48. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
49. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
50. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
51. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
52. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
53. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
54. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
55. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
56. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
57. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
58. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
59. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
60. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
61. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
62. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
63. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
64. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
65. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
66. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
67. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
68. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
69. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
70. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
71. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
72. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
73. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
74. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
75. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
76. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
77. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
78. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
79. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
80. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
81. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
82. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
83. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
84. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
85. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
86. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
87. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
88. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
89. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
90. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
91. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
92. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
93. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
94. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
95. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
96. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
97. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
98. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
99. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
100. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
101. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
102. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
103. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
104. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
105. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
106. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
107. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
108. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
109. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
110. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
111. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
112. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
113. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
114. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
115. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
116. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
117. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
118. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
119. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
120. spacer 1.3|463086|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
121. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
122. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
123. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
124. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
125. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
126. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
127. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
128. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
129. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
130. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
131. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
132. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
133. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
134. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
135. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
136. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
137. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
138. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
139. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
140. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
141. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
142. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
143. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
144. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
145. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
146. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
147. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
148. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
149. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
150. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
151. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
152. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
153. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
154. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
155. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
156. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
157. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
158. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
159. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
160. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
161. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
162. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
163. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
164. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
165. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
166. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
167. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
168. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
169. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
170. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
171. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
172. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
173. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
174. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
175. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
176. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
177. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
178. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
179. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
180. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
181. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
182. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
183. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
184. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
185. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
186. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
187. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
188. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
189. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
190. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
191. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
192. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
193. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
194. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
195. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
196. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
197. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
198. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
199. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
200. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
201. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
202. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
203. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
204. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
205. spacer 1.4|463128|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
206. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
207. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
208. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
209. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
210. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
211. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
212. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
213. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
214. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
215. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
216. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
217. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
218. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
219. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
220. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
221. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
222. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
223. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
224. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
225. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
226. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
227. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
228. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
229. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
230. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
231. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
232. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
233. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
234. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
235. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
236. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
237. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
238. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
239. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
240. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
241. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
242. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
243. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
244. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
245. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
246. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
247. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
248. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
249. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
250. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
251. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
252. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
253. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
254. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
255. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
256. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
257. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
258. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
259. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
260. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
261. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
262. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
263. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP033961 (Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
264. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP033961 (Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
265. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
266. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
267. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
268. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
269. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
270. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
271. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
272. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
273. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
274. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
275. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
276. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
277. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
278. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
279. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
280. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
281. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
282. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
283. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
284. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
285. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
286. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
287. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
288. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
289. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
290. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
291. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
292. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
293. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
294. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
295. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
296. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
297. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
298. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
299. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
300. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
301. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
302. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
303. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
304. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
305. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
306. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
307. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
308. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
309. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
310. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
311. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
312. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
313. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
314. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
315. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
316. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
317. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
318. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
319. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
320. spacer 1.4|463128|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
321. spacer 1.4|463128|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
322. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
323. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
324. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
325. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
326. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
327. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
328. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
329. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
330. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
331. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
332. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
333. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
334. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
335. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
336. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
337. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
338. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
339. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
340. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
341. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
342. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
343. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
344. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
345. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
346. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
347. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
348. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
349. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
350. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
351. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
352. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
353. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
354. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
355. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
356. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
357. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
358. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
359. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
360. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
361. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
362. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
363. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
364. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
365. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
366. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
367. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
368. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
369. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
370. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
371. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
372. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
373. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
374. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
375. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
376. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
377. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
378. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
379. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
380. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
381. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
382. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
383. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
384. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
385. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
386. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
387. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
388. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
389. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
390. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
391. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
392. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
393. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
394. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
395. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
396. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
397. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
398. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
399. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
400. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
401. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
402. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
403. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
404. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
405. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
406. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
407. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
408. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
409. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
410. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
411. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
412. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
413. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
414. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
415. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
416. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
417. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
418. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
419. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
420. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
421. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
422. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
423. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
424. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
425. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
426. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
427. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
428. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
429. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
430. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
431. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
432. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
433. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
434. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
435. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
436. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
437. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
438. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
439. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
440. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
441. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
442. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
443. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
444. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
445. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
446. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
447. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
448. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
449. spacer 1.4|463128|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
450. spacer 1.4|463128|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
451. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
452. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
453. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
454. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
455. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
456. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
457. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
458. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP040534 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
459. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP040534 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctt Protospacer
*********************
460. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
461. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
462. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
463. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
464. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
465. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
466. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
467. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
468. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
469. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
470. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
471. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
472. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
473. spacer 1.5|463170|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
474. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
475. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
476. spacer 1.5|463170|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
477. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
478. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
479. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
480. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
481. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
482. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
483. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
484. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
485. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
486. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
487. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
488. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgacggtgctc Protospacer
*********************
489. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
490. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
491. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
492. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
493. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
494. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
495. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
496. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
497. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
498. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
499. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
500. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
501. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
502. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
503. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
504. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
505. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
506. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
507. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
508. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
509. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
510. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
511. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
512. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
513. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
514. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
515. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
516. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
517. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
518. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
519. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
520. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
521. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
522. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
523. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
524. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
525. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
526. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
527. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
528. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
529. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
530. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
531. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
532. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
533. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
534. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
535. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
536. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
537. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
538. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
539. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
540. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
541. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
542. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
543. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
544. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
545. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
546. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
547. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
548. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
549. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
550. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
551. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
552. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
553. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
554. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
555. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgctc Protospacer
*********************
556. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
557. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
558. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
559. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
560. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
561. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
562. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
563. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
564. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
565. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
566. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
567. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
568. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
569. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
570. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
571. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
572. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
573. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
574. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
575. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
576. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
577. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
578. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
579. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
580. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
581. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
582. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
583. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
584. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
585. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
586. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
587. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
588. spacer 1.7|463254|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
589. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
590. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
591. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
592. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
593. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
594. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
595. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
596. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
597. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
598. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
599. spacer 1.7|463254|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
600. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
601. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
602. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
603. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
604. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
605. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
606. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
607. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
608. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
609. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
610. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
611. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
612. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
613. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
614. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
615. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
616. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
617. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
618. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
619. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
620. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
621. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
622. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
623. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
624. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
625. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
626. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
627. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
628. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
629. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
630. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
631. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
632. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
633. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
634. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
635. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
636. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
637. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
638. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
639. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
640. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
641. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
642. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
643. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
644. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
645. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
646. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
647. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
648. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
649. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
650. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
651. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
652. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
653. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
654. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
655. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
656. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
657. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
658. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
659. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
660. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
661. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
662. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
663. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
664. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
665. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
666. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
667. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
668. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
669. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
670. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
671. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
672. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
673. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
674. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
675. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
676. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
677. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
678. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
679. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
680. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
681. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
682. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
683. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
684. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
685. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
686. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
687. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
688. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
689. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
690. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
691. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
692. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
693. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
694. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
695. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
696. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
697. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
698. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
699. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
700. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
701. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
702. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
703. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
704. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
705. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
706. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
707. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
708. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
709. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
710. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
711. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
712. spacer 1.7|463254|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
713. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
714. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
715. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
716. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
717. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
718. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
719. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
720. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
721. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
722. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
723. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
724. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
725. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
726. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
727. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
728. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
729. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
730. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
731. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
732. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
733. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
734. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
735. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
736. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
737. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
738. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgccggtgctc Protospacer
*********************
739. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
740. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
741. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
742. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
743. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
744. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
745. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
746. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
747. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
748. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
749. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
750. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
751. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
752. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
*********************
753. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
754. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
755. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
756. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
757. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
758. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
759. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
760. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
761. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
762. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
763. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
764. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
765. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
766. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
767. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
768. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
769. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
770. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
771. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
772. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
773. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
774. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
775. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
776. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
777. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
778. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
779. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
780. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
781. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
782. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
783. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
784. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
785. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
786. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
787. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
788. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
789. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
790. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
791. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
792. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
793. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
794. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
795. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
796. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
797. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
798. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
799. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
800. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
801. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
802. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
803. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
804. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
805. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
806. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
807. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
808. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
809. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
810. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
811. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
812. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
813. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
814. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
815. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
816. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
817. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
818. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
819. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
820. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
821. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
822. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
823. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
824. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
825. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
826. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
827. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
828. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
829. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
830. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
831. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
832. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
833. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
834. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
835. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
836. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
837. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
838. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
839. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
840. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
841. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
842. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
843. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
844. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
845. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
846. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
847. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
848. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
849. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
850. spacer 1.11|463422|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
851. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
852. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
853. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
854. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
855. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
856. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
857. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
858. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
859. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
860. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
861. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
862. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
863. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
864. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
865. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
866. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
867. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
868. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
869. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
870. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*********************
871. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
872. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
873. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
874. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
875. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
876. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
877. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
878. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
879. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
880. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
881. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
882. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
883. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
884. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
885. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
886. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
887. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
888. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
889. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
890. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
891. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
892. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
893. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
894. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
895. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
896. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
897. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
898. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
899. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
900. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
901. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
902. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
903. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
904. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
905. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
906. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
907. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
908. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
909. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
910. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
911. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
912. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
913. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
914. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
915. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
916. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
917. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
918. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
919. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
920. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
921. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
922. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
923. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
924. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
925. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
926. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
927. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
928. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
929. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
930. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
931. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
932. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
933. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
934. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
935. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
936. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
937. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
938. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
939. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
940. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
941. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
942. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
943. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
944. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
945. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
946. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
947. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
948. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
949. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
950. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
951. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
952. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
953. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
954. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
955. spacer 1.13|463506|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
956. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
957. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
958. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
959. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
960. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
961. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
962. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
963. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
964. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
965. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
966. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
967. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
968. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
969. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
970. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
971. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
972. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
973. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
974. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
975. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
976. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
977. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
978. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
979. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
980. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
981. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
982. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
983. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
984. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
985. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
986. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
987. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
988. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
989. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
990. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
991. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
992. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
993. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
994. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
995. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
996. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
997. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
998. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
999. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1000. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1001. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1002. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1003. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1004. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1005. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1006. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1007. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1008. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1009. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1010. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1011. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1012. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1013. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1014. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1015. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1016. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1017. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1018. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1019. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
1020. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1021. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1022. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1023. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1024. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1025. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1026. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1027. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1028. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1029. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1030. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1031. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1032. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1033. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1034. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1035. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1036. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1037. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1038. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1039. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1040. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1041. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1042. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1043. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1044. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1045. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1046. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1047. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1048. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1049. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1050. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1051. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1052. spacer 1.14|463548|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1053. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1054. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1055. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1056. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1057. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1058. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1059. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1060. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1061. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1062. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1063. spacer 1.14|463548|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1064. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1065. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1066. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1067. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1068. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1069. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1070. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1071. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1072. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1073. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1074. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1075. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1076. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1077. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1078. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1079. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1080. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1081. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1082. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1083. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1084. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1085. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1086. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1087. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1088. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1089. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1090. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1091. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1092. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1093. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1094. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1095. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1096. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1097. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1098. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1099. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1100. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1101. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1102. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1103. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1104. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1105. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1106. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1107. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1108. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1109. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1110. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1111. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1112. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1113. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1114. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1115. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1116. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1117. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1118. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1119. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1120. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1121. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1122. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1123. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1124. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1125. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1126. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1127. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1128. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1129. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1130. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1131. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1132. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1133. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1134. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1135. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1136. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1137. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1138. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1139. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1140. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1141. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1142. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1143. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1144. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1145. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1146. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1147. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1148. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1149. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1150. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1151. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1152. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1153. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1154. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1155. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1156. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1157. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1158. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1159. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1160. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1161. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1162. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1163. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1164. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1165. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1166. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1167. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1168. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1169. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1170. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1171. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1172. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1173. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1174. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1175. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1176. spacer 1.14|463548|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1177. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1178. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1179. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1180. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1181. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1182. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1183. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1184. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1185. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1186. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1187. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
1188. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1189. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1190. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1191. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1192. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1193. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1194. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1195. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1196. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1197. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1198. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1199. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1200. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1201. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1202. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1203. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1204. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1205. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1206. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1207. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1208. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1209. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1210. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1211. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1212. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1213. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1214. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1215. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1216. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1217. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1218. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1219. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1220. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1221. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1222. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1223. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1224. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1225. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1226. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1227. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1228. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1229. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1230. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1231. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1232. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1233. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1234. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1235. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1236. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1237. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1238. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1239. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1240. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1241. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1242. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1243. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1244. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1245. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1246. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1247. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1248. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1249. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1250. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1251. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1252. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1253. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1254. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1255. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1256. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1257. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1258. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1259. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1260. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
1261. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1262. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1263. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1264. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1265. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1266. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1267. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1268. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1269. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1270. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1271. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1272. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1273. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1274. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1275. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1276. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1277. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1278. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1279. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1280. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1281. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1282. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1283. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1284. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1285. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1286. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1287. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1288. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1289. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1290. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1291. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1292. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1293. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1294. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1295. spacer 1.16|463632|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1296. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1297. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1298. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1299. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1300. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1301. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1302. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1303. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1304. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1305. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1306. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1307. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1308. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1309. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1310. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1311. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1312. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1313. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1314. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1315. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1316. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1317. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1318. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1319. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1320. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1321. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1322. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1323. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1324. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1325. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1326. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1327. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1328. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1329. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1330. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1331. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1332. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1333. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1334. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1335. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1336. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1337. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1338. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1339. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1340. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1341. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1342. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1343. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1344. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1345. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1346. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1347. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1348. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1349. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1350. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1351. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1352. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1353. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1354. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1355. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1356. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1357. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1358. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1359. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1360. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1361. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1362. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1363. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1364. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1365. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1366. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1367. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1368. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1369. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1370. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1371. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1372. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1373. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1374. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1375. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1376. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1377. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1378. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1379. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1380. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1381. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1382. spacer 1.16|463632|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1383. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1384. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1385. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1386. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1387. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1388. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1389. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1390. spacer 1.16|463632|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1391. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1392. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1393. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1394. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1395. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1396. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1397. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1398. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1399. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1400. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1401. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1402. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1403. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1404. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1405. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1406. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1407. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1408. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1409. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1410. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1411. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1412. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1413. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1414. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1415. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1416. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1417. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1418. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1419. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1420. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1421. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1422. spacer 1.16|463632|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1423. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1424. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1425. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1426. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1427. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1428. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1429. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1430. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1431. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1432. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1433. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1434. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1435. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1436. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1437. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1438. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1439. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1440. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1441. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1442. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1443. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1444. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1445. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1446. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1447. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1448. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1449. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1450. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1451. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1452. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1453. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1454. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1455. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1456. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1457. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1458. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1459. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1460. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1461. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1462. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1463. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1464. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1465. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1466. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1467. spacer 1.17|463674|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1468. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1469. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1470. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1471. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1472. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1473. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1474. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1475. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1476. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1477. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1478. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1479. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1480. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1481. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1482. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1483. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1484. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1485. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1486. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1487. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1488. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1489. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1490. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1491. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1492. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1493. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1494. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1495. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1496. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1497. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1498. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1499. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1500. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1501. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1502. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1503. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1504. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1505. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1506. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1507. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1508. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1509. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1510. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1511. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1512. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1513. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1514. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1515. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1516. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1517. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1518. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1519. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1520. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1521. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1522. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1523. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1524. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1525. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1526. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1527. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1528. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1529. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1530. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1531. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1532. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1533. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1534. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1535. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1536. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1537. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1538. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1539. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1540. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1541. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1542. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1543. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1544. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1545. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1546. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1547. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1548. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1549. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1550. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1551. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1552. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1553. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1554. spacer 1.17|463674|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1555. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1556. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1557. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1558. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1559. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1560. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1561. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1562. spacer 1.17|463674|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1563. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1564. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1565. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1566. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1567. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1568. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1569. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1570. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1571. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1572. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1573. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1574. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1575. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1576. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1577. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1578. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1579. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1580. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1581. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1582. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1583. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1584. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1585. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1586. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1587. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1588. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1589. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1590. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1591. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1592. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1593. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1594. spacer 1.17|463674|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1595. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1596. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1597. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1598. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1599. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1600. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1601. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1602. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1603. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1604. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
1605. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1606. spacer 1.18|463716|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1607. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1608. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1609. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1610. spacer 1.18|463716|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1611. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1612. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1613. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1614. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1615. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1616. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1617. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1618. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1619. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1620. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1621. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1622. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1623. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1624. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1625. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1626. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1627. spacer 1.18|463716|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1628. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1629. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1630. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1631. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1632. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1633. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1634. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1635. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1636. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1637. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1638. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1639. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1640. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1641. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1642. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1643. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1644. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
1645. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1646. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1647. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1648. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1649. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1650. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1651. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1652. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1653. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1654. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1655. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1656. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1657. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1658. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1659. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1660. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1661. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1662. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1663. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1664. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1665. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1666. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1667. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1668. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1669. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1670. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1671. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1672. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1673. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1674. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1675. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1676. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1677. spacer 1.19|463758|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1678. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1679. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1680. spacer 1.19|463758|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1681. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1682. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1683. spacer 1.19|463758|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1684. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1685. spacer 1.19|463758|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1686. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1687. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1688. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1689. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1690. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1691. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1692. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1693. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1694. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1695. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1696. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1697. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1698. spacer 1.19|463758|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1699. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1700. spacer 1.19|463758|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1701. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1702. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1703. spacer 1.19|463758|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1704. spacer 1.19|463758|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1705. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1706. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1707. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1708. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1709. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1710. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1711. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1712. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1713. spacer 1.19|463758|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1714. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1715. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1716. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1717. spacer 1.19|463758|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1718. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1719. spacer 1.19|463758|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1720. spacer 1.19|463758|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1721. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1722. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1723. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1724. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1725. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1726. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1727. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1728. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1729. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1730. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1731. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
1732. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1733. spacer 1.20|463800|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1734. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1735. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1736. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1737. spacer 1.20|463800|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1738. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1739. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1740. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1741. spacer 1.20|463800|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1742. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1743. spacer 1.20|463800|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1744. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1745. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1746. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1747. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1748. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1749. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1750. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1751. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1752. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1753. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1754. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1755. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1756. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1757. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1758. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1759. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1760. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1761. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1762. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1763. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1764. spacer 1.20|463800|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1765. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1766. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1767. spacer 1.20|463800|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1768. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1769. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1770. spacer 1.20|463800|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1771. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1772. spacer 1.20|463800|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1773. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1774. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1775. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1776. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1777. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1778. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1779. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1780. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1781. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1782. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1783. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1784. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1785. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1786. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1787. spacer 1.20|463800|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1788. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1789. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1790. spacer 1.20|463800|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1791. spacer 1.20|463800|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1792. spacer 1.20|463800|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1793. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1794. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1795. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1796. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1797. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1798. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1799. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1800. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1801. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1802. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1803. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1804. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1805. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
1806. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1807. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1808. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1809. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1810. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1811. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1812. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1813. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1814. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1815. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1816. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
atgtgaccgctgacggtagct Protospacer
*.*******************
1817. spacer 1.1|463002|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
atgtgaccgctgacggtagct Protospacer
*.*******************
1818. spacer 1.1|463002|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1819. spacer 1.1|463002|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1820. spacer 1.1|463002|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1821. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1822. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1823. spacer 1.1|463002|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1824. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1825. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1826. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1827. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1828. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1829. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1830. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1831. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1832. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1833. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1834. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1835. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1836. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1837. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1838. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1839. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1840. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1841. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1842. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1843. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1844. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1845. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1846. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1847. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1848. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1849. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1850. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1851. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1852. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1853. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1854. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1855. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1856. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1857. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1858. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1859. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1860. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1861. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1862. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1863. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1864. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1865. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1866. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1867. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1868. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1869. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1870. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1871. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1872. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1873. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1874. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1875. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1876. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1877. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1878. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1879. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1880. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1881. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1882. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1883. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1884. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1885. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1886. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1887. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1888. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1889. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1890. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1891. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1892. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1893. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1894. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1895. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1896. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1897. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1898. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1899. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1900. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1901. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1902. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1903. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1904. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1905. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1906. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1907. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccactgacggtggct Protospacer
********.************
1908. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1909. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1910. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1911. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1912. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1913. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1914. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1915. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1916. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1917. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1918. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1919. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1920. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1921. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1922. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1923. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1924. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1925. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1926. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1927. spacer 1.2|463044|21|NZ_CP017451|CRT matches to MF185718 (Arthrobacter phage Colucci, complete genome) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggcc Protospacer
********************.
1928. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1929. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1930. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1931. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1932. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1933. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1934. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1935. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1936. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1937. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1938. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1939. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1940. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1941. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1942. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1943. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1944. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1945. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1946. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1947. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1948. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1949. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1950. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1951. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1952. spacer 1.2|463044|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1953. spacer 1.2|463044|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1954. spacer 1.2|463044|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1955. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1956. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1957. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1958. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1959. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1960. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1961. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1962. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1963. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1964. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1965. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1966. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1967. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1968. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1969. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1970. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1971. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1972. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1973. spacer 1.2|463044|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1974. spacer 1.2|463044|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1975. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1976. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1977. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1978. spacer 1.3|463086|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1979. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1980. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1981. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1982. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1983. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1984. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
1985. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1986. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
1987. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1988. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1989. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgtcggtgctc Protospacer
************.********
1990. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1991. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1992. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1993. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1994. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1995. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1996. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1997. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1998. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1999. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2000. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2001. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2002. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2003. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2004. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2005. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2006. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2007. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2008. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2009. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2010. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2011. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2012. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2013. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2014. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2015. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2016. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2017. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2018. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2019. spacer 1.3|463086|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2020. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2021. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2022. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2023. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2024. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2025. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2026. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2027. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2028. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2029. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2030. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2031. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2032. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2033. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2034. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2035. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2036. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2037. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2038. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2039. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2040. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2041. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2042. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2043. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2044. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2045. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2046. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2047. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2048. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
2049. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2050. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2051. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2052. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2053. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2054. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2055. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2056. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2057. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2058. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2059. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2060. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2061. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2062. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2063. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2064. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
2065. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2066. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2067. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2068. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2069. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2070. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2071. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2072. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2073. spacer 1.3|463086|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgcaggtgctc Protospacer
************* *******
2074. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2075. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2076. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2077. spacer 1.3|463086|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2078. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2079. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2080. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2081. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2082. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2083. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2084. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2085. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2086. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2087. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2088. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
2089. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2090. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2091. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2092. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
2093. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2094. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2095. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2096. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2097. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2098. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2099. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2100. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2101. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2102. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2103. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2104. spacer 1.4|463128|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2105. spacer 1.4|463128|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2106. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2107. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2108. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2109. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2110. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2111. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtactt Protospacer
*****************.***
2112. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2113. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2114. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2115. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2116. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2117. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2118. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2119. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2120. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2121. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2122. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2123. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2124. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2125. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2126. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2127. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2128. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2129. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2130. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2131. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2132. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2133. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2134. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2135. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2136. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2137. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2138. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2139. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2140. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2141. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2142. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2143. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2144. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2145. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2146. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2147. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2148. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2149. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2150. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2151. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2152. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2153. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2154. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2155. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2156. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2157. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2158. spacer 1.4|463128|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2159. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2160. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2161. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2162. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2163. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2164. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2165. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2166. spacer 1.4|463128|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgaaggtgctt Protospacer
************* *******
2167. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2168. spacer 1.4|463128|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2169. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2170. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgacggtgctc Protospacer
********************.
2171. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2172. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2173. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2174. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2175. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2176. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2177. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2178. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2179. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2180. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2181. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2182. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2183. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2184. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2185. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2186. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2187. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2188. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2189. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acggggccgctgacggtgctt Protospacer
****** **************
2190. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2191. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2192. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2193. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2194. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2195. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2196. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2197. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2198. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2199. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2200. spacer 1.4|463128|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggggcgctgacggtgctt CRISPR spacer
acgggggcgctgccggtgctt Protospacer
************ ********
2201. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2202. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2203. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2204. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2205. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2206. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2207. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2208. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2209. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2210. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2211. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2212. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2213. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2214. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2215. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2216. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2217. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2218. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2219. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2220. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2221. spacer 1.5|463170|21|NZ_CP017451|CRT matches to MK392368 (Arthrobacter phage Elesar, complete genome) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgaccgtgctc Protospacer
************** ******
2222. spacer 1.5|463170|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgccggtgctc Protospacer
************ ********
2223. spacer 1.5|463170|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgccggtgctc Protospacer
************ ********
2224. spacer 1.5|463170|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgccggtgctc Protospacer
************ ********
2225. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcgggactgctgacggtgctc Protospacer
*****.***************
2226. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcgggactgctgacggtgctc Protospacer
*****.***************
2227. spacer 1.5|463170|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcgggactgctgacggtgctc Protospacer
*****.***************
2228. spacer 1.5|463170|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcgggactgctgacggtgctc Protospacer
*****.***************
2229. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2230. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2231. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2232. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2233. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgccggtgctc Protospacer
************ ********
2234. spacer 1.5|463170|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcgggactgctgacggtgctc Protospacer
*****.***************
2235. spacer 1.5|463170|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcgggactgctgacggtgctc Protospacer
*****.***************
2236. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2237. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgccggtgctc Protospacer
************ ********
2238. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggctgctgccggtgctc Protospacer
************ ********
2239. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2240. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2241. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggctgctgacggtgctc CRISPR spacer
gcggggccgctgacggtgctc Protospacer
*******.*************
2242. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
* *******************
2243. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2244. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2245. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2246. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2247. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2248. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2249. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2250. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2251. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2252. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2253. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2254. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2255. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2256. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
* *******************
2257. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
* *******************
2258. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2259. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2260. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2261. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2262. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2263. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2264. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2265. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
* *******************
2266. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
* *******************
2267. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2268. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2269. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2270. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2271. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2272. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2273. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2274. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2275. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2276. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2277. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2278. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2279. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2280. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2281. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2282. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2283. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2284. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgcta Protospacer
********************
2285. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
acggggccgctgcaggtgctc Protospacer
.********************
2286. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2287. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2288. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2289. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgcta Protospacer
********************
2290. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
acggggccgctgcaggtgctc Protospacer
.********************
2291. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2292. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2293. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2294. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgcaggtgcta Protospacer
********************
2295. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2296. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2297. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2298. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2299. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2300. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2301. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2302. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2303. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2304. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2305. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2306. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2307. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2308. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2309. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2310. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2311. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2312. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2313. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2314. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2315. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2316. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2317. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2318. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2319. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2320. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2321. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2322. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2323. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2324. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2325. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2326. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2327. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2328. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2329. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2330. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2331. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2332. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2333. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2334. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2335. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2336. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2337. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033961 (Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2338. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033961 (Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2339. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2340. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2341. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2342. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2343. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2344. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2345. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2346. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2347. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2348. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2349. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2350. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2351. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2352. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2353. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2354. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2355. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2356. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2357. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2358. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2359. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2360. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2361. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2362. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2363. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2364. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2365. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2366. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2367. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2368. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2369. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2370. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2371. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2372. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2373. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2374. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2375. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2376. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2377. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2378. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2379. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2380. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2381. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2382. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2383. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2384. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2385. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2386. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2387. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2388. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2389. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2390. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2391. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2392. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2393. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2394. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2395. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2396. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2397. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2398. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2399. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2400. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2401. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2402. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2403. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2404. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2405. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2406. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2407. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2408. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2409. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2410. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2411. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2412. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2413. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2414. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2415. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2416. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2417. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2418. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2419. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2420. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2421. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2422. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2423. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2424. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2425. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2426. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2427. spacer 1.6|463212|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2428. spacer 1.6|463212|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2429. spacer 1.6|463212|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2430. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2431. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2432. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2433. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2434. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2435. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2436. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2437. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2438. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2439. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2440. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2441. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2442. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2443. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2444. spacer 1.6|463212|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2445. spacer 1.6|463212|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2446. spacer 1.6|463212|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2447. spacer 1.6|463212|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2448. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2449. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2450. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2451. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2452. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2453. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2454. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2455. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2456. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2457. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2458. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2459. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2460. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2461. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2462. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2463. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2464. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2465. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2466. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2467. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2468. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2469. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2470. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2471. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2472. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2473. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2474. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2475. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2476. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2477. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2478. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2479. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2480. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2481. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2482. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2483. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2484. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2485. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2486. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2487. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2488. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2489. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2490. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2491. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2492. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2493. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2494. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2495. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2496. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2497. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2498. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2499. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2500. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2501. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2502. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2503. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2504. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2505. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2506. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2507. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2508. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2509. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2510. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2511. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2512. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2513. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2514. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2515. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2516. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2517. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2518. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2519. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2520. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2521. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2522. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2523. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2524. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2525. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2526. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2527. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2528. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2529. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2530. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2531. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2532. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2533. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2534. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2535. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2536. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2537. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2538. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2539. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2540. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2541. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2542. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2543. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2544. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2545. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2546. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2547. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2548. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2549. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2550. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2551. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2552. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2553. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2554. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2555. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2556. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2557. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2558. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2559. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2560. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2561. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2562. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2563. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2564. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2565. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2566. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2567. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2568. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2569. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2570. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2571. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2572. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2573. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2574. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2575. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2576. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2577. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2578. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2579. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2580. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2581. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2582. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2583. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2584. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2585. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2586. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2587. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2588. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2589. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2590. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2591. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2592. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2593. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2594. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2595. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2596. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2597. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2598. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2599. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2600. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2601. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2602. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2603. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2604. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2605. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2606. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2607. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2608. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2609. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2610. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2611. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2612. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2613. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2614. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2615. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2616. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2617. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2618. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2619. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2620. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2621. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2622. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2623. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2624. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2625. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2626. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2627. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2628. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2629. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2630. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2631. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2632. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2633. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2634. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2635. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2636. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2637. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2638. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2639. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2640. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2641. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2642. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2643. spacer 1.6|463212|21|NZ_CP017451|CRT matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2644. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2645. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2646. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2647. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2648. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2649. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2650. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2651. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2652. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2653. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2654. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2655. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2656. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgctggtgctc Protospacer
************* *******
2657. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2658. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2659. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2660. spacer 1.6|463212|21|NZ_CP017451|CRT matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2661. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2662. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2663. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2664. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2665. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2666. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2667. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2668. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2669. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2670. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2671. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2672. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2673. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2674. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2675. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2676. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2677. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2678. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2679. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2680. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2681. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2682. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2683. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040534 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2684. spacer 1.6|463212|21|NZ_CP017451|CRT matches to NZ_CP040534 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gcggggccgctgcaggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
************* *******
2685. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2686. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2687. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2688. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2689. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2690. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2691. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2692. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2693. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2694. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2695. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2696. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2697. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2698. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2699. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2700. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2701. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2702. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2703. spacer 1.7|463254|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2704. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2705. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2706. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2707. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2708. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2709. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2710. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2711. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2712. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2713. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgggggcgctgacggtggct Protospacer
****** **************
2714. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2715. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2716. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2717. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2718. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2719. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2720. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2721. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2722. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2723. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2724. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2725. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2726. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2727. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2728. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2729. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2730. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2731. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2732. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2733. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2734. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2735. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2736. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2737. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2738. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2739. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2740. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgggggcgctgacggtggct Protospacer
****** **************
2741. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2742. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2743. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2744. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2745. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2746. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2747. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2748. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2749. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2750. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2751. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2752. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2753. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2754. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2755. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2756. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2757. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2758. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2759. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2760. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2761. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2762. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2763. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2764. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2765. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2766. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2767. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2768. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2769. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2770. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2771. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2772. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2773. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2774. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2775. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2776. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2777. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2778. spacer 1.7|463254|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2779. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2780. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2781. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2782. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2783. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2784. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2785. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2786. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2787. spacer 1.7|463254|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
2788. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2789. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2790. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2791. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2792. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2793. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2794. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2795. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2796. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2797. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2798. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2799. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2800. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2801. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2802. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2803. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2804. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2805. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2806. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2807. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2808. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2809. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2810. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2811. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2812. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2813. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2814. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2815. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2816. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2817. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
2818. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2819. spacer 1.7|463254|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
2820. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
************* *******
2821. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
************* *******
2822. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
2823. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
************* *******
2824. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2825. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
2826. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2827. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2828. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2829. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2830. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2831. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2832. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
2833. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2834. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2835. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2836. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2837. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2838. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2839. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2840. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2841. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2842. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2843. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2844. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2845. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2846. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2847. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2848. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2849. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2850. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2851. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2852. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2853. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2854. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2855. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2856. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2857. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2858. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2859. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2860. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2861. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2862. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2863. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2864. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2865. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2866. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2867. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2868. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2869. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2870. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033961 (Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2871. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033961 (Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2872. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2873. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2874. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2875. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2876. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2877. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2878. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2879. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2880. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2881. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2882. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2883. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2884. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2885. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2886. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2887. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2888. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2889. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2890. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2891. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
2892. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
2893. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
2894. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2895. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2896. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2897. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2898. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2899. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2900. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2901. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2902. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2903. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2904. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2905. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2906. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2907. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2908. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2909. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2910. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2911. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2912. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2913. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2914. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2915. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2916. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2917. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2918. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2919. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2920. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2921. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2922. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2923. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2924. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2925. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2926. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2927. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2928. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2929. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2930. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2931. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2932. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2933. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2934. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2935. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2936. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2937. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2938. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2939. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2940. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2941. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2942. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2943. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2944. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2945. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2946. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2947. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2948. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2949. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2950. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2951. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2952. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2953. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2954. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2955. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2956. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2957. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2958. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2959. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2960. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2961. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2962. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2963. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2964. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2965. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2966. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2967. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2968. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2969. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2970. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2971. spacer 1.8|463296|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2972. spacer 1.8|463296|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2973. spacer 1.8|463296|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2974. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2975. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2976. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2977. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2978. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2979. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2980. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2981. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2982. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2983. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2984. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
2985. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2986. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2987. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2988. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2989. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2990. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
2991. spacer 1.8|463296|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2992. spacer 1.8|463296|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2993. spacer 1.8|463296|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2994. spacer 1.8|463296|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2995. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2996. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2997. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2998. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
2999. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3000. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3001. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3002. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3003. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3004. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3005. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3006. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3007. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
************* *******
3008. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3009. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3010. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3011. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3012. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3013. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3014. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3015. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3016. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3017. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3018. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3019. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3020. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3021. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3022. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3023. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3024. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3025. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3026. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3027. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3028. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3029. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3030. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3031. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3032. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3033. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3034. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3035. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3036. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3037. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3038. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3039. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3040. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3041. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3042. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3043. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3044. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3045. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3046. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3047. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gaggggccgctgcaggtgctc Protospacer
************* *******
3048. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3049. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3050. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3051. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3052. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3053. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3054. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3055. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3056. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3057. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3058. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3059. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3060. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3061. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3062. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3063. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3064. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3065. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3066. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3067. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3068. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3069. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3070. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3071. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3072. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3073. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3074. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3075. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3076. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3077. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3078. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3079. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3080. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3081. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3082. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3083. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3084. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3085. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3086. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3087. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3088. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3089. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3090. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3091. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3092. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3093. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3094. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3095. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3096. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3097. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3098. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3099. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3100. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3101. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3102. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3103. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3104. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3105. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3106. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3107. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3108. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3109. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3110. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3111. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3112. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3113. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3114. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3115. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3116. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3117. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3118. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3119. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3120. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3121. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3122. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3123. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3124. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3125. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3126. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3127. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3128. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3129. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3130. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3131. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3132. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3133. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3134. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3135. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3136. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3137. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3138. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3139. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3140. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3141. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3142. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3143. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3144. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3145. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3146. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3147. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3148. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3149. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3150. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3151. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3152. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3153. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3154. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3155. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3156. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3157. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3158. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3159. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3160. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3161. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3162. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3163. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3164. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3165. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3166. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3167. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3168. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3169. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3170. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3171. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3172. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3173. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3174. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3175. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3176. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3177. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3178. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3179. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3180. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3181. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3182. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3183. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3184. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3185. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3186. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3187. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3188. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3189. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3190. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3191. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3192. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3193. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3194. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3195. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3196. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3197. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3198. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3199. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3200. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3201. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3202. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3203. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3204. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3205. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3206. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3207. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3208. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3209. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3210. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3211. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3212. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3213. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3214. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3215. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3216. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3217. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3218. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3219. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3220. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3221. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3222. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3223. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3224. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3225. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3226. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3227. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3228. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3229. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3230. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3231. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3232. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3233. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3234. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3235. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3236. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3237. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3238. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3239. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3240. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3241. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3242. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3243. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3244. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3245. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3246. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3247. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3248. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3249. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3250. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3251. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3252. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3253. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3254. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3255. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3256. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3257. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3258. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3259. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3260. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3261. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3262. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3263. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3264. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3265. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3266. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3267. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3268. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3269. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3270. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3271. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3272. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3273. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3274. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3275. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3276. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3277. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3278. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3279. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3280. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3281. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3282. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3283. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gagcggccgctgccggtgctc Protospacer
*** *****************
3284. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3285. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3286. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3287. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3288. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3289. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3290. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3291. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3292. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3293. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3294. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3295. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3296. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3297. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3298. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3299. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3300. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3301. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3302. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3303. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3304. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3305. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3306. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3307. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3308. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3309. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3310. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3311. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3312. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3313. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3314. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3315. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3316. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3317. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040534 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3318. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040534 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
gaggggccgctgccggtgctc CRISPR spacer
gcggggccgctgccggtgctc Protospacer
* *******************
3319. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3320. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3321. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3322. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3323. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3324. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3325. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3326. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3327. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3328. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3329. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3330. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3331. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3332. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3333. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3334. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3335. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3336. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3337. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3338. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3339. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3340. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3341. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3342. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3343. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3344. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3345. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3346. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3347. spacer 1.9|463338|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3348. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3349. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3350. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3351. spacer 1.9|463338|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3352. spacer 1.9|463338|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3353. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3354. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3355. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3356. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3357. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3358. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3359. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3360. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3361. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3362. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3363. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3364. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3365. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3366. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3367. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3368. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3369. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3370. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3371. spacer 1.9|463338|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3372. spacer 1.9|463338|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3373. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3374. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3375. spacer 1.9|463338|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3376. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3377. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3378. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3379. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3380. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3381. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3382. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3383. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3384. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3385. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3386. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3387. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3388. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3389. spacer 1.9|463338|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3390. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3391. spacer 1.9|463338|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgaaggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
************* *******
3392. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3393. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3394. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3395. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3396. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3397. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3398. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3399. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3400. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3401. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3402. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3403. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3404. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3405. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3406. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3407. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3408. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3409. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3410. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3411. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3412. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3413. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3414. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3415. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3416. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3417. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3418. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3419. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3420. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3421. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3422. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3423. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3424. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3425. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3426. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3427. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3428. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3429. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3430. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3431. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3432. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3433. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3434. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3435. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3436. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3437. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3438. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3439. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3440. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3441. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3442. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3443. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3444. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3445. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3446. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3447. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3448. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3449. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3450. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3451. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3452. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3453. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3454. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3455. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3456. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3457. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3458. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3459. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3460. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3461. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3462. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3463. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3464. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3465. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3466. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3467. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3468. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3469. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3470. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3471. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgactgtggct Protospacer
************** ******
3472. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3473. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3474. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3475. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3476. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3477. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3478. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3479. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3480. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3481. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3482. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3483. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3484. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3485. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3486. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3487. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3488. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3489. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3490. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3491. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3492. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3493. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3494. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3495. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3496. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3497. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3498. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3499. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3500. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3501. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3502. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3503. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3504. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3505. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3506. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3507. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3508. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3509. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3510. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3511. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3512. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3513. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3514. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3515. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3516. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3517. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3518. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3519. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3520. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3521. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3522. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
3523. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3524. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3525. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3526. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3527. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3528. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3529. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3530. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3531. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3532. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
3533. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
3534. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3535. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3536. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3537. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3538. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3539. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3540. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3541. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3542. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3543. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3544. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3545. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3546. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3547. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3548. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3549. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3550. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3551. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3552. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3553. spacer 1.10|463380|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3554. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3555. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3556. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3557. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3558. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3559. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3560. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3561. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3562. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3563. spacer 1.10|463380|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3564. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3565. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3566. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3567. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3568. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3569. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3570. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3571. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3572. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3573. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3574. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3575. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3576. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3577. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3578. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3579. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3580. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3581. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3582. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3583. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3584. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3585. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3586. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3587. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3588. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3589. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3590. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3591. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3592. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3593. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3594. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3595. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3596. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3597. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3598. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3599. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3600. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3601. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3602. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3603. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3604. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3605. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3606. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3607. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3608. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3609. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3610. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3611. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3612. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3613. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3614. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3615. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3616. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3617. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3618. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3619. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3620. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3621. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3622. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3623. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3624. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3625. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3626. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3627. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3628. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3629. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3630. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3631. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3632. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3633. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3634. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3635. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3636. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3637. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3638. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3639. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3640. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3641. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3642. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3643. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3644. spacer 1.10|463380|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3645. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3646. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3647. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3648. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3649. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3650. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3651. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3652. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3653. spacer 1.10|463380|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
3654. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3655. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3656. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3657. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3658. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3659. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3660. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3661. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3662. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3663. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3664. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3665. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3666. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3667. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3668. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3669. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3670. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3671. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3672. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3673. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3674. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgcagacggtagct Protospacer
********** **********
3675. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3676. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3677. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3678. spacer 1.11|463422|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3679. spacer 1.11|463422|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3680. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3681. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3682. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3683. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3684. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3685. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3686. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3687. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3688. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3689. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3690. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgcagacggtagct Protospacer
********** **********
3691. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgcagacggtagct Protospacer
********** **********
3692. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3693. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3694. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3695. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3696. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3697. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3698. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3699. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3700. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3701. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3702. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3703. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3704. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3705. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3706. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3707. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3708. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3709. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3710. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3711. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3712. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3713. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3714. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3715. spacer 1.11|463422|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3716. spacer 1.11|463422|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3717. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3718. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3719. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3720. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3721. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3722. spacer 1.11|463422|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3723. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3724. spacer 1.11|463422|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3725. spacer 1.11|463422|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtagct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*****************.***
3726. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3727. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3728. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3729. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3730. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3731. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3732. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3733. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3734. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3735. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3736. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3737. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3738. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3739. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3740. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3741. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3742. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3743. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3744. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3745. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3746. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3747. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3748. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3749. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3750. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3751. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3752. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3753. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3754. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3755. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3756. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3757. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3758. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3759. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3760. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3761. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3762. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3763. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3764. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3765. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3766. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3767. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3768. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3769. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3770. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3771. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3772. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3773. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3774. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3775. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3776. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3777. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3778. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3779. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3780. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3781. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3782. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3783. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3784. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3785. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3786. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3787. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3788. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3789. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3790. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3791. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3792. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3793. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3794. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3795. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3796. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3797. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3798. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3799. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3800. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3801. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3802. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3803. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3804. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3805. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3806. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3807. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3808. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3809. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccactgacggtggct Protospacer
********.************
3810. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3811. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3812. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3813. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3814. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3815. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3816. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3817. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3818. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3819. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3820. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3821. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3822. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3823. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3824. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3825. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3826. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3827. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3828. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3829. spacer 1.12|463464|21|NZ_CP017451|CRT matches to MF185718 (Arthrobacter phage Colucci, complete genome) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggcc Protospacer
********************.
3830. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
3831. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3832. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3833. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3834. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3835. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
3836. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3837. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3838. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3839. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
3840. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
3841. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3842. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3843. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
3844. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3845. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3846. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3847. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3848. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3849. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
3850. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
3851. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3852. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3853. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3854. spacer 1.12|463464|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
3855. spacer 1.12|463464|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
3856. spacer 1.12|463464|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
3857. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
3858. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3859. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3860. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3861. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3862. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
3863. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3864. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3865. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3866. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3867. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3868. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
3869. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3870. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3871. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3872. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3873. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
3874. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
3875. spacer 1.12|463464|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
3876. spacer 1.12|463464|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
3877. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3878. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3879. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3880. spacer 1.13|463506|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3881. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3882. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3883. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3884. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3885. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3886. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
3887. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3888. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
3889. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3890. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3891. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgtcggtgctc Protospacer
************.********
3892. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3893. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3894. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3895. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3896. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3897. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3898. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3899. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3900. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3901. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3902. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3903. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3904. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3905. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3906. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3907. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3908. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3909. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3910. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3911. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3912. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3913. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3914. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3915. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3916. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3917. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3918. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3919. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3920. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3921. spacer 1.13|463506|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3922. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3923. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3924. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3925. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3926. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3927. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3928. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3929. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3930. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3931. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3932. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3933. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3934. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3935. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3936. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3937. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3938. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3939. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3940. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3941. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3942. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3943. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3944. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3945. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3946. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3947. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3948. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3949. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3950. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
3951. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3952. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3953. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3954. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3955. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3956. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3957. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3958. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3959. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3960. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3961. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3962. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3963. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3964. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3965. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3966. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
3967. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3968. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3969. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3970. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3971. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3972. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3973. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3974. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3975. spacer 1.13|463506|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgcaggtgctc Protospacer
************* *******
3976. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3977. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3978. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3979. spacer 1.13|463506|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3980. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3981. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3982. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3983. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3984. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3985. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3986. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3987. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3988. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3989. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3990. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
3991. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3992. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3993. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3994. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
3995. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
3996. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
3997. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
3998. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
3999. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4000. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4001. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4002. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4003. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4004. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4005. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4006. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4007. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4008. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4009. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4010. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4011. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4012. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4013. spacer 1.14|463548|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4014. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4015. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4016. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4017. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4018. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4019. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4020. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4021. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4022. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4023. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgggggcgctgacggtggct Protospacer
****** **************
4024. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4025. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4026. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4027. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4028. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4029. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4030. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4031. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4032. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4033. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4034. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4035. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4036. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4037. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4038. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4039. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4040. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4041. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4042. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4043. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4044. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4045. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4046. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4047. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4048. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4049. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4050. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgggggcgctgacggtggct Protospacer
****** **************
4051. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4052. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4053. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4054. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4055. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4056. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4057. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4058. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4059. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4060. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4061. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4062. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4063. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4064. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4065. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4066. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4067. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4068. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4069. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4070. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4071. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4072. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4073. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4074. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4075. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4076. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4077. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4078. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4079. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4080. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4081. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4082. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4083. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4084. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4085. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4086. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4087. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4088. spacer 1.14|463548|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4089. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4090. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4091. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4092. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4093. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4094. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4095. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4096. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4097. spacer 1.14|463548|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
4098. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4099. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4100. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4101. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4102. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4103. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4104. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4105. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4106. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4107. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4108. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4109. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4110. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4111. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4112. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4113. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4114. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4115. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4116. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4117. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4118. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4119. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4120. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4121. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4122. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4123. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4124. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4125. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4126. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4127. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
4128. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4129. spacer 1.14|463548|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
4130. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4131. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4132. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4133. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4134. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4135. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4136. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4137. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4138. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4139. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4140. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4141. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4142. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4143. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4144. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4145. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4146. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4147. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4148. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4149. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4150. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4151. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4152. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4153. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4154. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4155. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4156. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4157. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4158. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4159. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4160. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4161. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4162. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4163. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4164. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4165. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4166. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4167. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4168. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4169. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4170. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4171. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4172. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4173. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4174. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4175. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4176. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4177. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4178. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4179. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4180. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4181. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4182. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4183. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4184. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4185. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4186. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4187. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4188. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4189. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4190. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4191. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4192. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4193. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4194. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4195. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4196. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4197. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4198. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4199. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4200. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4201. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4202. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4203. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4204. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4205. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4206. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4207. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4208. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4209. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgactgtggct Protospacer
************** ******
4210. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4211. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4212. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4213. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4214. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4215. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4216. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4217. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4218. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4219. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4220. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4221. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4222. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4223. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4224. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4225. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4226. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4227. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4228. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4229. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4230. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4231. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4232. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4233. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4234. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4235. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4236. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4237. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4238. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4239. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4240. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4241. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4242. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4243. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4244. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4245. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4246. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4247. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4248. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4249. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4250. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4251. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4252. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4253. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4254. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4255. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4256. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4257. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4258. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4259. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4260. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
4261. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4262. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4263. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4264. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4265. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4266. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4267. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4268. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4269. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4270. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
4271. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
4272. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4273. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4274. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4275. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4276. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4277. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4278. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4279. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4280. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4281. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4282. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4283. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4284. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4285. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4286. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4287. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4288. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4289. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4290. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4291. spacer 1.15|463590|21|NZ_CP017451|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4292. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4293. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4294. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4295. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4296. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4297. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4298. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4299. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4300. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4301. spacer 1.15|463590|21|NZ_CP017451|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4302. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4303. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4304. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4305. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4306. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4307. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4308. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4309. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4310. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4311. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4312. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4313. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4314. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4315. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4316. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4317. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4318. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4319. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4320. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4321. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4322. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4323. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4324. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4325. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4326. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4327. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4328. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4329. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4330. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4331. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4332. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4333. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4334. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4335. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4336. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4337. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4338. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4339. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4340. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4341. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4342. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4343. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4344. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4345. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4346. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4347. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4348. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4349. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4350. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4351. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4352. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4353. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4354. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4355. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4356. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4357. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4358. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4359. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4360. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4361. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4362. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4363. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4364. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4365. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4366. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4367. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4368. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4369. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4370. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4371. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4372. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4373. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4374. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4375. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4376. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4377. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4378. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4379. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4380. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4381. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4382. spacer 1.15|463590|21|NZ_CP017451|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4383. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4384. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4385. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4386. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4387. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4388. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4389. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4390. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4391. spacer 1.15|463590|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
4392. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggaccgctgccggtagtc CRISPR spacer
acggggccgctgccggtagtc Protospacer
*****.***************
4393. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgggaccgctgccggtagtc CRISPR spacer
acggggccgctgccggtagtc Protospacer
*****.***************
4394. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggaccgctgccggtagtc CRISPR spacer
acggggccgctgccggtagtc Protospacer
*****.***************
4395. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgggaccgctgccggtagtc CRISPR spacer
acggggccgctgccggtagtc Protospacer
*****.***************
4396. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggcggctgtcggtggtc Protospacer
******* *************
4397. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acaggggcgataccagtgacc CRISPR spacer
acagggacgataccagtgacc Protospacer
******.**************
4398. spacer 1.19|463758|21|NZ_CP017451|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccggtgacc Protospacer
**************.******
4399. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4400. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4401. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgttgtcgctgctggtggtc Protospacer
**** ****************
4402. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgttgtcgctgctggtggtc Protospacer
**** ****************
4403. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4404. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4405. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4406. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4407. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4408. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4409. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4410. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4411. spacer 1.20|463800|21|NZ_CP017451|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
4412. spacer 1.3|463086|21|NZ_CP017451|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgccggtgctc CRISPR spacer
gtgtggccgctgccggtgctc Protospacer
..*******************
4413. spacer 1.5|463170|21|NZ_CP017451|CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.905
gcggggctgctgacggtgctc CRISPR spacer
caggggctgctgacggtgctc Protospacer
*******************
4414. spacer 1.7|463254|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 2, identity: 0.905
acggggccgctgacggtggct CRISPR spacer
gaggggccgctgacggtggct Protospacer
. *******************
4415. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4416. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4417. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4418. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4419. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4420. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4421. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4422. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4423. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4424. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4425. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4426. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4427. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4428. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4429. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4430. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4431. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4432. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4433. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4434. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4435. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4436. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4437. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4438. spacer 1.8|463296|21|NZ_CP017451|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4439. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4440. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4441. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4442. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4443. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4444. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4445. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4446. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4447. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4448. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4449. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4450. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4451. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4452. spacer 1.8|463296|21|NZ_CP017451|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4453. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4454. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4455. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4456. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4457. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4458. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4459. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4460. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4461. spacer 1.8|463296|21|NZ_CP017451|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 2, identity: 0.905
gaggggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
. *******************
4462. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggtc Protospacer
*******************..
4463. spacer 1.10|463380|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggtc Protospacer
*******************..
4464. spacer 1.10|463380|21|NZ_CP017451|CRT matches to MF185718 (Arthrobacter phage Colucci, complete genome) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggcc Protospacer
.*******************.
4465. spacer 1.13|463506|21|NZ_CP017451|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgccggtgctc CRISPR spacer
gtgtggccgctgccggtgctc Protospacer
..*******************
4466. spacer 1.14|463548|21|NZ_CP017451|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 2, identity: 0.905
acggggccgctgacggtggct CRISPR spacer
gaggggccgctgacggtggct Protospacer
. *******************
4467. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggtc Protospacer
*******************..
4468. spacer 1.15|463590|21|NZ_CP017451|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggtc Protospacer
*******************..
4469. spacer 1.15|463590|21|NZ_CP017451|CRT matches to MF185718 (Arthrobacter phage Colucci, complete genome) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggcc Protospacer
.*******************.
4470. spacer 1.16|463632|21|NZ_CP017451|CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 2, identity: 0.905
acgggaccgctgccggtagtc CRISPR spacer
gcgggaccgctgccggtagtt Protospacer
.*******************.
4471. spacer 1.17|463674|21|NZ_CP017451|CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 2, identity: 0.905
acgggaccgctgccggtagtc CRISPR spacer
gcgggaccgctgccggtagtt Protospacer
.*******************.
4472. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
4473. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
4474. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
4475. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
4476. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
4477. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
4478. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
4479. spacer 1.18|463716|21|NZ_CP017451|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..