Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016019 Bifidobacterium longum subsp. longum strain AH1206, complete genome 8 crisprs csa3,cas3,WYL,DEDDh,casR 0 2 0 0

Results visualization

1. NZ_CP016019
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016019_1 128288-128624 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016019_2 173835-174203 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016019_3 294698-294783 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016019_4 342283-342458 Orphan NA
2 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016019_5 834326-834399 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016019_6 1508093-1508173 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016019_7 2013155-2013240 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016019_8 2144029-2144102 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016019_2 2.5|174096|24|NZ_CP016019|CRISPRCasFinder 174096-174119 24 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 98015-98038 3 0.875
NZ_CP016019_2 2.5|174096|24|NZ_CP016019|CRISPRCasFinder 174096-174119 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1789555-1789578 4 0.833
NZ_CP016019_5 5.1|834349|28|NZ_CP016019|CRISPRCasFinder 834349-834376 28 NC_015513 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence 20967-20994 7 0.75

1. spacer 2.5|174096|24|NZ_CP016019|CRISPRCasFinder matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

atcggttccgcagccggctgccgg	CRISPR spacer
atcggttccgcagcgggcagccgt	Protospacer
************** *** **** 

2. spacer 2.5|174096|24|NZ_CP016019|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

atcggttccgcagccggctgccgg	CRISPR spacer
gtcggttccgccgccggctgcctc	Protospacer
.********** **********  

3. spacer 5.1|834349|28|NZ_CP016019|CRISPRCasFinder matches to NC_015513 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence) position: , mismatch: 7, identity: 0.75

aaacggcggaaacaagccaaaacacaga	CRISPR spacer
atacgccggaaacaagccaaaacgtttg	Protospacer
* *** *****************..  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage