Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017057 Erythrobacter litoralis strain DSM 8509 chromosome, complete genome 1 crisprs csa3,DinG,DEDDh 1 4 2 0

Results visualization

1. NZ_CP017057
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017057_1 2175489-2175703 Orphan NA
4 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP017057_1 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder 2175611-2175632 22 NZ_CP017057.1 1685000-1685021 2 0.909

1. spacer 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder matches to position: 1685000-1685021, mismatch: 2, identity: 0.909

ccgaccggttcgatcgccgcgc	CRISPR spacer
ccgaccggttcgaccggcgcgc	Protospacer
*************.** *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017057_1 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder 2175611-2175632 22 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 252866-252887 1 0.955
NZ_CP017057_1 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder 2175611-2175632 22 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 29326-29347 1 0.955
NZ_CP017057_1 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder 2175611-2175632 22 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 63132-63153 1 0.955
NZ_CP017057_1 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder 2175611-2175632 22 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 96845-96866 2 0.909
NZ_CP017057_1 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder 2175611-2175632 22 NZ_CP018172 Mesorhizobium oceanicum strain B7 plasmid unnamed1, complete sequence 97634-97655 2 0.909
NZ_CP017057_1 1.4|2175656|25|NZ_CP017057|CRISPRCasFinder 2175656-2175680 25 NC_023136 Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence 136769-136793 2 0.92
NZ_CP017057_1 1.1|2175512|22|NZ_CP017057|CRISPRCasFinder 2175512-2175533 22 NZ_CP036407 Komagataeibacter saccharivorans strain JH1 plasmid p92689, complete sequence 243-264 3 0.864
NZ_CP017057_1 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder 2175611-2175632 22 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 716219-716240 3 0.864
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_010627 Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence 478321-478351 5 0.839
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 124284-124314 5 0.839
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 446892-446922 6 0.806
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 306559-306589 6 0.806
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 220359-220389 6 0.806
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_031059 Rhodovulum phage vB_RhkS_P1, complete genome 37585-37615 6 0.806
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 458948-458978 6 0.806
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_010335 Caulobacter sp. K31 plasmid pCAUL01, complete sequence 142535-142565 7 0.774
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 186362-186392 7 0.774
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP022992 Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence 146524-146554 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 1022512-1022542 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 830083-830113 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP010729 Phaeobacter inhibens strain P88 plasmid pP88_d, complete sequence 90768-90798 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP015268 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence 59588-59618 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 21364-21394 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 14300-14330 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1304069-1304099 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 655111-655141 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 MH744418 Streptomyces phage JustBecause, complete genome 5806-5836 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 MT310898 Streptomyces phage Kela, complete genome 5797-5827 8 0.742
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1118123-1118153 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 792466-792496 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1118244-1118274 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 842343-842373 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 842335-842365 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 263188-263218 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 304127-304157 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5758820-5758850 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 254663-254693 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 842342-842372 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP029602 Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence 30832-30862 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 163615-163645 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 850801-850831 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 814047-814077 9 0.71
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 366862-366892 10 0.677
NZ_CP017057_1 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder 2175557-2175587 31 NC_017833 Streptomyces sp. FR1 plasmid pFP4, complete sequence 36721-36751 10 0.677

1. spacer 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 1, identity: 0.955

ccgaccggttcgatcgccgcgc	CRISPR spacer
gcgaccggttcgatcgccgcgc	Protospacer
 *********************

2. spacer 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

ccgaccggttcgatcgccgcgc	CRISPR spacer
ccgaccggttcgatcaccgcgc	Protospacer
***************.******

3. spacer 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.955

ccgaccggttcgatcgccgcgc	CRISPR spacer
ccgaccggttcgatcaccgcgc	Protospacer
***************.******

4. spacer 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ccgaccggttcgatcgccgcgc	CRISPR spacer
gcgaccggatcgatcgccgcgc	Protospacer
 ******* *************

5. spacer 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder matches to NZ_CP018172 (Mesorhizobium oceanicum strain B7 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ccgaccggttcgatcgccgcgc	CRISPR spacer
ccgaccggttcgctcgccgcga	Protospacer
************ ******** 

6. spacer 1.4|2175656|25|NZ_CP017057|CRISPRCasFinder matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.92

cggatcgcagggccgatcgcaggga	CRISPR spacer
cggatcgcagggccgttctcaggga	Protospacer
*************** ** ******

7. spacer 1.1|2175512|22|NZ_CP017057|CRISPRCasFinder matches to NZ_CP036407 (Komagataeibacter saccharivorans strain JH1 plasmid p92689, complete sequence) position: , mismatch: 3, identity: 0.864

ctcggcaggccgaacgccggct	CRISPR spacer
gcaggcaggccgaacgccggct	Protospacer
 . *******************

8. spacer 1.3|2175611|22|NZ_CP017057|CRISPRCasFinder matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 3, identity: 0.864

ccgaccggttcgatcgccgcgc	CRISPR spacer
acgaccggttcgatcgccgctt	Protospacer
 ******************* .

9. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 5, identity: 0.839

aaagccgcgcggatcgccgcgcg-gaccgcgt	CRISPR spacer
gaagccgcgctgatcgccgcgcgcgaactcg-	Protospacer
.********* ************ ** * ** 

10. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 5, identity: 0.839

aaagccgcgcggatcgccgcgcggaccgcgt-	CRISPR spacer
aaagccccgcggatcgcggcgcgg-cggcgct	Protospacer
****** ********** ****** * ***. 

11. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 6, identity: 0.806

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
gccgccgcgcggatcgccgcgcggatcgccg	Protospacer
.  **********************.***  

12. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 6, identity: 0.806

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
caccgcgcgaggatcgccgcgcgaaccgcgt	Protospacer
 *   **** *************.*******

13. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
agggtcggacggatcgccgcgaggaccgcgt	Protospacer
*..*.** .************ *********

14. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 6, identity: 0.806

aaagccg-cgcggatcgccgcgcggaccgcgt	CRISPR spacer
-gggccgttccggatcgccgcgctgaccgcgt	Protospacer
 ..**** . ************* ********

15. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 6, identity: 0.806

-aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tccagcc-tgcggatcgtcgcgcggacggcgt	Protospacer
   **** .********.********* ****

16. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 7, identity: 0.774

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgaggcgctgatcgccgcgccgaccgcgt	Protospacer
 . *  **** *********** ********

17. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 7, identity: 0.774

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
cagccggcgcggatcgcggcgcggatcgcgg	Protospacer
 *. * *********** *******.**** 

18. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
cgtccagcgcggatcgccgcgcggcacgcgc	Protospacer
 .  * ******************  ****.

19. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
cgcccggcgccgatcgccgcgcgcaccgcga	Protospacer
 .  * **** ************ ****** 

20. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
caagccgcgcggatcgccgctcgcggcaagg	Protospacer
 ******************* ** . *. * 

21. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP010729 (Phaeobacter inhibens strain P88 plasmid pP88_d, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
gaagccgcgcggatcgctgcgcagaatgacg	Protospacer
.****************.****.** .*   

22. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
aaagcagctcggatcgccgcgcgagacaagc	Protospacer
***** ** **************.. *. *.

23. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
aaagcagctcggatcgccgcgcgagacaagc	Protospacer
***** ** **************.. *. *.

24. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggac-cgcgt	CRISPR spacer
gcagccgcgccgatcgccgcgccgatatacg-	Protospacer
. ******** *********** **. ..** 

25. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggac-cgcgt	CRISPR spacer
gcagccgcgccgatcgccgcgccgatatacg-	Protospacer
. ******** *********** **. ..** 

26. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
gaggtcgcgcggaccgccgcgcagaccggcc	Protospacer
.*.*.********.********.*****  .

27. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to MH744418 (Streptomyces phage JustBecause, complete genome) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
acgctcgcgcagatcgccgcccggaccggga	Protospacer
* . .*****.********* ******* * 

28. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to MT310898 (Streptomyces phage Kela, complete genome) position: , mismatch: 8, identity: 0.742

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
acgctcgcgcagatcgccgcccggaccggga	Protospacer
* . .*****.********* ******* * 

29. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgccgcgcggatcgccgcgtcgacttccg	Protospacer
 . ******************. ***. *  

30. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgccgcgcggatcgccgcgtcgacttccg	Protospacer
 . ******************. ***. *  

31. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgccgcgcggatcgccgcgtcgacttccg	Protospacer
 . ******************. ***. *  

32. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgccgcgcggatcgccgcgtcgacttccg	Protospacer
 . ******************. ***. *  

33. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgccgcgcggatcgccgcgtcgacttccg	Protospacer
 . ******************. ***. *  

34. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
aaagccgcgcggatcggcgctcgctgaggag	Protospacer
**************** *** **    * . 

35. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
ctggtggcgcggatcgccgagctgaccgctc	Protospacer
  .*. ************* ** ****** .

36. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
cgctcgccgcggatcgccgcgcgaaccccgg	Protospacer
 .  *  ****************.*** ** 

37. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
cgcgagtcgcggatcgccgcgctgatcgcgc	Protospacer
 . *   *************** **.****.

38. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgccgcgcggatcgccgcgtcgacttccg	Protospacer
 . ******************. ***. *  

39. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
ctcacgtcgctgatcgccgagcggaccgcgc	Protospacer
   .*  *** ******** **********.

40. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
aaagccgcgcggatcggcgctcgctgaggag	Protospacer
**************** *** **    * . 

41. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgccgcgcggatcgccgcgtcgacttccg	Protospacer
 . ******************. ***. *  

42. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
tgcgccgcgcggatcgccgcgtcgacttccg	Protospacer
 . ******************. ***. *  

43. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 10, identity: 0.677

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
gcgcaggcgcggatcgctgcgcgggccgctc	Protospacer
. .   ***********.******.**** .

44. spacer 1.2|2175557|31|NZ_CP017057|CRISPRCasFinder matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 10, identity: 0.677

aaagccgcgcggatcgccgcgcggaccgcgt	CRISPR spacer
gcgcaggcccggatcgccgcgcagaccgccc	Protospacer
. .   ** *************.****** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 387522 : 465331 58 Paenibacillus_phage(15.38%) transposase,protease NA
DBSCAN-SWA_2 488667 : 494974 6 Escherichia_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage