Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013395 Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 3, complete sequence 0 crisprs WYL 0 0 0 0
NZ_CP013393 Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 1, complete sequence 0 crisprs cas3,DEDDh,csa3,DinG,WYL 0 0 4 0
NZ_CP013394 Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 2, complete sequence 1 crisprs DEDDh,cas3,csa3,DinG 0 1 2 0

Results visualization

1. NZ_CP013393
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 381409 : 410660 24 Pseudomonas_phage(25.0%) transposase,protease,plate NA
DBSCAN-SWA_2 700179 : 709293 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 976070 : 984508 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_4 1268346 : 1302902 46 Ralstonia_phage(20.59%) plate,head,tail,integrase,transposase attL 1260304:1260320|attR 1310907:1310923
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP013394
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013394_1 1745535-1745672 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 129674-129703 4 0.867
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 698489-698518 4 0.867
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2064127-2064156 4 0.867
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 974735-974764 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1337831-1337860 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1337798-1337827 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1336603-1336632 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1336640-1336669 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1336640-1336669 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1130711-1130740 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1336629-1336658 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1244903-1244932 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1336629-1336658 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1337796-1337825 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1336640-1336669 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1336651-1336680 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1336629-1336658 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 902856-902885 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 907202-907231 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1229058-1229087 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 628131-628160 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 907191-907220 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 940259-940288 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 799914-799943 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 940259-940288 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 799937-799966 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 940259-940288 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 940259-940288 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 940259-940288 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 799937-799966 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 836065-836094 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 816756-816785 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 870992-871021 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 907874-907903 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 799937-799966 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 799937-799966 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 799937-799966 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 940261-940290 7 0.767
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NC_015179 Acidiphilium multivorum AIU301 plasmid pACMV3, complete sequence 9083-9112 8 0.733
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NC_015187 Acidiphilium multivorum AIU301 plasmid pACMV2, complete sequence 20651-20680 8 0.733
NZ_CP013394_1 1.2|1745589|30|NZ_CP013394|CRT 1745589-1745618 30 NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 22821-22850 8 0.733

1. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.867

acggattcgatgacggattcgatggcggtt	CRISPR spacer
acgggttcgatgacgggttcgatggccggt	Protospacer
****.***********.********* * *

2. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.867

acggattcgatgacggattcgatggcggtt	CRISPR spacer
accgattcgatgaccgattcgatggctgat	Protospacer
** *********** *********** * *

3. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 4, identity: 0.867

acggattcgatgacggattcgatggcggtt	CRISPR spacer
accgattcgatgaccgattcgatggctgat	Protospacer
** *********** *********** * *

4. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

5. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

6. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

7. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

8. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

9. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

10. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

11. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

12. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

13. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

14. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

15. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

16. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

17. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

18. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

19. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

20. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

21. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

22. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

23. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

24. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

25. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

26. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

27. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

28. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

29. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

30. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

31. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

32. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

33. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

34. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

35. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

36. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

37. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

38. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

acggattcgatgacggattcgatggcggtt	CRISPR spacer
ccggattcgatgaccggttcgatggtgcgg	Protospacer
 ************* *.********.*   

39. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NC_015179 (Acidiphilium multivorum AIU301 plasmid pACMV3, complete sequence) position: , mismatch: 8, identity: 0.733

acggattcgatgacggattcgatggcggtt	CRISPR spacer
atgtggccgatgacgggttcgatggcggcg	Protospacer
*.* . .*********.***********. 

40. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NC_015187 (Acidiphilium multivorum AIU301 plasmid pACMV2, complete sequence) position: , mismatch: 8, identity: 0.733

acggattcgatgacggattcgatggcggtt	CRISPR spacer
atgtggccgatgacgggttcgatggcggcg	Protospacer
*.* . .*********.***********. 

41. spacer 1.2|1745589|30|NZ_CP013394|CRT matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 8, identity: 0.733

acggattcgatgacggattcgatggcggtt	CRISPR spacer
atgtggccgatgacgggttcgatggcggcg	Protospacer
*.* . .*********.***********. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1491339 : 1517471 20 uncultured_virus(100.0%) plate,transposase NA
DBSCAN-SWA_2 1579929 : 1693880 109 Burkholderia_phage(38.1%) plate,transposase,terminase,portal,head,capsid,integrase,protease,holin,tail attL 1624738:1624757|attR 1680709:1680728
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage