Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014597 Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence 1 crisprs cas7,cas8c,cas5,DEDDh 0 3 3 0
NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014595 Yangia sp. CCB-MM3 chromosome 1, complete sequence 4 crisprs csa3,cas3,DEDDh 0 0 1 0
NZ_CP014596 Yangia sp. CCB-MM3 chromosome 2, complete sequence 0 crisprs cas3 0 0 2 0
NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014601 Yangia sp. CCB-MM3 plasmid unnamed5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 1 crisprs NA 0 2 0 0

Results visualization

1. NZ_CP014597
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014597_1 132627-132797 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014597_1 1.1|132646|29|NZ_CP014597|CRT 132646-132674 29 NZ_CP014597 Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence 132646-132674 0 1.0
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP014597 Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence 132694-132725 0 1.0
NZ_CP014597_1 1.3|132745|34|NZ_CP014597|CRT 132745-132778 34 NZ_CP014597 Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence 132745-132778 0 1.0
NZ_CP014597_1 1.1|132646|29|NZ_CP014597|CRT 132646-132674 29 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 494482-494510 7 0.759
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1502457-1502488 7 0.781
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 MN369761 Mycobacterium phage Malthus, complete genome 27400-27431 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 AP018469 Mycobacterium phage Y10 DNA, complete genome, note: sample1 27476-27507 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 AP018470 Mycobacterium phage Y2 DNA, complete genome 27476-27507 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 MH727561 Mycobacterium phage Serendipitous, complete genome 10891-10922 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 MT310882 Mycobacterium phage JF1, complete genome 27476-27507 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 AP018471 Mycobacterium phage Y10 DNA, complete genome, note: sample2 27476-27507 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 MF140435 Mycobacterium phage Wintermute, complete genome 27476-27507 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NC_027365 Mycobacterium virus Fionnbarth, complete genome 27477-27508 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1574188-1574219 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1477126-1477157 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 319279-319310 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 66728-66759 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 313804-313835 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 500885-500916 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 449225-449256 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 KY555147 Caulobacter phage Ccr34, complete genome 115811-115842 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 KY555145 Caulobacter phage Ccr29, complete genome 119724-119755 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 KY555143 Caulobacter phage Ccr2, complete genome 115191-115222 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 MH744418 Streptomyces phage JustBecause, complete genome 103527-103558 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NC_019410 Caulobacter phage CcrKarma, complete genome 115901-115932 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 KY555146 Caulobacter phage Ccr32, complete genome 115371-115402 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NC_019407 Caulobacter phage CcrMagneto, complete genome 114089-114120 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 KY555144 Caulobacter phage Ccr5, complete genome 115080-115111 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 JX163858 Caulobacter phage phiCbK, complete genome 92458-92489 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 KY555142 Caulobacter phage Ccr10, complete genome 114716-114747 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 MT310898 Streptomyces phage Kela, complete genome 103401-103432 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NC_019411 Caulobacter phage CcrSwift, complete genome 114668-114699 8 0.75
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP035420 Leisingera sp. NJS204 plasmid unnamed3, complete sequence 99182-99213 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 263924-263955 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 264781-264812 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 261201-261232 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 355802-355833 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 446442-446473 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 488019-488050 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 229175-229206 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP045288 Curtobacterium flaccumfaciens pv. flaccumfaciens strain P990 plasmid pCff1, complete sequence 138638-138669 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 311554-311585 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 340311-340342 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 386619-386650 9 0.719
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 385245-385276 9 0.719
NZ_CP014597_1 1.3|132745|34|NZ_CP014597|CRT 132745-132778 34 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 427633-427666 9 0.735
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 17921-17952 10 0.688
NZ_CP014597_1 1.3|132745|34|NZ_CP014597|CRT 132745-132778 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2145518-2145551 10 0.706
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NZ_AP022334 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence 30052-30083 11 0.656
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 944137-944168 11 0.656
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 264745-264776 11 0.656
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 NC_023591 Mycobacterium phage Adler, complete genome 50653-50684 11 0.656
NZ_CP014597_1 1.2|132694|32|NZ_CP014597|CRT 132694-132725 32 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 50650-50681 11 0.656
NZ_CP014597_1 1.3|132745|34|NZ_CP014597|CRT 132745-132778 34 NC_015065 Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence 145695-145728 12 0.647

1. spacer 1.1|132646|29|NZ_CP014597|CRT matches to NZ_CP014597 (Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cccagccccgctgacgccaggctcccaac	CRISPR spacer
cccagccccgctgacgccaggctcccaac	Protospacer
*****************************

2. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP014597 (Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
aaacaagcccgccccgccggccgcggctcagg	Protospacer
********************************

3. spacer 1.3|132745|34|NZ_CP014597|CRT matches to NZ_CP014597 (Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tctggcccctcctccgccaaggcgcggcctccga	CRISPR spacer
tctggcccctcctccgccaaggcgcggcctccga	Protospacer
**********************************

4. spacer 1.1|132646|29|NZ_CP014597|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.759

cccagccccgctgacgccaggctcccaac	CRISPR spacer
tcccgccccgctgacgcccggctccgccg	Protospacer
.** ************** ******    

5. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cagcaagcgcgccccgacggccgcggcttccg	Protospacer
 *.***** ******* ***********.  *

6. spacer 1.2|132694|32|NZ_CP014597|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgccaagcccgccgcgccggccgcggtggaga	Protospacer
 . ********** ************.  **.

7. spacer 1.2|132694|32|NZ_CP014597|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgccaagcccgccgcgccggccgcggtggaga	Protospacer
 . ********** ************.  **.

8. spacer 1.2|132694|32|NZ_CP014597|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgccaagcccgccgcgccggccgcggtggaga	Protospacer
 . ********** ************.  **.

9. spacer 1.2|132694|32|NZ_CP014597|CRT matches to MH727561 (Mycobacterium phage Serendipitous, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gctcggtcccgccccgtcggcctcggctcagg	Protospacer
.  *.. *********.***** *********

10. spacer 1.2|132694|32|NZ_CP014597|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgccaagcccgccgcgccggccgcggtggaga	Protospacer
 . ********** ************.  **.

11. spacer 1.2|132694|32|NZ_CP014597|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgccaagcccgccgcgccggccgcggtggaga	Protospacer
 . ********** ************.  **.

12. spacer 1.2|132694|32|NZ_CP014597|CRT matches to MF140435 (Mycobacterium phage Wintermute, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgccaagcccgccgcgccggccgcggtggaga	Protospacer
 . ********** ************.  **.

13. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NC_027365 (Mycobacterium virus Fionnbarth, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgccaagcccgccgcgccggccgcggtggaga	Protospacer
 . ********** ************.  **.

14. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cagcaagcgcgccccgacggccgcggcctccg	Protospacer
 *.***** ******* **********..  *

15. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cagcaagcgcgccccgacggccgcggccttcg	Protospacer
 *.***** ******* **********..  *

16. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cagcaagcgcgccccgacggccgcggcctccg	Protospacer
 *.***** ******* **********..  *

17. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cagcaagcgcgccccgacggccgcggcctccg	Protospacer
 *.***** ******* **********..  *

18. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gaccgcgcccgcgccgccggccgcgggtcccg	Protospacer
.* *. ****** ************* **  *

19. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

aaacaagc--ccgccccgccggccgcggctcagg	CRISPR spacer
--gctggccgccgccgcgccggccgcggcgcagc	Protospacer
  .* .**  ***** ************* *** 

20. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.75

aaacaagc---ccgccccgccggccgcggctcagg	CRISPR spacer
---cctgctcgccgccgcgccggccgcggcacaga	Protospacer
   *  **   ***** ************* ***.

21. spacer 1.2|132694|32|NZ_CP014597|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

22. spacer 1.2|132694|32|NZ_CP014597|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

23. spacer 1.2|132694|32|NZ_CP014597|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

24. spacer 1.2|132694|32|NZ_CP014597|CRT matches to MH744418 (Streptomyces phage JustBecause, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gaccccgcccgccccgcaggccccggctcccg	Protospacer
.* *  *********** **** ******  *

25. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

26. spacer 1.2|132694|32|NZ_CP014597|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

27. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

28. spacer 1.2|132694|32|NZ_CP014597|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

29. spacer 1.2|132694|32|NZ_CP014597|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

30. spacer 1.2|132694|32|NZ_CP014597|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

31. spacer 1.2|132694|32|NZ_CP014597|CRT matches to MT310898 (Streptomyces phage Kela, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gaccccgcccgccccgcaggccccggctcccg	Protospacer
.* *  *********** **** ******  *

32. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 8, identity: 0.75

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cttctatcccgacccgccggccacggctcacg	Protospacer
   * * **** **********.******* *

33. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP035420 (Leisingera sp. NJS204 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
agcccagctcgccccgctggccgcggctgcca	Protospacer
*. * ***.********.**********   .

34. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gccgaagcccgccccgagggccgcggcgatgg	Protospacer
.   ************  *********   **

35. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gtccctgtacgccctgccggccgcggcccagg	Protospacer
.  *  *. *****.************.****

36. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gccgaagcccgccccgagggccgcggcgatgg	Protospacer
.   ************  *********   **

37. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
ttccctgtacgccctgccggccgcggcccagg	Protospacer
   *  *. *****.************.****

38. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gtccctgtacgccctgccggccgcggcccagg	Protospacer
.  *  *. *****.************.****

39. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
tctcgcactcgcctcgccggccgcggcgcagg	Protospacer
   *. .*.****.************* ****

40. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gaagaagaccgccccgccggccgctccggtga	Protospacer
.** *** ****************  *   *.

41. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP045288 (Curtobacterium flaccumfaciens pv. flaccumfaciens strain P990 plasmid pCff1, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
ggccgcgcccgccgcgccggcggcggctcgcg	Protospacer
.. *. ******* ******* *******. *

42. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
ctccctgtacgccctgccggccgcggcccagg	Protospacer
   *  *. *****.************.****

43. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
ctccctgtacgccctgccggccgcggcccagg	Protospacer
   *  *. *****.************.****

44. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
ctccctgtacgccctgccggccgcggcccagg	Protospacer
   *  *. *****.************.****

45. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
ctccctgtacgccctgccggccgcggcccagg	Protospacer
   *  *. *****.************.****

46. spacer 1.3|132745|34|NZ_CP014597|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 9, identity: 0.735

tctggcccctcctccgccaaggcgcggcctccga	CRISPR spacer
gcgcgcccctcctccgtcaaggcgaggccgcgac	Protospacer
 *  ************.******* **** * . 

47. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 10, identity: 0.688

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
ttttaagcccggcccgcccgccgcggcggccg	Protospacer
   .******* ****** ********    *

48. spacer 1.3|132745|34|NZ_CP014597|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 10, identity: 0.706

tctggcccctcctccgccaaggcgcggcctccga	CRISPR spacer
gcgcccccctcctccgtcaaggcgaggccgcgac	Protospacer
 *   ***********.******* **** * . 

49. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 11, identity: 0.656

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgctcggcccgcctcgccggccacggctccca	Protospacer
 . . .*******.********.******  .

50. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.656

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cggcaagcccgcccagccggtcgcgggcggcc	Protospacer
 ..*********** *****.***** . .  

51. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 11, identity: 0.656

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
gccgctgcccgcaccgccggccgcgcctcgtc	Protospacer
.     ****** ************ ***.  

52. spacer 1.2|132694|32|NZ_CP014597|CRT matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 11, identity: 0.656

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgacaagcccgccccgctgcccgcgttctgca	Protospacer
 .***************.* ***** .... .

53. spacer 1.2|132694|32|NZ_CP014597|CRT matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 11, identity: 0.656

aaacaagcccgccccgccggccgcggctcagg	CRISPR spacer
cgacaagcccgccccgctgcccgcgttctgca	Protospacer
 .***************.* ***** .... .

54. spacer 1.3|132745|34|NZ_CP014597|CRT matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 12, identity: 0.647

tctggcccctcctccgccaaggcgcggcctccga	CRISPR spacer
gtaacaacctcctccggcaaggcgctgcctcgac	Protospacer
 . .   ********* ******** ***** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8995 : 17053 7 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_2 80034 : 165747 77 Thermus_phage(12.5%) transposase,integrase attL 126408:126424|attR 167158:167174
DBSCAN-SWA_3 208307 : 249950 46 Leptospira_phage(42.86%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014600
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014600_1 37151-37310 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014600_1 1.1|37169|48|NZ_CP014600|PILER-CR 37169-37216 48 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 37168-37215 0 1.0
NZ_CP014600_1 1.2|37235|59|NZ_CP014600|PILER-CR 37235-37293 59 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 37234-37292 0 1.0

1. spacer 1.1|37169|48|NZ_CP014600|PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

agagaaagccggtcgatgcgccagcgctcagagagcctttgccggggt	CRISPR spacer
agagaaagccggtcgatgcgccagcgctcagagagcctttgccggggt	Protospacer
************************************************

2. spacer 1.2|37235|59|NZ_CP014600|PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgatcacccgccccagaaagagccctctgccacggccaaggcgcgcgccaaatctgcg	CRISPR spacer
gtgatcacccgccccagaaagagccctctgccacggccaaggcgcgcgccaaatctgcg	Protospacer
***********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP014595
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014595_2 1711969-1712062 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014595_1 1711624-1711855 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014595_3 1712176-1712337 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014595_4 2409244-2409599 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2821630 : 2846391 28 Paracoccus_phage(25.0%) capsid,protease,portal,head,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP014596
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 345414 : 408284 57 Moumouvirus(10.0%) transposase,integrase,protease,tRNA attL 368675:368690|attR 401079:401094
DBSCAN-SWA_2 895192 : 953178 48 Leptospira_phage(42.86%) integrase,transposase attL 891147:891161|attR 918708:918722
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage