Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015204 Rhodococcus sp. 008 plasmid pR8C1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP012749 Rhodococcus sp. 008 chromosome, complete genome 1 crisprs WYL,csa3,DEDDh,RT,cas3,cas4,DinG 0 0 2 0
NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 1 crisprs csa3,csf3gr5,csf2gr7,PD-DExK 0 1 3 0
NZ_CP015205 Rhodococcus sp. 008 plasmid pR8C2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP015204
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1587 : 61198 49 Mycobacterium_phage(33.33%) integrase,transposase,protease attL 5632:5646|attR 61919:61933
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP012749
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012749_1 2374506-2374617 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4693326 : 4720943 35 Rhodococcus_phage(43.48%) portal,tail,terminase NA
DBSCAN-SWA_2 4821133 : 4828695 9 Lactobacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP015203
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015203_1 194576-194652 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015203_1 1.1|194602|25|NZ_CP015203|CRISPRCasFinder 194602-194626 25 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 194602-194626 0 1.0
NZ_CP015203_1 1.1|194602|25|NZ_CP015203|CRISPRCasFinder 194602-194626 25 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 55159-55183 1 0.96
NZ_CP015203_1 1.1|194602|25|NZ_CP015203|CRISPRCasFinder 194602-194626 25 NZ_CP033036 Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence 360592-360616 4 0.84
NZ_CP015203_1 1.1|194602|25|NZ_CP015203|CRISPRCasFinder 194602-194626 25 NC_003064 Agrobacterium fabrum str. C58 plasmid At, complete sequence 527605-527629 4 0.84
NZ_CP015203_1 1.1|194602|25|NZ_CP015203|CRISPRCasFinder 194602-194626 25 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 526868-526892 6 0.76

1. spacer 1.1|194602|25|NZ_CP015203|CRISPRCasFinder matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 0, identity: 1.0

tgggagcccttgtagaagcagcaga	CRISPR spacer
tgggagcccttgtagaagcagcaga	Protospacer
*************************

2. spacer 1.1|194602|25|NZ_CP015203|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 1, identity: 0.96

tgggagcccttgtagaagcagcaga	CRISPR spacer
tgggagcccttgtagaagcagcagg	Protospacer
************************.

3. spacer 1.1|194602|25|NZ_CP015203|CRISPRCasFinder matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 4, identity: 0.84

tgggagcccttgtagaagcagcaga	CRISPR spacer
aaggagcccttgttgatgcagcaga	Protospacer
 .*********** ** ********

4. spacer 1.1|194602|25|NZ_CP015203|CRISPRCasFinder matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 4, identity: 0.84

tgggagcccttgtagaagcagcaga	CRISPR spacer
aaggagcccttgttgatgcagcaga	Protospacer
 .*********** ** ********

5. spacer 1.1|194602|25|NZ_CP015203|CRISPRCasFinder matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 6, identity: 0.76

tgggagcccttgtagaagcagcaga	CRISPR spacer
acagagcccttgtagaagcagcctg	Protospacer
  .*******************  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 137137 : 144725 10 uncultured_Caudovirales_phage(28.57%) NA NA
DBSCAN-SWA_2 346402 : 397376 36 Staphylococcus_phage(27.27%) transposase NA
DBSCAN-SWA_3 481607 : 603512 95 uncultured_virus(30.43%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage