Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013574 Rhizobium phaseoli strain N671 chromosome, complete genome 3 crisprs WYL,cas3,csa3,DEDDh 0 0 7 0
NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 0 crisprs PD-DExK,WYL 0 0 0 0
NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_CP013575 Rhizobium phaseoli strain N671 plasmid pRphaN671a, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 0 crisprs csa3,RT 0 0 0 0

Results visualization

1. NZ_CP013574
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013574_1 1216598-1216707 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013574_2 1467145-1467238 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013574_3 1926578-1926666 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1512188 : 1521389 9 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_2 1856627 : 1872040 20 Pseudomonas_phage(45.45%) capsid,tail NA
DBSCAN-SWA_3 1878466 : 1884775 13 Sinorhizobium_phage(33.33%) NA NA
DBSCAN-SWA_4 1905167 : 1918270 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_5 2153132 : 2163395 9 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_6 2649363 : 2656607 8 Paenibacillus_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_7 3920367 : 3930486 9 Mycobacterium_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP013575
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013575_1 51325-51427 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013575_1 1.1|51350|53|NZ_CP013575|CRISPRCasFinder 51350-51402 53 NZ_CP013569 Rhizobium phaseoli strain N771 plasmid pRphaN771a, complete sequence 51350-51402 0 1.0
NZ_CP013575_1 1.1|51350|53|NZ_CP013575|CRISPRCasFinder 51350-51402 53 NZ_CP013558 Rhizobium phaseoli strain N841 plasmid pRphaN841a, complete sequence 37750-37802 3 0.943

1. spacer 1.1|51350|53|NZ_CP013575|CRISPRCasFinder matches to NZ_CP013569 (Rhizobium phaseoli strain N771 plasmid pRphaN771a, complete sequence) position: , mismatch: 0, identity: 1.0

gctgcccccaagcaggccgacggccagacggatgccaaaagcgacgccccgag	CRISPR spacer
gctgcccccaagcaggccgacggccagacggatgccaaaagcgacgccccgag	Protospacer
*****************************************************

2. spacer 1.1|51350|53|NZ_CP013575|CRISPRCasFinder matches to NZ_CP013558 (Rhizobium phaseoli strain N841 plasmid pRphaN841a, complete sequence) position: , mismatch: 3, identity: 0.943

gctgcccccaagcaggccgacggccagacggatgccaaaagcgacgccccgag	CRISPR spacer
gctgcccccaagcaggtcgacggccagacggaagccaaaagcgacgccccgac	Protospacer
****************.*************** ******************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage