Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015133 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d6b, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 0 crisprs RT,csa3 0 0 3 0
NZ_CP015130 Klebsiella pneumoniae strain Kpn555 chromosome, complete genome 3 crisprs DEDDh,DinG,csa3,cas3,WYL 2 13 8 0
NZ_CP015131 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-7c3, complete sequence 0 crisprs RT 0 0 1 0

Results visualization

1. NZ_CP015133
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1926 : 25776 22 Escherichia_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015131
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39497 : 102287 50 Escherichia_phage(25.0%) transposase,integrase attL 44859:44879|attR 63526:63546
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP015130
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015130_1 4297723-4297862 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015130_2 4903566-4903643 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015130_3 5136631-5140922 Orphan NA
36 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 NZ_CP015130.1 5142132-5142153 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 NZ_CP015130.1 5142078-5142099 2 0.909
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 NZ_CP015130.1 5142120-5142153 2 0.941

1. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to position: 5142132-5142153, mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

2. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to position: 5142078-5142099, mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattctgacagt	Protospacer
******.********.******

3. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to position: 5142120-5142153, mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctccgattcggacagcgattcggattctgacagt	Protospacer
***.**.***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1492-1519 0 1.0
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3364-3391 0 1.0
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1630-1651 0 1.0
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2650-2671 0 1.0
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3148-3169 0 1.0
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3202-3223 0 1.0
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3466-3487 0 1.0
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3562-3583 0 1.0
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1258-1285 1 0.964
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3100-3127 1 0.964
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151882-151909 1 0.964
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1072-1093 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1504-1525 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1558-1579 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1900-1921 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1972-1993 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2368-2389 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2686-2707 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3376-3397 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3688-3709 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153631-153652 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151840-151861 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151930-151951 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153097-153118 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153169-153190 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153613-153634 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153823-153844 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153949-153970 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154057-154078 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154219-154240 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155743-155764 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155917-155938 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156097-156118 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156571-156592 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157117-157138 1 0.955
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1000-1021 1 0.955
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 25-58 1 0.971
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2422-2455 1 0.971
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2602-2623 1 0.955
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1288-1321 1 0.971
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1396-1429 1 0.971
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2686-2719 1 0.971
NZ_CP015130_3 3.22|5139873|52|NZ_CP015130|CRT 5139873-5139924 52 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1126-1177 2 0.962
NZ_CP015130_3 3.22|5139873|52|NZ_CP015130|CRT 5139873-5139924 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153967-154018 2 0.962
NZ_CP015130_3 3.27|5140329|52|NZ_CP015130|CRT 5140329-5140380 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153169-153220 2 0.962
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1618-1645 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3550-3577 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3676-3703 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1546-1573 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153157-153184 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153211-153238 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153637-153664 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154741-154768 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154939-154966 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155137-155164 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155371-155398 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155491-155518 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156271-156298 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157429-157456 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151408-151435 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153085-153112 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153619-153646 2 0.929
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153895-153922 2 0.929
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 25-46 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1126-1147 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1288-1309 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1750-1771 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1846-1867 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2254-2275 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2404-2425 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2422-2443 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2872-2893 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3004-3025 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3622-3643 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151329-151350 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151384-151405 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151420-151441 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151456-151477 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151546-151567 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151582-151603 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151744-151765 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151762-151783 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151780-151801 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151858-151879 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151966-151987 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151984-152005 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153187-153208 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153205-153226 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153649-153670 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153667-153688 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153685-153706 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154429-154450 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154645-154666 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154663-154684 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154681-154702 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154699-154720 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154717-154738 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154771-154792 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154879-154900 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154897-154918 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154915-154936 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155059-155080 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155077-155098 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155095-155116 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155113-155134 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155167-155188 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155221-155242 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155293-155314 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155311-155332 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155329-155350 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155347-155368 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155401-155422 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155827-155848 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155863-155884 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155935-155956 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156805-156826 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156823-156844 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156841-156862 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156973-156994 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156991-157012 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157009-157030 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157549-157570 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1072-1093 2 0.909
NZ_CP015130_3 3.29|5140449|22|NZ_CP015130|CRT 5140449-5140470 22 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1108-1129 2 0.909
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2686-2719 2 0.941
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1252-1285 2 0.941
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1288-1321 2 0.941
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3094-3127 2 0.941
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154429-154462 2 0.941
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154315-154336 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154693-154714 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154711-154732 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154765-154786 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154909-154930 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155107-155128 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155161-155182 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155215-155236 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155341-155362 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155395-155416 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151287-151308 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151378-151399 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151414-151435 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151450-151471 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151630-151651 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151684-151705 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151738-151759 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151960-151981 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153199-153220 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153319-153340 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153625-153646 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153901-153922 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155053-155074 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155287-155308 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155821-155842 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155929-155950 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156403-156424 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156817-156838 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156985-157006 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157345-157366 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157543-157564 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1318-1339 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2176-2197 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2866-2887 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 19-40 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1120-1141 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1246-1267 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1282-1303 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1480-1501 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1840-1861 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2398-2419 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2644-2665 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2998-3019 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3196-3217 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3352-3373 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3460-3481 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3616-3637 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1066-1087 2 0.909
NZ_CP015130_3 3.31|5140545|22|NZ_CP015130|CRT 5140545-5140566 22 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1102-1123 2 0.909
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 25-58 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2422-2455 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1072-1105 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1504-1537 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1900-1933 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1972-2005 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2554-2587 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151293-151326 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151329-151362 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154429-154462 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151930-151963 2 0.941
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157081-157114 2 0.941
NZ_CP015130_3 3.35|5140791|40|NZ_CP015130|CRT 5140791-5140830 40 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2608-2647 2 0.95
NZ_CP015130_3 3.22|5139873|52|NZ_CP015130|CRT 5139873-5139924 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156619-156670 3 0.942
NZ_CP015130_3 3.27|5140329|52|NZ_CP015130|CRT 5140329-5140380 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151420-151471 3 0.942
NZ_CP015130_3 3.27|5140329|52|NZ_CP015130|CRT 5140329-5140380 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154003-154054 3 0.942
NZ_CP015130_3 3.27|5140329|52|NZ_CP015130|CRT 5140329-5140380 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155521-155572 3 0.942
NZ_CP015130_3 3.27|5140329|52|NZ_CP015130|CRT 5140329-5140380 52 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1864-1915 3 0.942
NZ_CP015130_3 3.27|5140329|52|NZ_CP015130|CRT 5140329-5140380 52 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2236-2287 3 0.942
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1564-1591 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1738-1765 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1852-1879 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2260-2287 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2392-2419 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3154-3181 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156607-156634 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151786-151813 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151846-151873 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153655-153682 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153673-153700 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153859-153886 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154471-154498 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154669-154696 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154885-154912 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155047-155074 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155083-155110 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155281-155308 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155317-155344 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155941-155968 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156031-156058 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156379-156406 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156415-156442 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156559-156586 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156811-156838 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156829-156856 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156979-157006 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156997-157024 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157555-157582 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21235-21262 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1060-1087 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15856-15883 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9793-9820 3 0.893
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9937-9964 3 0.893
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1486-1519 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1558-1591 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1612-1645 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1846-1879 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2062-2095 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3358-3391 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3544-3577 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153151-153184 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155485-155518 3 0.912
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156265-156298 3 0.912
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2254-2287 3 0.912
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1450-1483 3 0.912
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157027-157060 3 0.912
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1018-1051 3 0.912
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1072-1105 3 0.912
NZ_CP015130_3 3.33|5140641|52|NZ_CP015130|CRT 5140641-5140692 52 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1306-1357 3 0.942
NZ_CP015130_3 3.36|5140851|52|NZ_CP015130|CRT 5140851-5140902 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154735-154786 3 0.942
NZ_CP015130_3 3.36|5140851|52|NZ_CP015130|CRT 5140851-5140902 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155131-155182 3 0.942
NZ_CP015130_3 3.36|5140851|52|NZ_CP015130|CRT 5140851-5140902 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155365-155416 3 0.942
NZ_CP015130_3 3.36|5140851|52|NZ_CP015130|CRT 5140851-5140902 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156025-156076 3 0.942
NZ_CP015130_3 3.36|5140851|52|NZ_CP015130|CRT 5140851-5140902 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156373-156424 3 0.942
NZ_CP015130_3 3.22|5139873|52|NZ_CP015130|CRT 5139873-5139924 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154255-154306 4 0.923
NZ_CP015130_3 3.27|5140329|52|NZ_CP015130|CRT 5140329-5140380 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153541-153592 4 0.923
NZ_CP015130_3 3.27|5140329|52|NZ_CP015130|CRT 5140329-5140380 52 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3292-3343 4 0.923
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 31-58 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1078-1105 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1906-1933 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2188-2215 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2428-2455 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2692-2719 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2770-2797 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3028-3055 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151239-151266 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151642-151669 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151696-151723 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151972-151999 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153691-153718 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153793-153820 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154327-154354 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156067-156094 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156133-156160 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156205-156232 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157357-157384 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157519-157546 4 0.857
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157645-157672 4 0.857
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2764-2797 4 0.882
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2968-3001 4 0.882
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154465-154498 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2968-3001 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1846-1879 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3022-3055 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151780-151813 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153823-153856 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156097-156130 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156571-156604 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157477-157510 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157549-157582 4 0.882
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1108-1141 4 0.882
NZ_CP015130_3 3.24|5140053|58|NZ_CP015130|CRT 5140053-5140110 58 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2212-2269 5 0.914
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154099-154126 5 0.821
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154135-154162 5 0.821
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887814-2887841 5 0.821
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153823-153856 5 0.853
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156097-156130 5 0.853
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156571-156604 5 0.853
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157639-157672 5 0.853
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2764-2797 5 0.853
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154183-154216 5 0.853
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153829-153856 6 0.786
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156103-156130 6 0.786
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156577-156604 6 0.786
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152071 6 0.786
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157639-157672 6 0.824
NZ_CP015130_3 3.35|5140791|40|NZ_CP015130|CRT 5140791-5140830 40 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3202-3241 6 0.85
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1186-1213 7 0.75
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2134-2161 7 0.75
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1180-1213 7 0.794
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151798-151831 7 0.794
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16445-16478 7 0.794
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16739-16772 7 0.794
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17123-17156 7 0.794
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17735-17768 7 0.794
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18497-18530 7 0.794
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19217-19250 7 0.794
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154537-154570 7 0.794
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154807-154840 7 0.794
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156145-156178 7 0.794
NZ_CP015130_3 3.35|5140791|40|NZ_CP015130|CRT 5140791-5140830 40 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2764-2803 7 0.825
NZ_CP015130_3 3.28|5140401|28|NZ_CP015130|CRT 5140401-5140428 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5098655-5098682 8 0.714
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2128-2161 8 0.765
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154537-154570 8 0.765
NZ_CP015130_3 3.30|5140491|34|NZ_CP015130|CRT 5140491-5140524 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154807-154840 8 0.765
NZ_CP015130_3 3.32|5140587|34|NZ_CP015130|CRT 5140587-5140620 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152020-152053 8 0.765
NZ_CP015130_3 3.36|5140851|52|NZ_CP015130|CRT 5140851-5140902 52 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154285-154336 8 0.846
NZ_CP015130_3 3.26|5140239|70|NZ_CP015130|CRT 5140239-5140308 70 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157585-157654 13 0.814
NZ_CP015130_3 3.5|5137419|148|NZ_CP015130|CRT 5137419-5137566 148 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1306-1453 90 0.392

1. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagtgattcggattcg	Protospacer
****************************

2. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagtgattcggattcg	Protospacer
****************************

3. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattccgacagt	Protospacer
**********************

4. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattccgacagt	Protospacer
**********************

5. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattccgacagt	Protospacer
**********************

6. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattccgacagt	Protospacer
**********************

7. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattccgacagt	Protospacer
**********************

8. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattccgacagt	Protospacer
**********************

9. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.964

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgattcggattcg	Protospacer
.***************************

10. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.964

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgattcggattcg	Protospacer
.***************************

11. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.964

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagtgattccgattcg	Protospacer
********************* ******

12. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

13. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagt	Protospacer
************.*********

14. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagtgattcggattccgacagt	Protospacer
***.******************

15. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

16. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattccgattccgacagt	Protospacer
********* ************

17. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

18. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

19. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagt	Protospacer
************.*********

20. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagt	Protospacer
************.*********

21. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattccgacagc	Protospacer
*********************.

22. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagt	Protospacer
*************** ******

23. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

24. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagt	Protospacer
************.*********

25. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagt	Protospacer
************.*********

26. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagt	Protospacer
*************** ******

27. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

28. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagt	Protospacer
******.***************

29. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagt	Protospacer
******.***************

30. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagt	Protospacer
************.*********

31. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagt	Protospacer
************.*********

32. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagt	Protospacer
******.***************

33. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

34. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagt	Protospacer
***************.******

35. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagt	Protospacer
************.*********

36. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.955

cagcgattcggattccgacagt	CRISPR spacer
cagcgattccgattccgacagt	Protospacer
********* ************

37. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.971

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctctgactccgacagcgattcggattctgacagc	Protospacer
***************.******************

38. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.971

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctctgactccgacagcgattcggattctgacagc	Protospacer
***************.******************

39. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.955

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactca	Protospacer
*********.************

40. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.971

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactcggacagcgattcggattctgacagc	Protospacer
*********************************.

41. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.971

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactcggacagcgattcggactctgacagt	Protospacer
************************.*********

42. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.971

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactccgacagcgattcggattctgacagt	Protospacer
********* ************************

43. spacer 3.22|5139873|52|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.962

ttccgactccgacagtgactccgactctgacagcgattcggactccgacagc	CRISPR spacer
ctccgactccgacagtgactcggactctgacagcgattcggactccgacagc	Protospacer
.******************** ******************************

44. spacer 3.22|5139873|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.962

ttccgactccgacagtgactccgactctgacagcgattcggactccgacagc	CRISPR spacer
ttccgactccgacagtgactccgattctgacagcgattcggactctgacagc	Protospacer
************************.********************.******

45. spacer 3.27|5140329|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.962

ttcggattcggacagcgactcggattctgacagcgattccgactccgacagt	CRISPR spacer
ttcggattcggacagcgactcggattccgacagcgattcggactccgacagt	Protospacer
***************************.*********** ************

46. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggattccgacagtgattcggattct	Protospacer
******.******************** 

47. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggattccgacagtgattcggattct	Protospacer
******.******************** 

48. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagtgattcggactcc	Protospacer
************************.** 

49. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggattccgacagtgattcggactcg	Protospacer
******.*****************.***

50. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagtgactcggattct	Protospacer
******************.******** 

51. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagcgattcggattcg	Protospacer
.**************.************

52. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgattcggattcc	Protospacer
***************.*********** 

53. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgattccgattcg	Protospacer
.******************** ******

54. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgattccgattcg	Protospacer
.******************** ******

55. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgattccgattcg	Protospacer
.******************** ******

56. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgattccgattcg	Protospacer
.******************** ******

57. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagtgattccgattct	Protospacer
********************* ***** 

58. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagtgattccgattct	Protospacer
********************* ***** 

59. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgattcggactcg	Protospacer
.***********************.***

60. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgactcggattcg	Protospacer
***************.**.*********

61. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagtgactccgattcg	Protospacer
******************.** ******

62. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggattccgacagcgattcggattcg	Protospacer
******.********.************

63. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgactcggattcg	Protospacer
***************.**.*********

64. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

65. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

66. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

67. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

68. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

69. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

70. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

71. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

72. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

73. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

74. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

75. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
tagcgattcggattctgacagt	Protospacer
.**************.******

76. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

77. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

78. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

79. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

80. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

81. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

82. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

83. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

84. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

85. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

86. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

87. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

88. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

89. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

90. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

91. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

92. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

93. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

94. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

95. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

96. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

97. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

98. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

99. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

100. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

101. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

102. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

103. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

104. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

105. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

106. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

107. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

108. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

109. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

110. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

111. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

112. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

113. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

114. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

115. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattcggacagc	Protospacer
*************** *****.

116. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

117. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

118. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

119. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgactcggattccgacagc	Protospacer
******.**************.

120. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

121. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

122. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

123. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggactccgacagc	Protospacer
************.********.

124. spacer 3.29|5140449|22|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.909

cagcgattcggattccgacagt	CRISPR spacer
cagcgattcggattctgacagc	Protospacer
***************.*****.

125. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctctgactccgacagcgattcggattctgacagt	Protospacer
***************.*****************.

126. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctcggactccgacagtgattcggattcggacagc	Protospacer
*** *********************** ******

127. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctctgactcggacagcgattcggattctgacagc	Protospacer
********* *****.******************

128. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctcggactccgacagtgattcggattcggacagc	Protospacer
*** *********************** ******

129. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctctgactctgacagcgattcggattctgacagc	Protospacer
*********.*****.******************

130. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

131. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

132. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

133. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

134. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

135. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

136. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

137. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

138. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

139. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

140. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactct	Protospacer
*********.*********** 

141. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

142. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

143. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattcggacagcgactcg	Protospacer
********* ***********.

144. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttccgattccgacagcgactcg	Protospacer
*** *****************.

145. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttccgattccgacagcgactcg	Protospacer
*** *****************.

146. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactcg	Protospacer
*********.***********.

147. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactcg	Protospacer
*********.***********.

148. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattcggacagcgactcg	Protospacer
********* ***********.

149. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttccgattccgacagcgactcg	Protospacer
*** *****************.

150. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattccgacagcgattcg	Protospacer
******************.**.

151. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

152. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

153. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

154. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattcggacagcgactcg	Protospacer
********* ***********.

155. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattcggacagcgactcg	Protospacer
********* ***********.

156. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttccgattccgacagcgactcg	Protospacer
*** *****************.

157. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

158. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

159. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttccgattccgacagcgactcg	Protospacer
*** *****************.

160. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactcg	Protospacer
*********.***********.

161. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactct	Protospacer
.******************** 

162. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

163. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ctcggattccgacagcgactcg	Protospacer
.********************.

164. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactct	Protospacer
*********.*********** 

165. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

166. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattcggacagcgactcc	Protospacer
********* *********** 

167. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactcg	Protospacer
*********.***********.

168. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattcggacagcgactct	Protospacer
********* *********** 

169. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactcc	Protospacer
*********.*********** 

170. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

171. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattccgacagtgactcc	Protospacer
***************.***** 

172. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactct	Protospacer
******.************** 

173. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattccgacagtgactcc	Protospacer
***************.***** 

174. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattcggacagcgactcc	Protospacer
********* *********** 

175. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattccgacagtgactct	Protospacer
***************.***** 

176. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactcc	Protospacer
*********.*********** 

177. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggactccgacagcgactcg	Protospacer
******.**************.

178. spacer 3.31|5140545|22|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.909

ttcggattccgacagcgactca	CRISPR spacer
ttcggattctgacagcgactct	Protospacer
*********.*********** 

179. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactccgacagcgattcggattctgacagc	Protospacer
********* ***********************.

180. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactccgacagcgattcggattctgacagc	Protospacer
********* ***********************.

181. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctcggactctgacagcgattcggattctgacagt	Protospacer
*** ***** ************************

182. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactcggacagcgattcggactccgacagt	Protospacer
************************.**.******

183. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctcggactctgacagcgattcggattctgacagt	Protospacer
*** ***** ************************

184. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactcggacagcgattccgattccgacagt	Protospacer
********************* *****.******

185. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactcggacagcgattcggactctgatagt	Protospacer
************************.*****.***

186. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactcggatagcgattcggattctgacagc	Protospacer
************.********************.

187. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttctgactcggatagcgattcggattctgacagt	Protospacer
.***********.*********************

188. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactctgacagcgattcggattctgacagc	Protospacer
********* ***********************.

189. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctcggattcggacagcgattcggattctgacagt	Protospacer
*** **.***************************

190. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactctgacagcgattcggactctgacagt	Protospacer
********* **************.*********

191. spacer 3.35|5140791|40|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.95

ctcggactccgacagcgacagcgattcggattctgacagc	CRISPR spacer
ctccgactccgacagcgacagtgattcggattctgacagc	Protospacer
*** *****************.******************

192. spacer 3.22|5139873|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttccgactccgacagtgactccgactctgacagcgattcggactccgacagc	CRISPR spacer
ttcggactccgacagtgactccgactctgacagcgactcggactccgacagt	Protospacer
*** ********************************.**************.

193. spacer 3.27|5140329|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttcggattcggacagcgactcggattctgacagcgattccgactccgacagt	CRISPR spacer
ttcggattcggacagcgactcggattcggacagcgattcggactccgacagc	Protospacer
*************************** *********** ***********.

194. spacer 3.27|5140329|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttcggattcggacagcgactcggattctgacagcgattccgactccgacagt	CRISPR spacer
ctccgattcggacagcgactcggattcggacagcgattccgactccgacagt	Protospacer
.** *********************** ************************

195. spacer 3.27|5140329|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttcggattcggacagcgactcggattctgacagcgattccgactccgacagt	CRISPR spacer
ctcggattcggacagcgactcggattcggacagcgattccgactctgacagt	Protospacer
.************************** *****************.******

196. spacer 3.27|5140329|52|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.942

ttcggattcggacagcgactcggattctgacagcgattccgactccgacagt	CRISPR spacer
ttcggattctgacagtgactcggattctgacagcgattccgactccgacagc	Protospacer
********* *****.***********************************.

197. spacer 3.27|5140329|52|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.942

ttcggattcggacagcgactcggattctgacagcgattccgactccgacagt	CRISPR spacer
ttcggactcggacagcgattcggattctgacagcgattccgactccgacagc	Protospacer
******.***********.********************************.

198. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctccgactccgacagtgattcggattcc	Protospacer
.** *********************** 

199. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgattcggatgct	Protospacer
***************.********* * 

200. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttccgactccgacagcgattcggattct	Protospacer
*** ***********.*********** 

201. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactcggacagcgattcggattct	Protospacer
********* *****.*********** 

202. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgactcggattct	Protospacer
***************.**.******** 

203. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactctgacagcgattcggattcc	Protospacer
*********.*****.*********** 

204. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgattccgattca	Protospacer
.******************** *****.

205. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactctgacagcgattcggattct	Protospacer
*********.*****.*********** 

206. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggattccgacagcgattcggattcg	Protospacer
.*****.********.************

207. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgattcggactcc	Protospacer
***************.********.** 

208. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgattcggactcc	Protospacer
***************.********.** 

209. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactctgacagtgattccgattca	Protospacer
*********.*********** *****.

210. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttccgactccgacagtgattcggactct	Protospacer
*** ********************.** 

211. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggattccgacagcgattcggattcg	Protospacer
.*****.********.************

212. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggattccgacagcgattcggattcg	Protospacer
.*****.********.************

213. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgactcggattct	Protospacer
***************.**.******** 

214. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggattccgacagcgattcggattcg	Protospacer
.*****.********.************

215. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgactcggattct	Protospacer
***************.**.******** 

216. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggattccgacagcgattcggattcg	Protospacer
.*****.********.************

217. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagcgattcggattcg	Protospacer
.********.*****.************

218. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgactccgattcg	Protospacer
.*****************.** ******

219. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgactccgattcg	Protospacer
.*****************.** ******

220. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttccgactccgacagtgattccgattcc	Protospacer
*** ***************** ***** 

221. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggattctgacagtgattcggattct	Protospacer
******.**.***************** 

222. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgactcggattcc	Protospacer
***************.**.******** 

223. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgattcggactcc	Protospacer
***************.********.** 

224. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgactcggattcc	Protospacer
***************.**.******** 

225. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgattcggactcc	Protospacer
***************.********.** 

226. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactctgacagcgattcggattct	Protospacer
*********.*****.*********** 

227. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactcagacagtgattcagattca	Protospacer
********* ***********.*****.

228. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgactcggattct	Protospacer
***************.**.******** 

229. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactcagacagtgattcagattca	Protospacer
********* ***********.*****.

230. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactcagacagtgattcagattca	Protospacer
********* ***********.*****.

231. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactcagacagtgattcagattca	Protospacer
********* ***********.*****.

232. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggactccgacagtgattcggattcggacagc	Protospacer
.** *********************** ******

233. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctccgactccgacagtgattcggattccgacagt	Protospacer
***.***********************.*****.

234. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggattccgacagtgattcggattctgacagc	Protospacer
.** **.***************************

235. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttccgactccgacagcgattcggattctgacagc	Protospacer
.**.***********.******************

236. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttctgactctgacagtgactcggattctgacagc	Protospacer
.********.********.***************

237. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggactccgacagtgattcggattcggacagc	Protospacer
.** *********************** ******

238. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggattccgacagtgattcggattctgacagc	Protospacer
.** **.***************************

239. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggactccgacagtgactcggattctgacagc	Protospacer
.** **************.***************

240. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggactccgacagtgattccgattctgacagc	Protospacer
.** ***************** ************

241. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggactccgacagtgattccgattctgacagc	Protospacer
.** ***************** ************

242. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttcggactcggacagcgattcggattctgacagc	Protospacer
.** *****************************.

243. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactcggacagcgactcggatgctgacagc	Protospacer
******************.****** *******.

244. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactctgacagcgattcggactctgacagc	Protospacer
********* **************.********.

245. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.912

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactctgacagcgattcggactctgacagc	Protospacer
********* **************.********.

246. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.912

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactcggacagcgattcggactccgacagc	Protospacer
************************.**.*****.

247. spacer 3.33|5140641|52|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.942

ttccgactccgacagcgactcggattccgacagcgactctgactcggacagc	CRISPR spacer
ctccgattccgacagtgactcggattccgacagcgactctgactcggacagc	Protospacer
.*****.********.************************************

248. spacer 3.36|5140851|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttcggattccgacagcgactcggactctgacagtgactccgattcggacagc	CRISPR spacer
ctcggattccgacagcgactcggactccgacagtgattccgattcggacagc	Protospacer
.**************************.********.***************

249. spacer 3.36|5140851|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttcggattccgacagcgactcggactctgacagtgactccgattcggacagc	CRISPR spacer
ctcggattccgacagcgactcggactccgacagtgattccgattcggacagc	Protospacer
.**************************.********.***************

250. spacer 3.36|5140851|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttcggattccgacagcgactcggactctgacagtgactccgattcggacagc	CRISPR spacer
ctcggattccgacagcgactcggactccgacagtgattccgattcggacagc	Protospacer
.**************************.********.***************

251. spacer 3.36|5140851|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttcggattccgacagcgactcggactctgacagtgactccgattcggacagc	CRISPR spacer
ctcggactccgacagcgactcggactccgacagtgactccgattcggacagc	Protospacer
.*****.********************.************************

252. spacer 3.36|5140851|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.942

ttcggattccgacagcgactcggactctgacagtgactccgattcggacagc	CRISPR spacer
ttccgattccgacagcgactcggactccgacagtgactccgattcggacagt	Protospacer
*** ***********************.***********************.

253. spacer 3.22|5139873|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.923

ttccgactccgacagtgactccgactctgacagcgattcggactccgacagc	CRISPR spacer
cagcgactccgacagtgactccgactctgacagcgattcggactctgacagc	Protospacer
.  ******************************************.******

254. spacer 3.27|5140329|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.923

ttcggattcggacagcgactcggattctgacagcgattccgactccgacagt	CRISPR spacer
ctccgattcggacagcgactcggattctgacagcgactccgactccgacagc	Protospacer
.** ********************************.**************.

255. spacer 3.27|5140329|52|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.923

ttcggattcggacagcgactcggattctgacagcgattccgactccgacagt	CRISPR spacer
ctcggattcggacagcgactccgattctgacagtgattccgactccgacagc	Protospacer
.******************** ***********.*****************.

256. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctctgactccgacagcgattcggattct	Protospacer
.** ***********.*********** 

257. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagcgattcggattct	Protospacer
.********.*****.*********** 

258. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagcgattcggattct	Protospacer
.********.*****.*********** 

259. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagtgactcggattcc	Protospacer
.********.********.******** 

260. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctctgactccgacagcgattcggattct	Protospacer
.** ***********.*********** 

261. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctctgactccgacagcgattcggattct	Protospacer
.** ***********.*********** 

262. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctccgactccgacagcgattcggattct	Protospacer
.** ***********.*********** 

263. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactcggacagcgattcggatgct	Protospacer
********* *****.********* * 

264. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagcgactcggattct	Protospacer
.**************.**.******** 

265. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagtgattccgattcc	Protospacer
.********.*********** ***** 

266. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagtgattccgattcc	Protospacer
.********.*********** ***** 

267. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggattccgacagcgattcggattct	Protospacer
.*****.********.*********** 

268. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagcgattcggactcc	Protospacer
.**************.********.** 

269. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgactcggactcc	Protospacer
.*****************.*****.** 

270. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagtgactcggattcc	Protospacer
.********.********.******** 

271. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagtgactcggactcc	Protospacer
.*****************.*****.** 

272. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagtgattccgattca	Protospacer
.********.*********** *****.

273. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactccgacagcgactcggattct	Protospacer
.**************.**.******** 

274. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagtgattccgattcc	Protospacer
.********.*********** ***** 

275. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagtgattccgattcc	Protospacer
.********.*********** ***** 

276. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ttcggactccgacagtgattcggattcg	CRISPR spacer
tgcggactccgacagcgattccgattct	Protospacer
* *************.***** ***** 

277. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctccgactccgacagcgattcggattctgactcc	Protospacer
***.***********.***************  *

278. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctctgactctgacagcgattcggattctgactcc	Protospacer
*********.*****.***************  *

279. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttccgactccgacagtgattcggactctgacagt	Protospacer
.**.********************.********.

280. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctctgactctgacagcgattcggattctgactcc	Protospacer
********* *********************  .

281. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttccgactccgacagcgattcggattctgacagc	Protospacer
.**.***** ***********************.

282. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttcggactcggacagcgattcggatgctgacagc	Protospacer
.** ********************* *******.

283. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttcggactctgacagcgattcggattctgacagc	Protospacer
.** ***** ***********************.

284. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
cagcgactccgacagcgattcggattctgacagt	Protospacer
*  .***** ************************

285. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
cagcgactccgacagcgattcggattctgacagt	Protospacer
*  .***** ************************

286. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
cagcgactccgacagcgattcggattctgacagt	Protospacer
*  .***** ************************

287. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttcggactcggacagcgattcggactctgacagc	Protospacer
.** ********************.********.

288. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttcggactctgacagcgattcggattctgacagc	Protospacer
.** ***** ***********************.

289. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.882

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttccgactctgacagcgattcggattctgacagc	Protospacer
.**.***** ***********************.

290. spacer 3.24|5140053|58|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.914

ttcggactctgacagcgattccgactccgacagcgactctgactccgacagcgacagt	CRISPR spacer
ttcggattctgacagcgattccgactccgacagcgactcagactccgacagcgactcg	Protospacer
******.******************************** ***************   

291. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttccgactccgacagcgattcggatagt	Protospacer
*** ***********.*********   

292. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttccgactccgacagcgattcggatagt	Protospacer
*** ***********.*********   

293. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.821

ttcggactccgacagtgattcggattcg	CRISPR spacer
ttcggactccgacagcgattcgtcgacg	Protospacer
***************.******    **

294. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
cagcgactccgacagcgattcggattctgacagt	Protospacer
*  .***********.*****************.

295. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
cagcgactccgacagcgattcggattctgacagt	Protospacer
*  .***********.*****************.

296. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
cagcgactccgacagcgattcggattctgacagt	Protospacer
*  .***********.*****************.

297. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
tgcggactccgacagcgattccgattctgacagc	Protospacer
. * ***********.***** ************

298. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.853

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctccgactccgacagcgattcggattctgactcc	Protospacer
***.***** *********************  .

299. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
cagtgactctgacagcgattcggactctgacagc	Protospacer
*  ****** **************.********.

300. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

ttcggactccgacagtgattcggattcg	CRISPR spacer
cagcgactccgacagcgattcggattct	Protospacer
.   ***********.*********** 

301. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

ttcggactccgacagtgattcggattcg	CRISPR spacer
cagcgactccgacagcgattcggattct	Protospacer
.   ***********.*********** 

302. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

ttcggactccgacagtgattcggattcg	CRISPR spacer
cagcgactccgacagcgattcggattct	Protospacer
.   ***********.*********** 

303. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctcggactctgacagcgattcggatagc	Protospacer
.********.*****.*********   

304. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
tgcggactccgacagcgattccgattctgacagc	Protospacer
. * ***** *********** ***********.

305. spacer 3.35|5140791|40|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.85

ctcggactccgacagcgacagcgattcggattctgacagc	CRISPR spacer
cagcgattccgacagcgacagcgattcggattccgacagt	Protospacer
*   **.**************************.*****.

306. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.75

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctctgattccgacagtgattcggacagc	Protospacer
.** **.*****************.   

307. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.75

ttcggactccgacagtgattcggattcg	CRISPR spacer
ctccgactccgacagtgactcggacagc	Protospacer
.** **************.*****.   

308. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctctgattccgacagtgattcggacagcgactcc	Protospacer
******.*****************.  .***  *

309. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggatagcgacagcgattcggactctgacagc	Protospacer
.** **.  ******.********.*********

310. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcagatagcgacagtgattcagattcagacagc	Protospacer
.** **.  ************.***** ******

311. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcagatagcgacagtgattcagactctgacagc	Protospacer
.** **.  ************.**.*********

312. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcagatagcgacagtgattcagattcagacagc	Protospacer
.** **.  ************.***** ******

313. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcagatagcgacagtgattcagactctgacagc	Protospacer
.** **.  ************.**.*********

314. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcagatagcgacagtgattcagactctgacagc	Protospacer
.** **.  ************.**.*********

315. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcagatagcgacagtgattcagactctgacagc	Protospacer
.** **.  ************.**.*********

316. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttcggatagcgacagcgattcggactctgacagt	Protospacer
.** **.   **************.*********

317. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttcggatagcgacagcgattcggactctgacagt	Protospacer
.** **.   **************.*********

318. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ctcggatagcgacagcgactcggactctgacagt	Protospacer
*** **.   ********.*****.*********

319. spacer 3.35|5140791|40|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.825

ctcggactccgacagcgacagcgattcggattctgacagc	CRISPR spacer
cagtgactccgactccgacagcgattcggattctgactcc	Protospacer
*   *********  **********************  *

320. spacer 3.28|5140401|28|NZ_CP015130|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.714

ttcggactccgacagtgattcggattcg	CRISPR spacer
ggcggactccgacagtgattcgacgaga	Protospacer
  ********************.    .

321. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ctccgactccgacagtgactcggacagcgactcc	Protospacer
***.**************.*****.  .***  *

322. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggatagcgacagcgattcggactctgacagt	Protospacer
.** **.  ******.********.********.

323. spacer 3.30|5140491|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

ctctgactccgacagtgattcggattctgacagc	CRISPR spacer
ttcggatagcgacagcgattcggactctgacagt	Protospacer
.** **.  ******.********.********.

324. spacer 3.32|5140587|34|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

ctctgactcggacagcgattcggattctgacagt	CRISPR spacer
ttcggatagcgacagcgactcggattcggacagt	Protospacer
.** **.   ********.******** ******

325. spacer 3.36|5140851|52|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.846

ttcggattccgacagcgactcggactctgacagtgactccgattcggacagc	CRISPR spacer
ctcggattccgacagcgactcggactctgacagcgactccgacagtgactcc	Protospacer
.********************************.********.   ***  *

326. spacer 3.26|5140239|70|NZ_CP015130|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 13, identity: 0.814

ctccgattctgacagcgattctgactctgacagcgactccgattctgacagtgattcgga	CRISPR spacer
ttccgattctgacagcgattccgactctgacagcgactccgattccgacagtgattcgga	Protospacer
.********************.***********************.**************

327. spacer 3.5|5137419|148|NZ_CP015130|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 90, identity: 0.392

ctccgactccgactccgacagcgactctgactcggacagcgattcggactctgacagtga	CRISPR spacer
cagcgactccgactccgacagcgactctgactcggacagcgattcggactctgacagtga	Protospacer
*  *********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 237452 : 286099 62 Klebsiella_phage(20.0%) terminase,integrase,tRNA,holin,tail attL 236649:236665|attR 247067:247083
DBSCAN-SWA_2 386194 : 427470 56 Salmonella_phage(32.56%) capsid,terminase,head,holin,tail NA
DBSCAN-SWA_3 508465 : 519351 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_4 1441352 : 1456224 14 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_5 1499417 : 1506325 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_6 2519956 : 2557180 45 Escherichia_phage(36.59%) capsid,plate,terminase,integrase,tRNA,head,lysis,holin,portal,tail attL 2555478:2555494|attR 2557202:2557218
DBSCAN-SWA_7 3281281 : 3387799 115 Escherichia_phage(55.32%) capsid,protease,plate,terminase,integrase,tRNA,head,lysis,portal,holin,tail attL 3320637:3320680|attR 3350320:3350363
DBSCAN-SWA_8 5031639 : 5041113 8 Dickeya_phage(16.67%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP015132
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2115 : 49738 38 Shigella_phage(33.33%) transposase,bacteriocin NA
DBSCAN-SWA_2 120418 : 177457 52 uncultured_Caudovirales_phage(31.25%) transposase,holin,integrase,protease attL 109440:109455|attR 154583:154598
DBSCAN-SWA_3 187280 : 196802 9 Escherichia_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage