Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP014764 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-704, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014762 Klebsiella pneumoniae strain KPNIH39 chromosome, complete genome 1 crisprs RT,WYL,cas3,DEDDh,DinG,csa3 0 1 7 0
NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 0 crisprs csa3,RT 0 0 3 0

Results visualization

1. NZ_CP014765
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10758 : 56765 42 Escherichia_phage(27.78%) transposase,integrase attL 18921:18935|attR 58123:58137
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014762
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014762_1 2364400-2364494 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014762_1 1.1|2364429|37|NZ_CP014762|CRISPRCasFinder 2364429-2364465 37 MH178096 Aeromonas phage AsXd-1, complete genome 10850-10886 5 0.865

1. spacer 1.1|2364429|37|NZ_CP014762|CRISPRCasFinder matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 5, identity: 0.865

aatcgttcactacctggtgcaacagattcactacctg	CRISPR spacer
aatcgttcactacctggtgcagcagattcaccccgta	Protospacer
*********************.*********. * *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 79814 : 156710 84 Enterobacteria_phage(42.11%) portal,capsid,integrase,plate,tail,tRNA,head,protease,terminase attL 83997:84038|attR 119232:119273
DBSCAN-SWA_2 1827900 : 1837363 8 Dickeya_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_3 2069596 : 2151138 98 Escherichia_phage(15.69%) portal,capsid,holin,transposase,integrase,tail,tRNA,head,protease,terminase attL 2061548:2061565|attR 2158592:2158609
DBSCAN-SWA_4 2242636 : 2310334 80 Salmonella_phage(20.0%) holin,integrase,tail,protease,terminase attL 2253714:2253730|attR 2277102:2277118
DBSCAN-SWA_5 2352625 : 2430236 85 Klebsiella_phage(57.89%) portal,capsid,holin,integrase,plate,transposase,tail,head,protease,terminase attL 2346767:2346782|attR 2379358:2379373
DBSCAN-SWA_6 2635273 : 2646160 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3645822 : 3652729 6 Bacillus_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP014763
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3779 : 74094 57 uncultured_Caudovirales_phage(25.0%) integrase,transposase,protease NA
DBSCAN-SWA_2 85074 : 122770 33 Salmonella_phage(33.33%) transposase,protease,integrase attL 74482:74495|attR 94473:94486
DBSCAN-SWA_3 167314 : 232320 47 Salmonella_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage