Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 1 crisprs DEDDh,csf3gr5,csf2gr7,csf4gr11,csf1gr8 0 1 0 0
NZ_CP015596 Mycobacterium sp. YC-RL4 chromosome, complete genome 0 crisprs csa3,DEDDh,cas3,DinG,WYL 0 0 3 0

Results visualization

1. NZ_CP015597
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015597_1 54151-54223 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015597_1 1.1|54174|27|NZ_CP015597|CRISPRCasFinder 54174-54200 27 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 54174-54200 0 1.0

1. spacer 1.1|54174|27|NZ_CP015597|CRISPRCasFinder matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtgctacccgccaggttcgtggtcc	CRISPR spacer
tagtgctacccgccaggttcgtggtcc	Protospacer
***************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015596
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 335594 : 459217 108 Mycobacterium_phage(44.44%) integrase,transposase attL 376944:377003|attR 459248:459285
DBSCAN-SWA_2 2964010 : 2992637 27 Mycobacterium_phage(30.0%) protease,integrase,capsid,terminase,portal,transposase attL 2962210:2962234|attR 2975951:2975975
DBSCAN-SWA_3 3362604 : 3425009 45 uncultured_Mediterranean_phage(57.14%) integrase,transposase,holin attL 3387641:3387658|attR 3440453:3440470
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage