Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048227 Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048226 Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048224 Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP048223 Aeromonas salmonicida subsp. salmonicida strain J223 chromosome, complete genome 11 crisprs csa3,TnsE_C,WYL,cas3,DEDDh,DinG 0 1 8 0
NZ_CP048225 Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP048223
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_1 428344-428488 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_2 1450474-1450572 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_3 1725960-1726046 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_4 1816158-1816251 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_5 1898876-1899018 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_6 2424290-2424389 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_7 2669709-2669821 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_8 3021883-3021973 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_9 3084646-3084784 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_10 3477014-3477109 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048223_11 4651609-4651732 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048223_9 9.1|3084699|33|NZ_CP048223|CRISPRCasFinder 3084699-3084731 33 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 99642-99674 8 0.758

1. spacer 9.1|3084699|33|NZ_CP048223|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 8, identity: 0.758

gatacccagcagctcaacgtcgaagatcagcac	CRISPR spacer
gattgacagtagctctacgtcgaagatcagagt	Protospacer
***   ***.***** ************** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1609052 : 1667990 45 Indivirus(18.18%) transposase,integrase,protease attL 1627288:1627305|attR 1669802:1669819
DBSCAN-SWA_2 2302602 : 2415428 114 Aeromonas_virus(66.0%) terminase,tail,capsid,portal,integrase,transposase,tRNA,head,holin attL 2323840:2323857|attR 2395390:2395407
DBSCAN-SWA_3 2456923 : 2465120 6 Stenotrophomonas_phage(16.67%) NA NA
DBSCAN-SWA_4 2584168 : 2594091 9 uncultured_Mediterranean_phage(28.57%) tRNA NA
DBSCAN-SWA_5 3022055 : 3077366 48 Morganella_phage(16.67%) transposase,integrase,tRNA,capsid attL 3023133:3023192|attR 3077330:3078493
DBSCAN-SWA_6 3643322 : 3714116 53 uncultured_Caudovirales_phage(44.44%) transposase,plate,tRNA NA
DBSCAN-SWA_7 3729516 : 3739377 12 Yersinia_phage(14.29%) transposase,tRNA,protease NA
DBSCAN-SWA_8 4614437 : 4696092 80 Aeromonas_virus(73.17%) terminase,holin,tail,capsid,transposase,portal,tRNA,head,integrase attL 4637910:4637926|attR 4677073:4677089
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP048224
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33445 : 85024 45 uncultured_virus(28.57%) transposase NA
DBSCAN-SWA_2 100065 : 155193 51 Shigella_phage(16.67%) transposase,integrase attL 102621:102680|attR 157977:160589
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage