Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011406 Vibrio parahaemolyticus strain FORC_014 chromosome 1, complete sequence 0 crisprs cas3,DinG,csa3,csx1,DEDDh,c2c9_V-U4,WYL 0 0 7 0
NZ_CP011408 Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP011407 Vibrio parahaemolyticus strain FORC_014 chromosome 2, complete sequence 1 crisprs DEDDh,csa3,cas3 0 0 1 0

Results visualization

1. NZ_CP011406
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 798797 : 805499 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1154706 : 1234899 81 Vibrio_phage(68.89%) terminase,head,tRNA,portal,tail,integrase,capsid,protease attL 1155489:1155513|attR 1190754:1190778
DBSCAN-SWA_3 1367367 : 1377181 7 Mycobacterium_phage(16.67%) tRNA NA
DBSCAN-SWA_4 1816982 : 1828520 15 Vibrio_phage(91.67%) NA NA
DBSCAN-SWA_5 2137489 : 2204703 58 Vibrio_phage(54.84%) integrase,capsid,transposase attL 2134579:2134599|attR 2207899:2207919
DBSCAN-SWA_6 2212914 : 2227331 18 Vibrio_phage(45.45%) integrase,tRNA attL 2215104:2215118|attR 2225356:2225370
DBSCAN-SWA_7 2921220 : 2938616 14 uncultured_Mediterranean_phage(20.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP011408
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011408_1 17150-17221 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011408_1 1.1|17173|26|NZ_CP011408|CRISPRCasFinder 17173-17198 26 NZ_CP011408 Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence 17173-17198 0 1.0

1. spacer 1.1|17173|26|NZ_CP011408|CRISPRCasFinder matches to NZ_CP011408 (Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence) position: , mismatch: 0, identity: 1.0

tgacattgttctattgtgtattatag	CRISPR spacer
tgacattgttctattgtgtattatag	Protospacer
**************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP011407
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011407_1 68165-68262 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1091391 : 1097985 11 Vibrio_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage