Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011156 Bacillus cereus strain HN001 plasmid pRML01, complete sequence 0 crisprs cas14j,csa3,cas14k,Cas14u_CAS-V 0 0 4 0
NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 1 crisprs NA 0 2 1 0
NZ_CP011155 Bacillus cereus strain HN001, complete genome 6 crisprs cas3,csa3,WYL,c2c9_V-U4,DinG,DEDDh,cas14k 1 2 9 0

Results visualization

1. NZ_CP011157
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011157_1 9230-9547 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9260-9289 0 1.0
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9332-9361 0 1.0
NZ_CP011157_1 1.4|9464|42|NZ_CP011157|CRT 9464-9505 42 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9380-9421 0 1.0
NZ_CP011157_1 1.4|9464|42|NZ_CP011157|CRT 9464-9505 42 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9464-9505 0 1.0
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9284-9313 1 0.967
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9308-9337 1 0.967
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9392-9421 1 0.967
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9476-9505 1 0.967
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100204-100233 1 0.967
NZ_CP011157_1 1.4|9464|42|NZ_CP011157|CRT 9464-9505 42 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9248-9289 1 0.976
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9356-9385 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9416-9445 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9440-9469 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9500-9529 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100084-100113 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100120-100149 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100156-100185 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100180-100209 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100228-100257 2 0.933
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100288-100317 3 0.9
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15357-15386 3 0.9
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15453-15482 3 0.9
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15585-15614 3 0.9
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15705-15734 3 0.9
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 9524-9553 5 0.833
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP022446 Bacillus cereus C1L plasmid pC1L1, complete sequence 471753-471782 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP022446 Bacillus cereus C1L plasmid pC1L1, complete sequence 471801-471830 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 152666-152695 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP024688 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-4-144K, complete sequence 100161-100190 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP024688 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-4-144K, complete sequence 100209-100238 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP046512 Bacillus cereus strain JHU plasmid p1, complete sequence 500094-500123 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 104527-104556 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 104623-104652 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 104719-104748 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_005707 Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence 55579-55608 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_005707 Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence 55675-55704 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_005707 Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence 55771-55800 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP023246 Bacillus cereus strain HBL-AI plasmid unnamed1, complete sequence 475065-475094 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP042875 Bacillus cereus strain 09 plasmid unnamed1, complete sequence 216849-216878 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP045607 Bacillus cereus strain SB1 plasmid p1, complete sequence 487770-487799 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 127642-127671 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 127738-127767 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 127834-127863 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 143503-143532 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 143551-143580 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 143599-143628 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 143755-143784 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP045534 Bacillaceae bacterium C02 plasmid unnamed1, complete sequence 45918-45947 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP045534 Bacillaceae bacterium C02 plasmid unnamed1, complete sequence 46014-46043 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP045534 Bacillaceae bacterium C02 plasmid unnamed1, complete sequence 46110-46139 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 68575-68604 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 68623-68652 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 68671-68700 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 68875-68904 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP007513 Bacillus bombysepticus plasmid pBb, complete genome 161392-161421 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_AP014865 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence 433471-433500 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_AP014865 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence 433519-433548 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014853 Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence 337774-337803 6 0.8
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 152594-152623 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 152762-152791 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP020005 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence 121629-121658 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP020005 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence 121665-121694 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP046512 Bacillus cereus strain JHU plasmid p1, complete sequence 499806-499835 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP046512 Bacillus cereus strain JHU plasmid p1, complete sequence 499950-499979 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP004876 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence 82226-82255 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP004877 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence 303392-303421 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_017203 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence 119899-119928 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_020384 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence 124122-124151 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014283 Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence 248803-248832 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 104479-104508 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 104575-104604 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 104671-104700 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 372938-372967 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 443699-443728 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP015152 Bacillus thuringiensis strain Bc601 plasmid pBTBC2, complete sequence 119824-119853 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_005707 Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence 55531-55560 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_005707 Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence 55627-55656 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_005707 Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence 55723-55752 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 458279-458308 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 458423-458452 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP032614 Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence 422392-422421 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP007616 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence 63763-63792 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP004860 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence 314662-314691 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP004861 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence 82508-82537 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP010111 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence 244699-244728 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP010111 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence 244747-244776 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP010111 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence 244795-244824 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP010111 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence 244843-244872 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP053930 Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence 10511-10540 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP053930 Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence 10559-10588 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP053930 Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence 10751-10780 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP022346 Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence 23779-23808 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP022346 Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence 23827-23856 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP022346 Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence 23875-23904 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP022346 Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence 23923-23952 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP040343 Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence 181037-181066 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP023246 Bacillus cereus strain HBL-AI plasmid unnamed1, complete sequence 475041-475070 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 185886-185915 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 185934-185963 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP040341 Bacillus cereus strain DLOU-Tangshan plasmid unnamed1, complete sequence 234029-234058 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP050184 Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence 348621-348650 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP010091 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence 76781-76810 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_018492 Bacillus cereus FRI-35 plasmid p01, complete sequence 123589-123618 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016589 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence 87025-87054 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 127594-127623 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 127690-127719 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 127786-127815 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_KY940428 UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence 75080-75109 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_KY940428 UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence 75128-75157 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_KY940428 UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence 75176-75205 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP036355 Bacillus sp. SYJ plasmid unnamed1, complete sequence 79976-80005 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP036355 Bacillus sp. SYJ plasmid unnamed1, complete sequence 80096-80125 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP036355 Bacillus sp. SYJ plasmid unnamed1, complete sequence 80288-80317 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP053290 Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence 199564-199593 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP053290 Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence 199708-199737 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_020394 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence 187481-187510 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_020394 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence 187529-187558 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_020394 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence 187577-187606 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014284 Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence 211496-211525 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 143455-143484 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 143659-143688 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 143707-143736 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP041978 Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence 280799-280828 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP041978 Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence 280847-280876 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP041978 Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence 280895-280924 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011655 Bacillus cereus AH187 plasmid pAH187_270, complete sequence 50633-50662 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011655 Bacillus cereus AH187 plasmid pAH187_270, complete sequence 50729-50758 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011655 Bacillus cereus AH187 plasmid pAH187_270, complete sequence 50825-50854 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP045534 Bacillaceae bacterium C02 plasmid unnamed1, complete sequence 45966-45995 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP045534 Bacillaceae bacterium C02 plasmid unnamed1, complete sequence 46062-46091 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP045534 Bacillaceae bacterium C02 plasmid unnamed1, complete sequence 46158-46187 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP013056 Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-1, complete sequence 82760-82789 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP032609 Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence 5337-5366 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP032609 Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence 303433-303462 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_010924 Bacillus cereus strain AH187 plasmid pCER270, complete sequence 107042-107071 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_010924 Bacillus cereus strain AH187 plasmid pCER270, complete sequence 107138-107167 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_010924 Bacillus cereus strain AH187 plasmid pCER270, complete sequence 107234-107263 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 68719-68748 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 68779-68808 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 68827-68856 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP045776 Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence 96357-96386 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP045776 Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence 96453-96482 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP045776 Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence 96549-96578 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP042928 Bacillus cereus strain G1-1 plasmid unnamed, complete sequence 69218-69247 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP041980 Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence 263752-263781 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP041980 Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence 263800-263829 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP041980 Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence 263848-263877 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP041980 Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence 263896-263925 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_AP014866 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence 62905-62934 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP046513 Bacillus cereus strain JHU plasmid p2, complete sequence 267350-267379 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP046513 Bacillus cereus strain JHU plasmid p2, complete sequence 267470-267499 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP046513 Bacillus cereus strain JHU plasmid p2, complete sequence 267530-267559 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP046513 Bacillus cereus strain JHU plasmid p2, complete sequence 267626-267655 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_016792 Bacillus cereus NC7401 plasmid pNCcld, complete sequence 105911-105940 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_016792 Bacillus cereus NC7401 plasmid pNCcld, complete sequence 106007-106036 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_016792 Bacillus cereus NC7401 plasmid pNCcld, complete sequence 106103-106132 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 360952-360981 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 361000-361029 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP009636 Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence 133315-133344 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP009636 Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence 133411-133440 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP009299 Bacillus cereus D17 plasmid unnamed, complete sequence 166644-166673 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP009299 Bacillus cereus D17 plasmid unnamed, complete sequence 166788-166817 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP009299 Bacillus cereus D17 plasmid unnamed, complete sequence 166836-166865 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP020755 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence 425484-425513 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP020755 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence 425532-425561 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 CP020755 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence 425580-425609 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP021062 Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence 56442-56471 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP021062 Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence 56490-56519 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP021062 Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence 56538-56567 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_018486 Bacillus thuringiensis HD-771 plasmid p01, complete sequence 154244-154273 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP053962 Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence 197691-197720 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP053962 Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence 197787-197816 7 0.767
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP020005 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence 121701-121730 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_017203 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence 120043-120072 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NC_020384 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence 124266-124295 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP010578 Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB232, complete sequence 96153-96182 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 443591-443620 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 930898-930927 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP015152 Bacillus thuringiensis strain Bc601 plasmid pBTBC2, complete sequence 119932-119961 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP004861 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence 82616-82645 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP050184 Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence 259394-259423 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP010091 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence 76889-76918 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP016589 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence 86929-86958 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_KX258624 Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence 94955-94984 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_KX258624 Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence 95027-95056 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_KX258624 Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence 95063-95092 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_KX258624 Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence 95099-95128 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP014284 Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence 211424-211453 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP013056 Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-1, complete sequence 82652-82681 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP032609 Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence 5229-5258 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP032609 Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence 5265-5294 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP032609 Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence 303325-303354 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_CP032609 Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence 303361-303390 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 NZ_AP014866 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence 62869-62898 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 AF008938 Vibrio cholerae V86 phage putative replication protein gene, complete cds 5594-5623 8 0.733
NZ_CP011157_1 1.2|9332|30|NZ_CP011157|CRT 9332-9361 30 MN694152 Marine virus AFVG_250M376, complete genome 32585-32614 8 0.733

1. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 0, identity: 1.0

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctcaggttttggctctggcttcggctc	Protospacer
******************************

2. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 0, identity: 1.0

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctcaggttttggctctggcttcggctc	Protospacer
******************************

3. spacer 1.4|9464|42|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 0, identity: 1.0

cggttcaggtttcggctcaggttttggctctggcttcggttc	CRISPR spacer
cggttcaggtttcggctcaggttttggctctggcttcggttc	Protospacer
******************************************

4. spacer 1.4|9464|42|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 0, identity: 1.0

cggttcaggtttcggctcaggttttggctctggcttcggttc	CRISPR spacer
cggttcaggtttcggctcaggttttggctctggcttcggttc	Protospacer
******************************************

5. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 1, identity: 0.967

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctcaggttttggttctggcttcggctc	Protospacer
***************.**************

6. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 1, identity: 0.967

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctcaggttttggttctggcttcggctc	Protospacer
***************.**************

7. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 1, identity: 0.967

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctcaggttttggctctggcttcggttc	Protospacer
***************************.**

8. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 1, identity: 0.967

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctcaggttttggctctggcttcggttc	Protospacer
***************************.**

9. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 1, identity: 0.967

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctctggttttggctctggcttcggctc	Protospacer
****** ***********************

10. spacer 1.4|9464|42|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 1, identity: 0.976

cggttcaggtttcggctcaggttttggctctggcttcggttc	CRISPR spacer
cggttcaggtttcggctcaggttttggctctggcttcggctc	Protospacer
***************************************.**

11. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctcaggttttggttctggcttcggttc	Protospacer
***************.***********.**

12. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggttcaggttttggttctggcttcggctc	Protospacer
***.***********.**************

13. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctcaggttttggttctggcttcggttc	Protospacer
***************.***********.**

14. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggttcaggttttggttctggcttcggctc	Protospacer
***.***********.**************

15. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctctggtttcggctctggcttcggctc	Protospacer
****** *****.*****************

16. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctctggtttcggctctggcttcggctc	Protospacer
****** *****.*****************

17. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctctggtttcggctctggcttcggctc	Protospacer
****** *****.*****************

18. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctctggtttcggctctggcttcggctc	Protospacer
****** *****.*****************

19. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 2, identity: 0.933

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctctggtttcggctctggcttcggctc	Protospacer
****** *****.*****************

20. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 3, identity: 0.9

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cagttctggttttggctctggcttcggctc	Protospacer
*.*.** ***********************

21. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.9

cggctcaggttttggctctggcttcggctc	CRISPR spacer
aggctctggttttggctctggcttaggctc	Protospacer
 ***** ***************** *****

22. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.9

cggctcaggttttggctctggcttcggctc	CRISPR spacer
gggctctggttttggctctggcttaggctc	Protospacer
 ***** ***************** *****

23. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.9

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tggctctggttttggctctggcttaggctc	Protospacer
.***** ***************** *****

24. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.9

cggctcaggttttggctctggcttcggctc	CRISPR spacer
gggctctggttttggctctggcttaggctc	Protospacer
 ***** ***************** *****

25. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 5, identity: 0.833

cggctcaggttttggctctggcttcggctc---	CRISPR spacer
cggctcaggttttggttctggctt---ttcaga	Protospacer
***************.********   .**   

26. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttgggtctggcttcacttc	Protospacer
** .*********** *********. .**

27. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttgggtctggcttcacttc	Protospacer
** .*********** *********. .**

28. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggctctggcttcacttc	Protospacer
.* .*********************. .**

29. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP024688 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-4-144K, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtctcaggttttgggtctggcttcacttc	Protospacer
.* ************ *********. .**

30. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP024688 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-4-144K, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtctcaggttttgggtctggcttcacttc	Protospacer
.* ************ *********. .**

31. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP046512 (Bacillus cereus strain JHU plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttgggtctggcttcacttc	Protospacer
** .*********** *********. .**

32. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

33. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

34. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

35. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_005707 (Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

36. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_005707 (Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

37. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_005707 (Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

38. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP023246 (Bacillus cereus strain HBL-AI plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tggctctggttttggctctggttttgtttc	Protospacer
.***** **************.**.* .**

39. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP042875 (Bacillus cereus strain 09 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

40. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

41. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

42. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

43. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

44. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

45. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

46. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttgggtctggcttcacttc	Protospacer
** .*********** *********. .**

47. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttgggtctggcttcacttc	Protospacer
** .*********** *********. .**

48. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP045534 (Bacillaceae bacterium C02 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

49. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP045534 (Bacillaceae bacterium C02 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

50. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP045534 (Bacillaceae bacterium C02 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

51. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

52. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

53. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttgggtctggcttcacttc	Protospacer
** .*********** *********. .**

54. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttgggtctggcttcacttc	Protospacer
** .*********** *********. .**

55. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP007513 (Bacillus bombysepticus plasmid pBb, complete genome) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

56. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

57. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttggatctggcttcacttc	Protospacer
** .*********** *********. .**

58. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014853 (Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence) position: , mismatch: 6, identity: 0.8

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cgtttcaggttttgggtctggcttcacttc	Protospacer
** .*********** *********. .**

59. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

60. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

61. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP020005 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcctcaggttttgggtctggcttcacttc	Protospacer
.  ************ *********. .**

62. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP020005 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcctcaggttttgggtctggcttcacttc	Protospacer
.  ************ *********. .**

63. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP046512 (Bacillus cereus strain JHU plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

64. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP046512 (Bacillus cereus strain JHU plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

65. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP004876 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

66. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP004877 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacccctggttttgtctctggctttggctc	Protospacer
.. *.* ******* *********.*****

67. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_017203 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

68. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_020384 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

69. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacccctggttttgtctctggctttggctc	Protospacer
.. *.* ******* *********.*****

70. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

71. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

72. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

73. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacccctggttttgtctctggctttggctc	Protospacer
.. *.* ******* *********.*****

74. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

75. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP015152 (Bacillus thuringiensis strain Bc601 plasmid pBTBC2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

76. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_005707 (Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

77. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_005707 (Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

78. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_005707 (Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

79. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

80. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

81. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP032614 (Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacccctggttttgtctctggctttggctc	Protospacer
.. *.* ******* *********.*****

82. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP007616 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacccctggttttgtctctggctttggctc	Protospacer
.. *.* ******* *********.*****

83. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP004860 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacccctggttttgtctctggctttggctc	Protospacer
.. *.* ******* *********.*****

84. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP004861 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

85. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP010111 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

86. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP010111 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

87. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP010111 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

88. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP010111 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

89. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP053930 (Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

90. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP053930 (Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

91. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP053930 (Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

92. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP022346 (Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

93. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP022346 (Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

94. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP022346 (Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

95. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP022346 (Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

96. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP040343 (Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

97. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP023246 (Bacillus cereus strain HBL-AI plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacccctggttttgtctctggctttggctc	Protospacer
.. *.* ******* *********.*****

98. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

99. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

100. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP040341 (Bacillus cereus strain DLOU-Tangshan plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

101. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacccctggttttgtctctggctttggctc	Protospacer
.. *.* ******* *********.*****

102. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP010091 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

103. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_018492 (Bacillus cereus FRI-35 plasmid p01, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

104. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

105. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

106. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

107. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

108. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

109. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

110. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

111. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP036355 (Bacillus sp. SYJ plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

112. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP036355 (Bacillus sp. SYJ plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

113. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP036355 (Bacillus sp. SYJ plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

114. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

115. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

116. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_020394 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

117. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_020394 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

118. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_020394 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

119. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014284 (Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

120. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

121. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

122. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

123. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

124. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

125. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

126. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

127. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

128. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

129. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP045534 (Bacillaceae bacterium C02 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

130. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP045534 (Bacillaceae bacterium C02 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

131. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP045534 (Bacillaceae bacterium C02 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

132. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP013056 (Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

133. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

134. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

135. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

136. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

137. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

138. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

139. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

140. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

141. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

142. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

143. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

144. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP042928 (Bacillus cereus strain G1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

145. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

146. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

147. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

148. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

149. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_AP014866 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

150. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP046513 (Bacillus cereus strain JHU plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

151. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP046513 (Bacillus cereus strain JHU plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

152. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP046513 (Bacillus cereus strain JHU plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

153. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP046513 (Bacillus cereus strain JHU plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

154. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

155. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

156. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

157. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

158. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

159. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP009636 (Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

160. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP009636 (Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

161. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP009299 (Bacillus cereus D17 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

162. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP009299 (Bacillus cereus D17 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

163. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP009299 (Bacillus cereus D17 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

164. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

165. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

166. spacer 1.2|9332|30|NZ_CP011157|CRT matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

167. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

168. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

169. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttggatctggcttcacttc	Protospacer
.* .*********** *********. .**

170. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_018486 (Bacillus thuringiensis HD-771 plasmid p01, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

171. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP053962 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

172. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP053962 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tgtttcaggttttgggtctggcttcacttc	Protospacer
.* .*********** *********. .**

173. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP020005 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacttcaggttttggatctggcttcacttc	Protospacer
.. .*********** *********. .**

174. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_017203 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

175. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NC_020384 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

176. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP010578 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB232, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacttcaggttttggatctggcttcacttc	Protospacer
.. .*********** *********. .**

177. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

178. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
gtgctctggttttggctctggctgtgatac	Protospacer
  **** **************** .*.. *

179. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP015152 (Bacillus thuringiensis strain Bc601 plasmid pBTBC2, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

180. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP004861 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

181. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacttcaggttttgggtctggcttcacttc	Protospacer
.. .*********** *********. .**

182. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP010091 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

183. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
tacttcaggttttggatctggcttcacttc	Protospacer
.. .*********** *********. .**

184. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

185. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttgggtctggcttcacttc	Protospacer
.  .*********** *********. .**

186. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttgggtctggcttcacttc	Protospacer
.  .*********** *********. .**

187. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

188. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP014284 (Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

189. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP013056 (Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-1, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

190. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

191. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

192. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

193. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

194. spacer 1.2|9332|30|NZ_CP011157|CRT matches to NZ_AP014866 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
ttcttcaggttttggatctggcttcacttc	Protospacer
.  .*********** *********. .**

195. spacer 1.2|9332|30|NZ_CP011157|CRT matches to AF008938 (Vibrio cholerae V86 phage putative replication protein gene, complete cds) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
aatctccggttttggctcgggcttcgtagc	Protospacer
 . *** *********** *******   *

196. spacer 1.2|9332|30|NZ_CP011157|CRT matches to MN694152 (Marine virus AFVG_250M376, complete genome) position: , mismatch: 8, identity: 0.733

cggctcaggttttggctctggcttcggctc	CRISPR spacer
cggctctggttttggctctggtgtagctga	Protospacer
****** **************. * * .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17874 : 44476 31 Bacillus_phage(40.0%) integrase,bacteriocin,transposase attL 40263:40278|attR 47000:47015
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP011156
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22158 : 95208 48 Bacillus_phage(35.71%) transposase NA
DBSCAN-SWA_2 218173 : 278877 48 Bacillus_phage(50.0%) coat,transposase NA
DBSCAN-SWA_3 288749 : 340368 42 Bacillus_phage(52.94%) transposase,protease,integrase attL 281747:281762|attR 333301:333316
DBSCAN-SWA_4 426353 : 433550 6 Catovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP011155
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011155_1 2061151-2061299 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011155_2 4692175-4692244 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011155_5 4693267-4693352 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011155_3 4692547-4692688 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011155_4 4692889-4693075 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011155_6 5190610-5190743 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP011155_2 2.1|4692199|21|NZ_CP011155|CRISPRCasFinder 4692199-4692219 21 NZ_CP011155.1 4691179-4691199 2 0.905

1. spacer 2.1|4692199|21|NZ_CP011155|CRISPRCasFinder matches to position: 4691179-4691199, mismatch: 2, identity: 0.905

ggacctatctctccctgcaca	CRISPR spacer
ggacctatctctccttgaaca	Protospacer
**************.** ***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011155_6 6.1|5190633|31|NZ_CP011155|CRISPRCasFinder 5190633-5190663 31 MG945583 UNVERIFIED: Microviridae sp. isolate 3973-1602, complete genome 2021-2051 7 0.774
NZ_CP011155_1 1.1|2061193|35|NZ_CP011155|PILER-CR 2061193-2061227 35 NZ_CP014853 Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence 48468-48502 8 0.771
NZ_CP011155_1 1.1|2061193|35|NZ_CP011155|PILER-CR 2061193-2061227 35 NZ_CP014286 Bacillus thuringiensis strain Bt185 plasmid pBT1850054, complete sequence 8422-8456 8 0.771
NZ_CP011155_1 1.1|2061193|35|NZ_CP011155|PILER-CR 2061193-2061227 35 NZ_CP032610 Bacillus thuringiensis strain QZL38 plasmid p.3, complete sequence 5427-5461 8 0.771
NZ_CP011155_1 1.1|2061193|35|NZ_CP011155|PILER-CR 2061193-2061227 35 NZ_CP032610 Bacillus thuringiensis strain QZL38 plasmid p.3, complete sequence 59631-59665 8 0.771
NZ_CP011155_1 1.1|2061193|35|NZ_CP011155|PILER-CR 2061193-2061227 35 NZ_CP016589 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence 495105-495139 9 0.743
NZ_CP011155_1 1.1|2061193|35|NZ_CP011155|PILER-CR 2061193-2061227 35 NZ_CP018742 Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence 109155-109189 9 0.743
NZ_CP011155_1 1.1|2061193|35|NZ_CP011155|PILER-CR 2061193-2061227 35 MN694246 Marine virus AFVG_250M226, complete genome 22630-22664 11 0.686

1. spacer 6.1|5190633|31|NZ_CP011155|CRISPRCasFinder matches to MG945583 (UNVERIFIED: Microviridae sp. isolate 3973-1602, complete genome) position: , mismatch: 7, identity: 0.774

ttcttcttttttgtcactagtcgaaccgctt	CRISPR spacer
ttcttcttttttgtccctaatcgtcttgttt	Protospacer
*************** ***.***  ..*.**

2. spacer 1.1|2061193|35|NZ_CP011155|PILER-CR matches to NZ_CP014853 (Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence) position: , mismatch: 8, identity: 0.771

accacaaagaccagattatatttctaatgtggccg	CRISPR spacer
accacaacgaccagattatatttctaactatgaaa	Protospacer
******* *******************.   *  .

3. spacer 1.1|2061193|35|NZ_CP011155|PILER-CR matches to NZ_CP014286 (Bacillus thuringiensis strain Bt185 plasmid pBT1850054, complete sequence) position: , mismatch: 8, identity: 0.771

accacaaagaccagattatatttctaatgtggccg	CRISPR spacer
accacaacgaccagattatgtttctagttatgaag	Protospacer
******* ***********.******.*   *  *

4. spacer 1.1|2061193|35|NZ_CP011155|PILER-CR matches to NZ_CP032610 (Bacillus thuringiensis strain QZL38 plasmid p.3, complete sequence) position: , mismatch: 8, identity: 0.771

accacaaagaccagattatatttctaatgtggccg	CRISPR spacer
accacaacgaccagattatgtttctagttatgaag	Protospacer
******* ***********.******.*   *  *

5. spacer 1.1|2061193|35|NZ_CP011155|PILER-CR matches to NZ_CP032610 (Bacillus thuringiensis strain QZL38 plasmid p.3, complete sequence) position: , mismatch: 8, identity: 0.771

accacaaagaccagattatatttctaatgtggccg	CRISPR spacer
accacaacgaccagattatgtttctagttatgaag	Protospacer
******* ***********.******.*   *  *

6. spacer 1.1|2061193|35|NZ_CP011155|PILER-CR matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 9, identity: 0.743

accacaaagaccagattatatttctaatgtggccg	CRISPR spacer
accacaacgaccagattacatttctagttatgaaa	Protospacer
******* **********.*******.*   *  .

7. spacer 1.1|2061193|35|NZ_CP011155|PILER-CR matches to NZ_CP018742 (Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence) position: , mismatch: 9, identity: 0.743

accacaaagaccagattatatttctaatgtggccg	CRISPR spacer
accacaacgacctgattatatttctgttgatggaa	Protospacer
******* **** ************. **  *  .

8. spacer 1.1|2061193|35|NZ_CP011155|PILER-CR matches to MN694246 (Marine virus AFVG_250M226, complete genome) position: , mismatch: 11, identity: 0.686

accacaaagaccagattatatttctaatgtggccg	CRISPR spacer
tattgaaagaccagattataattcttatgtatcta	Protospacer
  .  *************** **** ****. *..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 231360 : 239308 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 284519 : 292895 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 627306 : 635303 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_4 1820526 : 1829202 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 2008127 : 2036128 31 Bacillus_phage(38.1%) portal,head,integrase,terminase attL 2015911:2015926|attR 2036692:2036707
DBSCAN-SWA_6 2466688 : 2554653 86 Bacillus_phage(70.45%) portal,tRNA,transposase,protease,bacteriocin,tail,terminase,holin,capsid,head,integrase attL 2501172:2501204|attR 2562124:2562156
DBSCAN-SWA_7 3623928 : 3634085 14 Bacillus_phage(45.45%) bacteriocin NA
DBSCAN-SWA_8 3687873 : 3819422 118 Bacillus_phage(46.15%) coat,portal,tRNA,protease,transposase,bacteriocin,integrase,tail,holin,capsid,head,terminase attL 3697619:3697636|attR 3821482:3821499
DBSCAN-SWA_9 3884323 : 3956212 85 Bacillus_phage(83.02%) portal,tRNA,protease,integrase,tail,holin,capsid,terminase attL 3883950:3883966|attR 3956603:3956619
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage