Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 0 crisprs csa3,cas14j,RT,Cas14u_CAS-V,cas14k 0 0 34 0
NZ_CP011151 Bacillus cereus strain CMCC P0021, complete genome 5 crisprs cas3,csa3,WYL,c2c9_V-U4,cas14j,c2c10_CAS-V-U3,DinG,cas14k,DEDDh 0 23 11 0

Results visualization

1. NZ_CP011152
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 10081 7 Bacillus_phage(66.67%) integrase attL 3095:3110|attR 14500:14515
DBSCAN-SWA_2 18342 : 19575 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_3 25174 : 25729 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_4 30942 : 32016 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_5 35583 : 46407 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_6 54603 : 54876 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_7 58404 : 78053 7 Tupanvirus(75.0%) NA NA
DBSCAN-SWA_8 86614 : 87736 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_9 91661 : 92498 2 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_10 100468 : 101638 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_11 107823 : 109848 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_12 113165 : 115727 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_13 144102 : 146310 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_14 167471 : 169301 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_15 203033 : 204851 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_16 236589 : 267299 28 uncultured_Caudovirales_phage(33.33%) protease,transposase NA
DBSCAN-SWA_17 270634 : 278544 11 Bacillus_phage(90.91%) NA NA
DBSCAN-SWA_18 286683 : 288105 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_19 297463 : 299644 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_20 303764 : 313692 9 Bacillus_virus(25.0%) transposase NA
DBSCAN-SWA_21 321962 : 323564 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_22 331990 : 338021 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_23 345242 : 347282 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_24 373314 : 380099 5 Hokovirus(25.0%) NA NA
DBSCAN-SWA_25 383873 : 394907 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_26 399802 : 415563 2 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_27 424689 : 454662 11 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_28 458259 : 460340 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_29 467954 : 516605 45 uncultured_Caudovirales_phage(14.29%) transposase,coat NA
DBSCAN-SWA_30 521005 : 521326 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_31 540814 : 545656 3 Invertebrate_iridescent_virus(50.0%) protease NA
DBSCAN-SWA_32 552589 : 553070 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_33 558844 : 559900 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_34 575166 : 576894 1 uncultured_Caudovirales_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP011151
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011151_1 1154042-1154157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011151_2 2667793-2667884 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011151_3 3782765-3785263 Orphan NA
55 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011151_4 5303040-5303173 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011151_5 5320171-5320274 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011151_2 2.1|2667828|22|NZ_CP011151|CRISPRCasFinder 2667828-2667849 22 MN096369 Gordonia phage Phendrix, complete genome 58314-58335 2 0.909
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 2 0.926
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 2 0.926
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 KY705251 Streptococcus phage P0091, complete genome 17101-17127 2 0.926
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 MH937499 Streptococcus phage CHPC1062, complete genome 17285-17311 2 0.926
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 MG708274 Streptococcus phage vB_SthS_VA214, complete genome 20002-20028 2 0.926
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 AP013411 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43 29813-29839 3 0.889
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 AP013669 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS *** 3666-3692 3 0.889
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MN693092 Marine virus AFVG_25M37, complete genome 19108-19134 3 0.889
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 MN694321 Marine virus AFVG_250M307, complete genome 14005-14031 3 0.889
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 MG708274 Streptococcus phage vB_SthS_VA214, complete genome 20002-20028 3 0.889
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 KY705251 Streptococcus phage P0091, complete genome 17101-17127 3 0.889
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 MH937499 Streptococcus phage CHPC1062, complete genome 17285-17311 3 0.889
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10529-10555 3 0.889
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 KY705251 Streptococcus phage P0091, complete genome 17101-17127 3 0.889
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 MH937499 Streptococcus phage CHPC1062, complete genome 17285-17311 3 0.889
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 MG708274 Streptococcus phage vB_SthS_VA214, complete genome 20002-20028 3 0.889
NZ_CP011151_3 3.21|3783647|27|NZ_CP011151|CRT 3783647-3783673 27 JQ691611 Cronobacter phage CR9, complete genome 9699-9725 3 0.889
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 MG708274 Streptococcus phage vB_SthS_VA214, complete genome 20002-20028 3 0.889
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 KY705251 Streptococcus phage P0091, complete genome 17101-17127 3 0.889
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 MH937499 Streptococcus phage CHPC1062, complete genome 17285-17311 3 0.889
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 MN694321 Marine virus AFVG_250M307, complete genome 14005-14031 3 0.889
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_011771 Bacillus cereus AH820 plasmid pAH820_10, complete sequence 10335-10361 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 176370-176396 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 15799-15825 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 172322-172348 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MN693405 Marine virus AFVG_25M416, complete genome 18961-18987 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 AP014301 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S28-C84, *** SEQUENCING IN PROGRESS *** 803-829 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 174974-175000 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 170998-171024 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 176996-177022 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 16960-16986 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 172948-172974 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MN693333 Marine virus AFVG_25M417, complete genome 18961-18987 4 0.852
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MK521907 Klebsiella phage vB_KpnS_FZ41, complete genome 71434-71460 4 0.852
NZ_CP011151_3 3.14|3783323|27|NZ_CP011151|CRT 3783323-3783349 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 MN693092 Marine virus AFVG_25M37, complete genome 19117-19143 4 0.852
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 MT354570 Pseudomonas phage phiB1_1, complete genome 30773-30799 4 0.852
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 MN830258 Lactobacillus phage JNU_P9, complete genome 19969-19995 4 0.852
NZ_CP011151_3 3.22|3783692|27|NZ_CP011151|CRT 3783692-3783718 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 709682-709708 4 0.852
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 MN830258 Lactobacillus phage JNU_P9, complete genome 19969-19995 4 0.852
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 MN693092 Marine virus AFVG_25M37, complete genome 19117-19143 4 0.852
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1872-1898 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1962-1988 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1881-1907 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1890-1916 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1899-1925 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1908-1934 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1917-1943 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1926-1952 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_011771 Bacillus cereus AH820 plasmid pAH820_10, complete sequence 10713-10739 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_011771 Bacillus cereus AH820 plasmid pAH820_10, complete sequence 10794-10820 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 14920-14946 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 13396-13422 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 13768-13794 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 15751-15777 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 14923-14949 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 13399-13425 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 15748-15774 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 14920-14946 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 13396-13422 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 9183-9209 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 9336-9362 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 21362-21388 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 21515-21541 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 103810-103836 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 103846-103872 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 103882-103908 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 103918-103944 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MN693099 Marine virus AFVG_25M184, complete genome 13927-13953 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MN693189 Marine virus AFVG_25M326, complete genome 18855-18881 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT197175 Klebsiella phage VLC5, complete genome 15241-15267 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MN013077 Klebsiella phage vB_KaeM_KaOmega, complete genome 8610-8636 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU886271 Freshwater phage uvFW-CGR-AMD-COM-C440, complete genome 37930-37956 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MH616795 Microviridae sp. isolate ctbh757, complete genome 1056-1082 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MH617049 Microviridae sp. isolate ctba755, complete genome 1044-1070 5 0.815
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 GU323708 Lactobacillus phage phiPYB5, complete genome 19357-19383 5 0.815
NZ_CP011151_3 3.14|3783323|27|NZ_CP011151|CRT 3783323-3783349 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 MN693189 Marine virus AFVG_25M326, complete genome 18900-18926 5 0.815
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2683-2709 5 0.815
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2737-2763 5 0.815
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2791-2817 5 0.815
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168895-168921 5 0.815
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168949-168975 5 0.815
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 22447-22473 5 0.815
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 AP014693 Ralstonia phage RSL2 DNA, complete sequence 152490-152516 5 0.815
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168895-168921 5 0.815
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168949-168975 5 0.815
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2683-2709 5 0.815
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2737-2763 5 0.815
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2791-2817 5 0.815
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 124940-124966 5 0.815
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 MH513984 Mycobacterium phage Steamy, complete genome 4659-4685 5 0.815
NZ_CP011151_3 3.21|3783647|27|NZ_CP011151|CRT 3783647-3783673 27 NC_003390 Synechococcus phage P60, complete genome 39237-39263 5 0.815
NZ_CP011151_3 3.23|3783737|27|NZ_CP011151|CRT 3783737-3783763 27 JQ691611 Cronobacter phage CR9, complete genome 9699-9725 5 0.815
NZ_CP011151_3 3.23|3783737|27|NZ_CP011151|CRT 3783737-3783763 27 MN694528 Marine virus AFVG_250M165, complete genome 1655-1681 5 0.815
NZ_CP011151_3 3.24|3783782|27|NZ_CP011151|CRT 3783782-3783808 27 MN693673 Marine virus AFVG_250M950, complete genome 35649-35675 5 0.815
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168895-168921 5 0.815
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168949-168975 5 0.815
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2683-2709 5 0.815
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2737-2763 5 0.815
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2791-2817 5 0.815
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 124940-124966 5 0.815
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 MN693189 Marine virus AFVG_25M326, complete genome 18900-18926 5 0.815
NZ_CP011151_3 3.51|3784994|27|NZ_CP011151|CRT 3784994-3785020 27 MN693092 Marine virus AFVG_25M37, complete genome 19117-19143 5 0.815
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NZ_CP011151_3 3.2|3782837|27|NZ_CP011151|CRT 3782837-3782863 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NZ_CP011151_3 3.4|3782918|27|NZ_CP011151|CRT 3782918-3782944 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NZ_CP011151_3 3.6|3782999|27|NZ_CP011151|CRT 3782999-3783025 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NZ_CP011151_3 3.8|3783080|27|NZ_CP011151|CRT 3783080-3783106 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NZ_CP011151_3 3.10|3783161|27|NZ_CP011151|CRT 3783161-3783187 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MN693092 Marine virus AFVG_25M37, complete genome 19063-19089 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 13312-13338 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 13939-13965 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 13315-13341 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 13942-13968 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 13312-13338 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 13939-13965 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KJ019159 Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome 14608-14634 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 KJ019090 Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome 14596-14622 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 NC_047917 Erwinia phage vB_EamP-S2, complete genome 29593-29619 6 0.778
NZ_CP011151_3 3.12|3783242|27|NZ_CP011151|CRT 3783242-3783268 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NZ_CP011151_3 3.14|3783323|27|NZ_CP011151|CRT 3783323-3783349 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NZ_CP011151_3 3.14|3783323|27|NZ_CP011151|CRT 3783323-3783349 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NZ_CP011151_3 3.14|3783323|27|NZ_CP011151|CRT 3783323-3783349 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 MN693189 Marine virus AFVG_25M326, complete genome 18918-18944 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 AP013564 Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5-MedDCM-OCT-S33-C6, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces 9195-9221 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 AP013944 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S41-C114, *** SEQUENCING IN PROGRESS *** 9025-9051 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 AP013943 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S40-C165, *** SEQUENCING IN PROGRESS *** 9797-9823 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 AP013945 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S43-C137, *** SEQUENCING IN PROGRESS *** 4494-4520 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 AP014476 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S42-C91, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 17307-17333 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 MN693405 Marine virus AFVG_25M416, complete genome 18979-19005 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 AP013942 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S39-C99, *** SEQUENCING IN PROGRESS *** 14907-14933 6 0.778
NZ_CP011151_3 3.15|3783368|27|NZ_CP011151|CRT 3783368-3783394 27 MN693333 Marine virus AFVG_25M417, complete genome 18979-19005 6 0.778
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2845-2871 6 0.778
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169111-169137 6 0.778
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169003-169029 6 0.778
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 MN693555 Marine virus AFVG_25M96, complete genome 16855-16881 6 0.778
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 NC_021795 Cellulophaga phage phi17:1, complete genome 26459-26485 6 0.778
NZ_CP011151_3 3.17|3783467|27|NZ_CP011151|CRT 3783467-3783493 27 AP014381 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S43-C84, *** SEQUENCING IN PROGRESS *** 10963-10989 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169111-169137 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169003-169029 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2845-2871 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 664305-664331 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 167924-167950 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1713018-1713044 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 334739-334765 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NC_024385 Leuconostoc phage phiLN12, complete genome 26909-26935 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 AP018399 Xanthomonas phage XacN1 DNA, complete genome 302138-302164 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 393461-393487 6 0.778
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2683-2709 6 0.778
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2737-2763 6 0.778
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2791-2817 6 0.778
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 NC_001446 Bacillus thuringiensis sv israelensis HI4 plasmid pTX14-3, complete sequence 3724-3750 6 0.778
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 NC_018511 Bacillus thuringiensis HD-789 plasmid pBTHD789-5, complete sequence 885-911 6 0.778
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168895-168921 6 0.778
NZ_CP011151_3 3.19|3783557|27|NZ_CP011151|CRT 3783557-3783583 27 NZ_CP009345 Bacillus thuringiensis HD1002 plasmid 6, complete sequence 1990-2016 6 0.778
NZ_CP011151_3 3.20|3783602|27|NZ_CP011151|CRT 3783602-3783628 27 NZ_CP016618 Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence 178569-178595 6 0.778
NZ_CP011151_3 3.22|3783692|27|NZ_CP011151|CRT 3783692-3783718 27 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 135653-135679 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169111-169137 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169003-169029 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2845-2871 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 664305-664331 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 167924-167950 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1713018-1713044 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 334739-334765 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NC_024385 Leuconostoc phage phiLN12, complete genome 26909-26935 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 AP018399 Xanthomonas phage XacN1 DNA, complete genome 302138-302164 6 0.778
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 393461-393487 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 MN693189 Marine virus AFVG_25M326, complete genome 18918-18944 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 AP013564 Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5-MedDCM-OCT-S33-C6, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces 9195-9221 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 AP013944 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S41-C114, *** SEQUENCING IN PROGRESS *** 9025-9051 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 AP013943 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S40-C165, *** SEQUENCING IN PROGRESS *** 9797-9823 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 AP013945 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S43-C137, *** SEQUENCING IN PROGRESS *** 4494-4520 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 AP014476 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S42-C91, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 17307-17333 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 MN693405 Marine virus AFVG_25M416, complete genome 18979-19005 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 AP013942 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S39-C99, *** SEQUENCING IN PROGRESS *** 14907-14933 6 0.778
NZ_CP011151_3 3.31|3784157|27|NZ_CP011151|CRT 3784157-3784183 27 MN693333 Marine virus AFVG_25M417, complete genome 18979-19005 6 0.778
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP037902 Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence 80561-80587 7 0.741
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP046332 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2 54271-54297 7 0.741
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP033968 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence 243808-243834 7 0.741
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NC_006466 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 134758-134784 7 0.741
NZ_CP011151_3 3.18|3783512|27|NZ_CP011151|CRT 3783512-3783538 27 NZ_CP043439 Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence 239863-239889 7 0.741
NZ_CP011151_3 3.22|3783692|27|NZ_CP011151|CRT 3783692-3783718 27 NZ_CP017564 Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence 32383-32409 7 0.741
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP037902 Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence 80561-80587 7 0.741
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP046332 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2 54271-54297 7 0.741
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP033968 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence 243808-243834 7 0.741
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NC_006466 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 134758-134784 7 0.741
NZ_CP011151_3 3.28|3784004|27|NZ_CP011151|CRT 3784004-3784030 27 NZ_CP043439 Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence 239863-239889 7 0.741
NZ_CP011151_3 3.33|3784238|36|NZ_CP011151|CRT 3784238-3784273 36 AP013669 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS *** 3666-3701 7 0.806
NZ_CP011151_3 3.33|3784238|36|NZ_CP011151|CRT 3784238-3784273 36 AP013411 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43 29804-29839 7 0.806
NZ_CP011151_3 3.51|3784994|27|NZ_CP011151|CRT 3784994-3785020 27 MN586053 Arthrobacter phage BeatusComedenti, complete genome 29812-29838 7 0.741
NZ_CP011151_3 3.51|3784994|27|NZ_CP011151|CRT 3784994-3785020 27 NC_031231 Arthrobacter phage KellEzio, complete genome 29814-29840 7 0.741
NZ_CP011151_4 4.1|5303063|31|NZ_CP011151|CRISPRCasFinder 5303063-5303093 31 JX238501 Bacillus phage phiAGATE, complete genome 124559-124589 8 0.742
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100650-100683 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812210 Flavobacterium phage vB_FspS_hemulen9-1, complete genome 22854-22887 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812215 Flavobacterium phage vB_FspS_lillamy9-4, complete genome 22191-22224 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812216 Flavobacterium phage vB_FspS_lillamy9-5, complete genome 22191-22224 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NC_048835 Flavobacterium phage vB_FspS_lillamy9-1, complete genome 22191-22224 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812213 Flavobacterium phage vB_FspS_lillamy9-2, complete genome 22191-22224 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812230 Flavobacterium phage vB_FspS_sniff9-2, complete genome 21831-21864 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812209 Flavobacterium phage vB_FspS_hemulen6-2, complete genome 22983-23016 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812218 Flavobacterium phage vB_FspS_lillamy9-7, complete genome 21454-21487 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812233 Flavobacterium phage vB_FspS_snork9-1, complete genome 22007-22040 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812219 Flavobacterium phage vB_FspS_morran9-1, complete genome 22308-22341 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812217 Flavobacterium phage vB_FspS_lillamy9-6, complete genome 21930-21963 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NC_048840 Flavobacterium phage vB_FspS_snork6-1, complete genome 22137-22170 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NC_048839 Flavobacterium phage vB_FspS_sniff9-1, complete genome 22057-22090 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NC_048842 Flavobacterium phage vB_FspS_stinky9-1, complete genome 21673-21706 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812232 Flavobacterium phage vB_FspS_snork6-2, complete genome 21655-21688 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 MN812208 Flavobacterium phage vB_FspS_hemulen6-1, complete genome 22983-23016 8 0.765
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47181-47214 11 0.676
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47565-47598 11 0.676
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47949-47982 11 0.676
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48333-48366 11 0.676
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48717-48750 11 0.676
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49101-49134 11 0.676
NZ_CP011151_4 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder 5303117-5303150 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49485-49518 11 0.676

1. spacer 2.1|2667828|22|NZ_CP011151|CRISPRCasFinder matches to MN096369 (Gordonia phage Phendrix, complete genome) position: , mismatch: 2, identity: 0.909

cccagttgctccagttattccg	CRISPR spacer
accagttgctccagtgattccg	Protospacer
 ************** ******

2. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 2, identity: 0.926

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
************************ *.

3. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 2, identity: 0.926

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
************************ *.

4. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 2, identity: 0.926

tggacctcaaggtgttcaagg-taacac	CRISPR spacer
tggacctcaaggtgttcaaggattaca-	Protospacer
********************* * *** 

5. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 2, identity: 0.926

tggacctcaaggtgttcaaggtaacac-	CRISPR spacer
tggacctcaaggtgttcaagg-accaca	Protospacer
********************* * *** 

6. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 2, identity: 0.926

tggacctcaaggtgttcaagg-taacac	CRISPR spacer
tggacctcaaggtgttcaaggattaca-	Protospacer
********************* * *** 

7. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to AP013411 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43) position: , mismatch: 3, identity: 0.889

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgcaactggacctca	Protospacer
***.*********** **********.

8. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to AP013669 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgcaactggacctca	Protospacer
***.*********** **********.

9. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 3, identity: 0.889

tggcgctactggtgctactggacctcg	CRISPR spacer
tggggcaactggtgctactggacctca	Protospacer
*** ** *******************.

10. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to MN694321 (Marine virus AFVG_250M307, complete genome) position: , mismatch: 3, identity: 0.889

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggagctactggaactcaaggtgctga	Protospacer
*** ********* *********** *

11. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcaaggcgttcaagg-taacac	CRISPR spacer
tggacctcaaggtgttcaaggattaca-	Protospacer
************.******** * *** 

12. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcaaggcgttcaagg-taacac	CRISPR spacer
tggacctcaaggtgttcaaggattaca-	Protospacer
************.******** * *** 

13. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcaaggcgttcaaggtaacac-	CRISPR spacer
tggacctcaaggtgttcaagg-accaca	Protospacer
************.******** * *** 

14. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcagggtgttcaaggtaacac-	CRISPR spacer
tggacctcagggtattcaaggt-ccaca	Protospacer
*************.********  *** 

15. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcagggtgttcaagg-taacac	CRISPR spacer
tggacctcaaggtgttcaaggattaca-	Protospacer
*********.*********** * *** 

16. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcagggtgttcaaggtaacac-	CRISPR spacer
tggacctcaaggtgttcaagg-accaca	Protospacer
*********.*********** * *** 

17. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcagggtgttcaagg-taacac	CRISPR spacer
tggacctcaaggtgttcaaggattaca-	Protospacer
*********.*********** * *** 

18. spacer 3.21|3783647|27|NZ_CP011151|CRT matches to JQ691611 (Cronobacter phage CR9, complete genome) position: , mismatch: 3, identity: 0.889

aggtgctcaaggtaacacaggtgctac	CRISPR spacer
tggtcctcaaggtaacacaggtcctac	Protospacer
 *** ***************** ****

19. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcaaggcgttcaagg-taacac	CRISPR spacer
tggacctcaaggtgttcaaggattaca-	Protospacer
************.******** * *** 

20. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcaaggcgttcaagg-taacac	CRISPR spacer
tggacctcaaggtgttcaaggattaca-	Protospacer
************.******** * *** 

21. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 3, identity: 0.889

tggacctcaaggcgttcaaggtaacac-	CRISPR spacer
tggacctcaaggtgttcaagg-accaca	Protospacer
************.******** * *** 

22. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to MN694321 (Marine virus AFVG_250M307, complete genome) position: , mismatch: 3, identity: 0.889

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggagctactggaactcaaggtgctga	Protospacer
*** ********* *********** *

23. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

24. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

25. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

26. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

27. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

28. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

29. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

30. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

31. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

32. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

33. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

34. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

35. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

36. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

37. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

38. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.********.***************  

39. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_011771 (Bacillus cereus AH820 plasmid pAH820_10, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggagctactggagctactggacctac	Protospacer
*** ******** ************  

40. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggtgatactggtcctgt	Protospacer
************** ****** ***  

41. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggctcaactggtgctactggacccca	Protospacer
**** * *****************.*.

42. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggctctactggtgctactggtcccag	Protospacer
**** **************** **. *

43. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MN693405 (Marine virus AFVG_25M416, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggagctac	Protospacer
***.****************** **  

44. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to AP014301 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S28-C84, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
cggagctactggtgctactggccctca	Protospacer
.** ***************** ****.

45. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggtgatactggtcctgt	Protospacer
************** ****** ***  

46. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggctctactggtgctactggtcccag	Protospacer
**** **************** **. *

47. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggtgatactggtcctgt	Protospacer
************** ****** ***  

48. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggctcaactggtgctactggacccca	Protospacer
**** * *****************.*.

49. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggctctactggtgctactggtcccag	Protospacer
**** **************** **. *

50. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MN693333 (Marine virus AFVG_25M417, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggagctac	Protospacer
***.****************** **  

51. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MK521907 (Klebsiella phage vB_KpnS_FZ41, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctactggtgctactggacctcg	CRISPR spacer
aggggctactggtgctactggtcctca	Protospacer
 ** ***************** ****.

52. spacer 3.14|3783323|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctca	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

53. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 4, identity: 0.852

cggcgctactggacctcaaggtgctca	CRISPR spacer
tggtgctactggacctcaaggtgctac	Protospacer
.**.*********************  

54. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to MT354570 (Pseudomonas phage phiB1_1, complete genome) position: , mismatch: 4, identity: 0.852

tggacctcaaggtgttcaaggtaacac-	CRISPR spacer
tggacctcaaggtgtacaagg-accgca	Protospacer
*************** ***** * *.* 

55. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to MN830258 (Lactobacillus phage JNU_P9, complete genome) position: , mismatch: 4, identity: 0.852

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
gggacctcaaggcgttcagggtacccc	Protospacer
 *****************.**** * *

56. spacer 3.22|3783692|27|NZ_CP011151|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.852

aggtgttcaaggcaacacaggcgctac	CRISPR spacer
aggtgttcaaggaaacccaggcgcatc	Protospacer
************ *** *******  *

57. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to MN830258 (Lactobacillus phage JNU_P9, complete genome) position: , mismatch: 4, identity: 0.852

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
gggacctcaaggcgttcagggtacccc	Protospacer
 *****************.**** * *

58. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 4, identity: 0.852

cggcgctactggacctcaaggtgctca	CRISPR spacer
tggtgctactggacctcaaggtgctac	Protospacer
.**.*********************  

59. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

60. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

61. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

62. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

63. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

64. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

65. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

66. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

67. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

68. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

69. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

70. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

71. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

72. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

73. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

74. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggagatac	Protospacer
************.*********  *  

75. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggagatac	Protospacer
************.*********  *  

76. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.*****.***************  

77. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggcgctac	Protospacer
************.********  **  

78. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggcgctac	Protospacer
************.********  **  

79. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggcgctac	Protospacer
************.********  **  

80. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggcgctac	Protospacer
************.********  **  

81. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggcgctac	Protospacer
************.********  **  

82. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggcgctac	Protospacer
************.********  **  

83. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_011771 (Bacillus cereus AH820 plasmid pAH820_10, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
aggagctactggagctactggacctac	Protospacer
 ** ******** ************  

84. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_011771 (Bacillus cereus AH820 plasmid pAH820_10, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
aggagctactggagctactggacctac	Protospacer
 ** ******** ************  

85. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggatttac	Protospacer
***.******************..*  

86. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggcgttca	Protospacer
***.*****************  .**.

87. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggagctactggtgctactggtgttct	Protospacer
*** *****************  .** 

88. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
gggagctactggtgctactggacccga	Protospacer
 ** ********************. .

89. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggatttac	Protospacer
***.******************..*  

90. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggcgttca	Protospacer
***.*****************  .**.

91. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
gggagctactggtgctactggacccga	Protospacer
 ** ********************. .

92. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggatttac	Protospacer
***.******************..*  

93. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggcgttca	Protospacer
***.*****************  .**.

94. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
aggagctactggagctactggacctac	Protospacer
 ** ******** ************  

95. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
aggagctactggagctactggacctac	Protospacer
 ** ******** ************  

96. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
aggagctactggagctactggacctac	Protospacer
 ** ******** ************  

97. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NZ_CP040338 (Bacillus luti strain FJ plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
aggagctactggagctactggacctac	Protospacer
 ** ******** ************  

98. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctacgggggctactggaccatc	Protospacer
********* ** *********** . 

99. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctacgggggctactggaccatc	Protospacer
********* ** *********** . 

100. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctacgggggctactggaccatc	Protospacer
********* ** *********** . 

101. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctacgggggctactggaccatc	Protospacer
********* ** *********** . 

102. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MN693099 (Marine virus AFVG_25M184, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactgggtctac	Protospacer
***.*****************..**  

103. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggagctactggtgctactggagcaac	Protospacer
*** ****************** *   

104. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT197175 (Klebsiella phage VLC5, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
gggcgctactggtgctacaggagctgc	Protospacer
 ***************** *** **  

105. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MN013077 (Klebsiella phage vB_KaeM_KaOmega, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
gggcgatactggtgctactggcccgca	Protospacer
 **** *************** ** *.

106. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU886271 (Freshwater phage uvFW-CGR-AMD-COM-C440, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctaatggacataa	Protospacer
***.************* ***** * .

107. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MH616795 (Microviridae sp. isolate ctbh757, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggcactac	Protospacer
***.*****************  **  

108. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MH617049 (Microviridae sp. isolate ctba755, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
tggcgctactggcgctactggtactac	Protospacer
************.********  **  

109. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to GU323708 (Lactobacillus phage phiPYB5, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggtgctactggacctcg	CRISPR spacer
agggcctactggtgctactggaccaca	Protospacer
 **  ******************* *.

110. spacer 3.14|3783323|27|NZ_CP011151|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctca	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

111. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 5, identity: 0.815

cggcgctactggacctcaaggtgctca	CRISPR spacer
aggacctactggacctcaaggtgctac	Protospacer
 **  ********************  

112. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

113. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggggttcaaggtattca	Protospacer
************ ********** .  

114. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

115. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

116. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggtgttcaaggtaacac----	CRISPR spacer
tggacctcaaggggttcaagg----acttca	Protospacer
************ ********    **    

117. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 5, identity: 0.815

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggtcctcaaggtatcca	Protospacer
************* .******** *  

118. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to AP014693 (Ralstonia phage RSL2 DNA, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
agggattcaaggtgtccaaggtaacac	Protospacer
 **. .*********.***********

119. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

120. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac----	CRISPR spacer
tggacctcaaggggttcaagg----acttca	Protospacer
************ ********    **    

121. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

122. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggggttcaaggtattca	Protospacer
************ ********** .  

123. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

124. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaatcga	Protospacer
***** *************** * *. 

125. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 5, identity: 0.815

tggacctcagggtgttcaaggtaacac	CRISPR spacer
cggacctcagggtgttcaaggcatcca	Protospacer
.********************.* *  

126. spacer 3.21|3783647|27|NZ_CP011151|CRT matches to NC_003390 (Synechococcus phage P60, complete genome) position: , mismatch: 5, identity: 0.815

aggtgctcaaggtaacacaggtgctac	CRISPR spacer
gggtcctcaaggtaacccaggtgctga	Protospacer
.*** *********** ********. 

127. spacer 3.23|3783737|27|NZ_CP011151|CRT matches to JQ691611 (Cronobacter phage CR9, complete genome) position: , mismatch: 5, identity: 0.815

aggcgttcaaggtaacacaggtgctac	CRISPR spacer
tggtcctcaaggtaacacaggtcctac	Protospacer
 **. .**************** ****

128. spacer 3.23|3783737|27|NZ_CP011151|CRT matches to MN694528 (Marine virus AFVG_250M165, complete genome) position: , mismatch: 5, identity: 0.815

aggcgttcaaggtaacacaggtgctac	CRISPR spacer
aggcgttcaaggtaatactggtgggag	Protospacer
***************.** ****  * 

129. spacer 3.24|3783782|27|NZ_CP011151|CRT matches to MN693673 (Marine virus AFVG_250M950, complete genome) position: , mismatch: 5, identity: 0.815

aggtgttcaaggtaacacaggtgctac	CRISPR spacer
aagtgttcaaggtaacagaggtgaggc	Protospacer
*.*************** *****  .*

130. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

131. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac----	CRISPR spacer
tggacctcaaggggttcaagg----acttca	Protospacer
************ ********    **    

132. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

133. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggggttcaaggtattca	Protospacer
************ ********** .  

134. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
************ ********** .  

135. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.815

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaatcga	Protospacer
***** *************** * *. 

136. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 5, identity: 0.815

cggcgctactggacctcaaggtgctca	CRISPR spacer
aggacctactggacctcaaggtgctac	Protospacer
 **  ********************  

137. spacer 3.51|3784994|27|NZ_CP011151|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcaaggtgctac	Protospacer
***.**************.****.*  

138. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

139. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

140. spacer 3.2|3782837|27|NZ_CP011151|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

141. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

142. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

143. spacer 3.4|3782918|27|NZ_CP011151|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

144. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

145. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

146. spacer 3.6|3782999|27|NZ_CP011151|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

147. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

148. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

149. spacer 3.8|3783080|27|NZ_CP011151|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

150. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

151. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

152. spacer 3.10|3783161|27|NZ_CP011151|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

153. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
cggtgctactggtgctactggatcaac	Protospacer
.**.******************.*   

154. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggtattgc	Protospacer
***.*****************  .*  

155. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggtattaa	Protospacer
***.*****************  .* .

156. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggtattgc	Protospacer
***.*****************  .*  

157. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggtattaa	Protospacer
***.*****************  .* .

158. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggtattgc	Protospacer
***.*****************  .*  

159. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggtattaa	Protospacer
***.*****************  .* .

160. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KJ019159 (Synechococcus phage ACG-2014f isolate Syn7803C34, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggtgttga	Protospacer
***.*****************  .* .

161. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to KJ019090 (Synechococcus phage ACG-2014f isolate Syn7803US24, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
tggtgctactggtgctactggtgttga	Protospacer
***.*****************  .* .

162. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** ****.**************   

163. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to NC_047917 (Erwinia phage vB_EamP-S2, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
gggcgctactggtgctgctggaggtgc	Protospacer
 ***************.*****  *  

164. spacer 3.12|3783242|27|NZ_CP011151|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctactggtgctactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** ****.**************   

165. spacer 3.14|3783323|27|NZ_CP011151|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctca	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

166. spacer 3.14|3783323|27|NZ_CP011151|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctca	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

167. spacer 3.14|3783323|27|NZ_CP011151|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctca	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

168. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
aggtgctactggacctcaaggtccagc	Protospacer
 **.****************** *   

169. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to AP013564 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5-MedDCM-OCT-S33-C6, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

170. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to AP013944 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S41-C114, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

171. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to AP013943 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S40-C165, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

172. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to AP013945 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S43-C137, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

173. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to AP014476 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S42-C91, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

174. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to MN693405 (Marine virus AFVG_25M416, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
tggagctactggccctcaaggtgcaac	Protospacer
.** ******** ***********   

175. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to AP013942 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S39-C99, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

176. spacer 3.15|3783368|27|NZ_CP011151|CRT matches to MN693333 (Marine virus AFVG_25M417, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
tggagctactggccctcaaggtgcaac	Protospacer
.** ******** ***********   

177. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggaccccaaggagttcaaggtattca	Protospacer
******.***** ********** .  

178. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
aggacctcaaggagttcaaggtattca	Protospacer
 *********** ********** .  

179. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggaccccaaggagttcaaggtattca	Protospacer
******.***** ********** .  

180. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to MN693555 (Marine virus AFVG_25M96, complete genome) position: , mismatch: 6, identity: 0.778

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
aggacctcaaggtattcaaggtattca	Protospacer
 ************.********* .  

181. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 6, identity: 0.778

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggtatacaaggtattca	Protospacer
*************.* ******* .  

182. spacer 3.17|3783467|27|NZ_CP011151|CRT matches to AP014381 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S43-C84, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

tggacctcaaggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggtgatgaaggtactca	Protospacer
************** * ****** .  

183. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
aggacctcaaggagttcaaggtattca	Protospacer
 *********** ********** .  

184. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggaccccaaggagttcaaggtattca	Protospacer
******.***** ********** .  

185. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggaccccaaggagttcaaggtattca	Protospacer
******.***** ********** .  

186. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaggcca	Protospacer
***** *************** ..*  

187. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaggcca	Protospacer
***** *************** ..*  

188. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggcgttcatggcaggcg	Protospacer
****************** **.*.   

189. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaggcca	Protospacer
***** *************** ..*  

190. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NC_024385 (Leuconostoc phage phiLN12, complete genome) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggaccacaaggcattcaaggtattca	Protospacer
****** ******.********* .  

191. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
aagacctcaaggcgttcaatggaacgg	Protospacer
 .***************** * ***. 

192. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaggcca	Protospacer
***** *************** ..*  

193. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcagggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
*********.** ********** .  

194. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcagggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggggttcaaggtattca	Protospacer
*********.** ********** .  

195. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcagggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
*********.** ********** .  

196. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to NC_001446 (Bacillus thuringiensis sv israelensis HI4 plasmid pTX14-3, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcagggtgttcaaggtaacac	CRISPR spacer
aggacctcagggtattcaaggtccacc	Protospacer
 ************.********    *

197. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to NC_018511 (Bacillus thuringiensis HD-789 plasmid pBTHD789-5, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcagggtgttcaaggtaacac	CRISPR spacer
aggacctcagggtattcaaggtccacc	Protospacer
 ************.********    *

198. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcagggtgttcaaggtaacac	CRISPR spacer
tggacctcaaggagttcaaggtattca	Protospacer
*********.** ********** .  

199. spacer 3.19|3783557|27|NZ_CP011151|CRT matches to NZ_CP009345 (Bacillus thuringiensis HD1002 plasmid 6, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcagggtgttcaaggtaacac	CRISPR spacer
aggacctcagggtattcaaggtccacc	Protospacer
 ************.********    *

200. spacer 3.20|3783602|27|NZ_CP011151|CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

aggcgttcaaggcaacacaggcgctac	CRISPR spacer
ttgcgttcaaggcaagacaggcggcag	Protospacer
  ************* ******* .* 

201. spacer 3.22|3783692|27|NZ_CP011151|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.778

aggtgttcaaggcaacacaggcgctac	CRISPR spacer
aggtgttcaagggaacataggcggcga	Protospacer
************ ****.***** .. 

202. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
aggacctcaaggagttcaaggtattca	Protospacer
 *********** ********** .  

203. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggaccccaaggagttcaaggtattca	Protospacer
******.***** ********** .  

204. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggaccccaaggagttcaaggtattca	Protospacer
******.***** ********** .  

205. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaggcca	Protospacer
***** *************** ..*  

206. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaggcca	Protospacer
***** *************** ..*  

207. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacctcaaggcgttcatggcaggcg	Protospacer
****************** **.*.   

208. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaggcca	Protospacer
***** *************** ..*  

209. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NC_024385 (Leuconostoc phage phiLN12, complete genome) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggaccacaaggcattcaaggtattca	Protospacer
****** ******.********* .  

210. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
aagacctcaaggcgttcaatggaacgg	Protospacer
 .***************** * ***. 

211. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.778

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
tggacatcaaggcgttcaaggaggcca	Protospacer
***** *************** ..*  

212. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
aggtgctactggacctcaaggtccagc	Protospacer
 **.****************** *   

213. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to AP013564 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5-MedDCM-OCT-S33-C6, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

214. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to AP013944 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S41-C114, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

215. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to AP013943 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S40-C165, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

216. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to AP013945 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S43-C137, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

217. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to AP014476 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S42-C91, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

218. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to MN693405 (Marine virus AFVG_25M416, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
tggagctactggccctcaaggtgcaac	Protospacer
.** ******** ***********   

219. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to AP013942 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S39-C99, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  *   

220. spacer 3.31|3784157|27|NZ_CP011151|CRT matches to MN693333 (Marine virus AFVG_25M417, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctactggacctcaaggtgctca	CRISPR spacer
tggagctactggccctcaaggtgcaac	Protospacer
.** ******** ***********   

221. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

222. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

223. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

224. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

225. spacer 3.18|3783512|27|NZ_CP011151|CRT matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

226. spacer 3.22|3783692|27|NZ_CP011151|CRT matches to NZ_CP017564 (Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence) position: , mismatch: 7, identity: 0.741

aggtgttcaaggcaacacaggcgctac	CRISPR spacer
tcgtgttaaaggcaacacaggcgtgca	Protospacer
  ***** ***************.   

227. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

228. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

229. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

230. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

231. spacer 3.28|3784004|27|NZ_CP011151|CRT matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.741

tggacctcaaggcgttcaaggtaacac	CRISPR spacer
acctcttcaaggcgttcaaggtaaccg	Protospacer
    *.*******************  

232. spacer 3.33|3784238|36|NZ_CP011151|CRT matches to AP013669 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.806

tggtgctaccggtgccactggacctcaaggcgttca	CRISPR spacer
tggtgctactggtgcaactggacctcaaggttctac	Protospacer
*********.***** **************. .*  

233. spacer 3.33|3784238|36|NZ_CP011151|CRT matches to AP013411 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43) position: , mismatch: 7, identity: 0.806

tggtgctaccggtgccactggacctcaaggcgttca	CRISPR spacer
tggtgctactggtgcaactggacctcaaggttctac	Protospacer
*********.***** **************. .*  

234. spacer 3.51|3784994|27|NZ_CP011151|CRT matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 7, identity: 0.741

tggcgctactggacctcagggtgttca	CRISPR spacer
cggcgccactggacctcagggtccggg	Protospacer
.*****.*************** .  .

235. spacer 3.51|3784994|27|NZ_CP011151|CRT matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 7, identity: 0.741

tggcgctactggacctcagggtgttca	CRISPR spacer
cggcgccactggacctcagggtccggg	Protospacer
.*****.*************** .  .

236. spacer 4.1|5303063|31|NZ_CP011151|CRISPRCasFinder matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.742

ttcttcttttttgtcactagttgaaccgctt	CRISPR spacer
ctaaccttttttgccactagttaaaccgccc	Protospacer
.*  .********.********.******..

237. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tttatcttcttttttattttctggtttattttcc	Protospacer
.**.****** ****************  * ..*

238. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812210 (Flavobacterium phage vB_FspS_hemulen9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

239. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812215 (Flavobacterium phage vB_FspS_lillamy9-4, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

240. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812216 (Flavobacterium phage vB_FspS_lillamy9-5, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

241. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NC_048835 (Flavobacterium phage vB_FspS_lillamy9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

242. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812213 (Flavobacterium phage vB_FspS_lillamy9-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

243. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812230 (Flavobacterium phage vB_FspS_sniff9-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

244. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812209 (Flavobacterium phage vB_FspS_hemulen6-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

245. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812218 (Flavobacterium phage vB_FspS_lillamy9-7, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

246. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812233 (Flavobacterium phage vB_FspS_snork9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

247. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812219 (Flavobacterium phage vB_FspS_morran9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

248. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812217 (Flavobacterium phage vB_FspS_lillamy9-6, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

249. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NC_048840 (Flavobacterium phage vB_FspS_snork6-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

250. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NC_048839 (Flavobacterium phage vB_FspS_sniff9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

251. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NC_048842 (Flavobacterium phage vB_FspS_stinky9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

252. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812232 (Flavobacterium phage vB_FspS_snork6-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

253. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to MN812208 (Flavobacterium phage vB_FspS_hemulen6-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

254. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

255. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

256. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

257. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

258. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

259. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

260. spacer 4.2|5303117|34|NZ_CP011151|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 257117 : 267273 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 322655 : 331031 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 716176 : 724337 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_4 1920453 : 1929740 9 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_5 2319888 : 2384160 70 Bacillus_phage(48.72%) portal,tail,transposase,protease,terminase,integrase,head,capsid attL 2346748:2346764|attR 2387100:2387116
DBSCAN-SWA_6 2630048 : 2694518 76 Bacillus_phage(62.86%) portal,integrase,tail,protease,terminase,bacteriocin,tRNA,capsid attL 2630456:2630472|attR 2693183:2693199
DBSCAN-SWA_7 3702788 : 3708655 6 Staphylococcus_phage(83.33%) NA NA
DBSCAN-SWA_8 3764917 : 3774131 13 Bacillus_phage(40.0%) bacteriocin NA
DBSCAN-SWA_9 3894178 : 3904017 13 Bacillus_phage(90.0%) NA NA
DBSCAN-SWA_10 4589262 : 4596950 9 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_11 4984807 : 5028744 55 Bacillus_virus(28.57%) coat,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage