Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014774 Aeromonas veronii strain AVNIH1 chromosome, complete genome 9 crisprs WYL,DinG,DEDDh,cas3,csa3,c2c9_V-U4 1 0 333 2
NZ_CP014775 Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence 0 crisprs DEDDh 0 0 2 0

Results visualization

1. NZ_CP014774
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_1 412609-412715 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_2 947263-947401 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_3 1704936-1705128 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_4 2809051-2809131 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_5 3127760-3127850 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_6 3129568-3129650 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_7 3523283-3523388 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_8 3654234-3654369 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014774_9 3976335-3976447 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP014774_6 6.1|3129593|33|NZ_CP014774|CRISPRCasFinder 3129593-3129625 33 NZ_CP014774.1 1705129-1705161 0 1.0

1. spacer 6.1|3129593|33|NZ_CP014774|CRISPRCasFinder matches to position: 1705129-1705161, mismatch: 0, identity: 1.0

aggtgtccagattccccaatttgggatttttgg	CRISPR spacer
aggtgtccagattccccaatttgggatttttgg	Protospacer
*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4635 5 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_2 9330 : 15853 4 Staphylococcus_prophage(33.33%) transposase NA
DBSCAN-SWA_3 23452 : 24013 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_4 31155 : 32073 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_5 40177 : 46365 5 Ralstonia_phage(25.0%) integrase attL 31832:31845|attR 52893:52906
DBSCAN-SWA_6 57660 : 58674 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_7 65902 : 71908 6 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_8 87073 : 88507 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_9 91737 : 107946 11 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_10 134695 : 140077 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_11 151097 : 154815 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_12 188193 : 189240 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_13 196706 : 197495 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_14 204738 : 206622 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_15 218432 : 220301 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_16 233081 : 234602 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_17 243059 : 244253 1 Escherichia_phage(100.0%) integrase attL 237912:237926|attR 251044:251058
DBSCAN-SWA_18 256562 : 258874 2 Acidithiobacillus_phage(100.0%) transposase NA
DBSCAN-SWA_19 270962 : 271763 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_20 279642 : 288001 4 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_21 308770 : 314496 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_22 318771 : 320142 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_23 327175 : 335921 9 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_24 353368 : 354498 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_25 357687 : 358329 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_26 389453 : 393866 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_27 404667 : 406683 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_28 412683 : 421819 9 uncultured_virus(33.33%) tRNA NA
DBSCAN-SWA_29 427567 : 461780 27 Enterobacteria_phage(15.38%) tRNA NA
DBSCAN-SWA_30 473364 : 474654 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_31 479442 : 480873 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_32 494422 : 500523 5 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_33 506249 : 513322 6 Bodo_saltans_virus(40.0%) NA NA
DBSCAN-SWA_34 522240 : 526832 3 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_35 542119 : 542890 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_36 556039 : 558898 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_37 619776 : 622203 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_38 630491 : 635398 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_39 639135 : 640635 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_40 653278 : 654946 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_41 686734 : 687829 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_42 699373 : 700201 2 Aeromonas_virus(100.0%) capsid NA
DBSCAN-SWA_43 705868 : 714744 6 Tupanvirus(20.0%) protease NA
DBSCAN-SWA_44 719029 : 719728 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_45 725336 : 726371 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_46 730525 : 737899 5 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_47 745950 : 750080 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_48 758185 : 767575 7 Turkeypox_virus(20.0%) NA NA
DBSCAN-SWA_49 785202 : 821047 30 uncultured_Mediterranean_phage(20.0%) protease,transposase,tRNA NA
DBSCAN-SWA_50 827121 : 899026 51 Escherichia_phage(17.65%) transposase,integrase attL 818378:818437|attR 906224:907508
DBSCAN-SWA_51 908694 : 924857 11 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_52 940661 : 944836 4 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_53 983995 : 988630 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_54 994394 : 995930 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_55 1002823 : 1004488 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_56 1011795 : 1013559 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 1021716 : 1025457 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_58 1035103 : 1035907 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_59 1061756 : 1063849 2 Aeropyrum_pernix_spindle-shaped_virus(50.0%) NA NA
DBSCAN-SWA_60 1075500 : 1076541 1 Mannheimia_phage(100.0%) transposase NA
DBSCAN-SWA_61 1079573 : 1083526 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_62 1093721 : 1097959 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_63 1105470 : 1106289 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_64 1118376 : 1120049 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_65 1135676 : 1136750 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_66 1144376 : 1145288 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_67 1152631 : 1156747 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_68 1161637 : 1170361 6 Lactococcus_phage(33.33%) NA NA
DBSCAN-SWA_69 1175225 : 1184127 5 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_70 1194569 : 1196825 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_71 1202632 : 1203283 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_72 1207738 : 1212673 7 Mycobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_73 1215813 : 1217292 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_74 1224247 : 1225918 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_75 1229898 : 1233603 3 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_76 1243633 : 1247379 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_77 1252462 : 1256680 4 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_78 1271464 : 1276664 6 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_79 1298803 : 1304310 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_80 1313524 : 1314253 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_81 1321087 : 1324260 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_82 1330845 : 1407979 61 Escherichia_phage(23.53%) transposase,tRNA NA
DBSCAN-SWA_83 1416677 : 1417103 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_84 1424727 : 1428220 2 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_85 1433042 : 1433717 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_86 1440456 : 1441737 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_87 1447379 : 1448669 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_88 1455112 : 1457997 2 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_89 1470995 : 1478389 6 Cafeteria_roenbergensis_virus(25.0%) NA NA
DBSCAN-SWA_90 1483556 : 1488939 4 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_91 1506154 : 1506811 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_92 1512439 : 1524281 6 uncultured_virus(25.0%) NA NA
DBSCAN-SWA_93 1537821 : 1539219 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_94 1542249 : 1545073 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_95 1552873 : 1554867 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_96 1572134 : 1578370 4 Vibrio_phage(66.67%) NA NA
DBSCAN-SWA_97 1589122 : 1590142 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_98 1600560 : 1605125 3 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_99 1627730 : 1629056 1 Arthrobacter_phage(100.0%) NA NA
DBSCAN-SWA_100 1644966 : 1646714 2 Staphylococcus_phage(50.0%) protease NA
DBSCAN-SWA_101 1661515 : 1667541 4 Cyanophage(50.0%) NA NA
DBSCAN-SWA_102 1678393 : 1679170 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_103 1698956 : 1710618 13 uncultured_virus(20.0%) transposase NA
DBSCAN-SWA_104 1715976 : 1723457 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_105 1728636 : 1730778 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_106 1737212 : 1737800 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_107 1753877 : 1756183 2 Kaumoebavirus(50.0%) NA NA
DBSCAN-SWA_108 1765297 : 1767332 2 Stenotrophomonas_phage(50.0%) NA NA
DBSCAN-SWA_109 1779803 : 1788287 4 Sulfolobus_virus(33.33%) NA NA
DBSCAN-SWA_110 1791355 : 1804532 11 Morganella_phage(16.67%) integrase attL 1781953:1781966|attR 1798974:1798987
DBSCAN-SWA_111 1814578 : 1816979 2 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_112 1820322 : 1821915 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_113 1835486 : 1838180 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_114 1843176 : 1846028 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_115 1864832 : 1881228 16 Staphylococcus_phage(37.5%) NA NA
DBSCAN-SWA_116 1886357 : 1891254 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_117 1904615 : 1906460 1 Salinibacter_virus(100.0%) NA NA
DBSCAN-SWA_118 1914346 : 1916947 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_119 1921863 : 1941591 18 Anomala_cuprea_entomopoxvirus(10.0%) tRNA NA
DBSCAN-SWA_120 1944613 : 1947005 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_121 1960672 : 1961494 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_122 1968374 : 1969346 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_123 1974457 : 1978250 3 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_124 1983368 : 1998449 10 Hokovirus(50.0%) NA NA
DBSCAN-SWA_125 2013667 : 2019100 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_126 2032493 : 2034212 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_127 2046572 : 2051782 4 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_128 2060934 : 2062906 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_129 2068589 : 2087167 19 Moraxella_phage(25.0%) integrase,tRNA attL 2061025:2061040|attR 2081404:2081419
DBSCAN-SWA_130 2097119 : 2098709 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_131 2103540 : 2109032 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_132 2122454 : 2122727 1 Serratia_phage(100.0%) NA NA
DBSCAN-SWA_133 2132777 : 2135587 3 Geobacillus_virus(50.0%) NA NA
DBSCAN-SWA_134 2140502 : 2142125 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_135 2151800 : 2155636 2 Megavirus(50.0%) tRNA NA
DBSCAN-SWA_136 2159532 : 2164912 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_137 2179322 : 2182869 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_138 2186871 : 2187363 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_139 2198261 : 2199395 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_140 2204805 : 2212291 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_141 2237919 : 2238987 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_142 2255020 : 2256286 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_143 2260554 : 2261772 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_144 2266429 : 2266780 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_145 2280106 : 2282974 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_146 2296097 : 2305597 7 Klosneuvirus(40.0%) tRNA NA
DBSCAN-SWA_147 2325033 : 2339172 12 Bacillus_phage(14.29%) NA NA
DBSCAN-SWA_148 2351399 : 2357096 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_149 2365553 : 2366444 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_150 2375050 : 2379896 3 Staphylococcus_prophage(50.0%) transposase NA
DBSCAN-SWA_151 2385491 : 2390351 4 Salicola_phage(33.33%) NA NA
DBSCAN-SWA_152 2418631 : 2419750 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_153 2427820 : 2443233 11 Tupanvirus(20.0%) NA NA
DBSCAN-SWA_154 2447023 : 2449776 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_155 2455989 : 2457963 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_156 2461982 : 2464463 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_157 2477497 : 2481363 2 Heterosigma_akashiwo_virus(50.0%) NA NA
DBSCAN-SWA_158 2496154 : 2502464 7 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_159 2509612 : 2510260 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_160 2516328 : 2517276 1 Staphylococcus_prophage(100.0%) transposase NA
DBSCAN-SWA_161 2520880 : 2521384 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_162 2524854 : 2526324 2 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_163 2535265 : 2540383 4 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_164 2548136 : 2548679 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_165 2560856 : 2562503 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_166 2574851 : 2577281 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_167 2581339 : 2582467 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_168 2595633 : 2599995 2 Herpes_simplex_virus(50.0%) NA NA
DBSCAN-SWA_169 2606702 : 2609468 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_170 2614133 : 2616181 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_171 2619633 : 2620257 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_172 2627267 : 2628290 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_173 2633275 : 2641417 11 Phage_NCTB(20.0%) NA NA
DBSCAN-SWA_174 2659849 : 2660467 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_175 2671577 : 2671823 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_176 2681084 : 2683349 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_177 2687531 : 2688536 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_178 2692349 : 2693835 2 Pithovirus(50.0%) NA NA
DBSCAN-SWA_179 2704387 : 2713592 7 Dinoroseobacter_phage(25.0%) NA NA
DBSCAN-SWA_180 2723621 : 2727074 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_181 2740651 : 2743320 2 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_182 2752847 : 2754065 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_183 2763119 : 2764487 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_184 2771682 : 2773391 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_185 2781177 : 2781942 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_186 2788023 : 2789737 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_187 2792942 : 2801927 9 Rhizobium_phage(20.0%) NA NA
DBSCAN-SWA_188 2809803 : 2815436 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_189 2825790 : 2830456 5 Brazilian_cedratvirus(33.33%) tRNA NA
DBSCAN-SWA_190 2847847 : 2852749 5 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_191 2860130 : 2874067 12 Pandoravirus(12.5%) tRNA NA
DBSCAN-SWA_192 2881777 : 2881975 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_193 2885036 : 2890365 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_194 2905330 : 2915245 9 Staphylococcus_phage(25.0%) protease,tRNA NA
DBSCAN-SWA_195 2920185 : 2931307 7 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_196 2939333 : 2940323 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_197 2948605 : 2949760 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_198 2954084 : 2961710 7 Catovirus(25.0%) NA NA
DBSCAN-SWA_199 2998808 : 3000838 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_200 3024628 : 3028275 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_201 3035787 : 3041462 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_202 3045098 : 3046097 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_203 3053484 : 3054492 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_204 3059296 : 3060565 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_205 3068286 : 3069552 1 Serratia_phage(100.0%) tRNA NA
DBSCAN-SWA_206 3073528 : 3074977 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_207 3078606 : 3083662 3 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_208 3086992 : 3089278 2 Enterobacterial_phage(50.0%) integrase,transposase attL 3080615:3080629|attR 3090457:3090471
DBSCAN-SWA_209 3113355 : 3114279 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_210 3123859 : 3133187 12 Vibrio_phage(20.0%) transposase NA
DBSCAN-SWA_211 3141113 : 3148645 10 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_212 3156819 : 3159415 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_213 3165765 : 3166191 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_214 3169716 : 3170550 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_215 3188453 : 3189359 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_216 3202094 : 3202670 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_217 3208592 : 3215601 4 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_218 3234081 : 3332388 82 Bacillus_phage(15.0%) transposase,integrase attL 3297022:3297037|attR 3313876:3313891
DBSCAN-SWA_219 3374053 : 3380362 6 Bacillus_thuringiensis_phage(100.0%) tRNA NA
DBSCAN-SWA_220 3383468 : 3386234 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_221 3397886 : 3401580 3 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_222 3411098 : 3416036 4 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_223 3421975 : 3427381 3 Bacillus_virus(66.67%) transposase NA
DBSCAN-SWA_224 3438602 : 3438887 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_225 3447797 : 3448142 1 Leucania_separata_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_226 3453134 : 3453911 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_227 3458170 : 3459508 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_228 3462519 : 3465475 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_229 3471464 : 3478144 6 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_230 3484600 : 3486160 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_231 3492839 : 3496961 3 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_232 3502953 : 3514380 9 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_233 3548505 : 3550611 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_234 3554764 : 3556192 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_235 3564424 : 3569739 5 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_236 3572885 : 3573416 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_237 3579996 : 3582444 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_238 3585749 : 3587737 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_239 3595780 : 3596698 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_240 3601236 : 3602250 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_241 3605382 : 3611690 5 Clostridium_phage(20.0%) NA NA
DBSCAN-SWA_242 3615148 : 3621149 5 Only_Syngen_Nebraska_virus(33.33%) transposase NA
DBSCAN-SWA_243 3627112 : 3629023 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_244 3647307 : 3651381 5 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_245 3655423 : 3656521 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_246 3662597 : 3665448 2 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_247 3679207 : 3679714 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_248 3683533 : 3684181 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_249 3691730 : 3692981 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_250 3715754 : 3722027 7 Sinorhizobium_phage(33.33%) NA NA
DBSCAN-SWA_251 3765025 : 3766230 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_252 3770837 : 3771062 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_253 3777762 : 3780430 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_254 3783532 : 3784345 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_255 3799439 : 3806512 3 Sucra_jujuba_nucleopolyhedrovirus(33.33%) NA NA
DBSCAN-SWA_256 3815767 : 3821394 4 Mimivirus(33.33%) NA NA
DBSCAN-SWA_257 3835601 : 3836093 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_258 3840656 : 3845434 3 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_259 3854209 : 3855406 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_260 3863857 : 3866434 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_261 3870867 : 3876455 4 Brevibacillus_phage(50.0%) NA NA
DBSCAN-SWA_262 3879663 : 3880713 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_263 3889147 : 3896458 7 Catovirus(33.33%) protease NA
DBSCAN-SWA_264 3899459 : 3900926 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_265 3914131 : 3916009 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_266 3921734 : 3922556 1 Arthrobacter_phage(100.0%) NA NA
DBSCAN-SWA_267 3926487 : 3928125 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_268 3934774 : 3937003 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_269 3940450 : 3946320 7 Vibrio_phage(33.33%) tRNA NA
DBSCAN-SWA_270 3950525 : 3951128 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_271 3960745 : 3961462 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_272 3968944 : 3969892 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_273 3973029 : 3980909 9 Pseudomonas_phage(20.0%) transposase NA
DBSCAN-SWA_274 3985857 : 3987114 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_275 3994339 : 4008503 13 Bodo_saltans_virus(16.67%) protease,tRNA NA
DBSCAN-SWA_276 4013278 : 4015302 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_277 4019432 : 4022870 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_278 4027645 : 4028941 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_279 4034707 : 4035403 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_280 4042867 : 4043884 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_281 4052210 : 4052870 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_282 4061862 : 4063389 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_283 4092780 : 4093164 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_284 4098945 : 4102416 5 Natrialba_phage(50.0%) NA NA
DBSCAN-SWA_285 4110087 : 4132086 16 Staphylococcus_prophage(33.33%) transposase NA
DBSCAN-SWA_286 4138440 : 4139811 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_287 4151223 : 4152240 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_288 4157766 : 4160829 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_289 4171428 : 4176981 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_290 4182173 : 4185307 4 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_291 4203258 : 4204359 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_292 4207579 : 4210303 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_293 4223440 : 4228505 4 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_294 4233724 : 4235350 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_295 4240128 : 4242131 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_296 4246488 : 4251471 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_297 4258325 : 4262201 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_298 4265462 : 4269912 5 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_299 4274112 : 4279070 4 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_300 4289323 : 4294841 3 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_301 4301164 : 4303303 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_302 4307238 : 4309062 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_303 4321569 : 4324898 3 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_304 4328753 : 4330394 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_305 4333618 : 4334872 1 Phage_21(100.0%) NA NA
DBSCAN-SWA_306 4344299 : 4347361 3 Escherichia_coli_phage(50.0%) tRNA NA
DBSCAN-SWA_307 4356777 : 4360001 3 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_308 4365758 : 4369573 4 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_309 4376130 : 4377267 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_310 4383384 : 4387369 3 Klebsiella_phage(50.0%) NA NA
DBSCAN-SWA_311 4394825 : 4397785 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_312 4401614 : 4408605 6 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_313 4411830 : 4415630 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_314 4427173 : 4508645 92 Aeromonas_phage(78.69%) transposase,tRNA,holin NA
DBSCAN-SWA_315 4515190 : 4520540 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_316 4525515 : 4528803 1 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_317 4543711 : 4551100 3 Acidithiobacillus_phage(66.67%) transposase NA
DBSCAN-SWA_318 4557597 : 4562391 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_319 4566069 : 4567119 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_320 4571408 : 4574402 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_321 4583123 : 4583894 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_322 4605509 : 4606886 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_323 4626078 : 4627374 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_324 4635520 : 4637665 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_325 4654072 : 4655653 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_326 4658833 : 4666620 8 uncultured_Mediterranean_phage(75.0%) tRNA NA
DBSCAN-SWA_327 4670527 : 4677557 8 Mycoplasma_phage(33.33%) NA NA
DBSCAN-SWA_328 4687255 : 4692813 2 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_329 4723167 : 4727112 4 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_330 4730447 : 4733891 5 Brazilian_cedratvirus(33.33%) NA NA
DBSCAN-SWA_331 4739221 : 4741174 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_332 4748625 : 4752302 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_333 4755851 : 4756559 1 uncultured_Caudovirales_phage(100.0%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP014774.1|WP_043163073.1|1697701_1698256_+|hypothetical-protein 1697701_1698256_+ 184 aa aa NA NA NA No NA
NZ_CP014774.1|WP_148660623.1|1705800_1705983_+|hypothetical-protein 1705800_1705983_+ 60 aa aa NA NA NA 1698956-1710618 yes
2. NZ_CP014775
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20754 : 44055 26 Escherichia_phage(25.0%) integrase,transposase attL 20477:20536|attR 44274:45639
DBSCAN-SWA_2 100682 : 146168 45 Escherichia_phage(47.62%) integrase,transposase attL 131753:131812|attR 137697:138520
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage