Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015236 Rhodococcus fascians D188 plasmid pFiD188, complete sequence 0 crisprs DinG,csf4gr11,csf2gr7,csf3gr5 0 0 0 0
NZ_CP015237 Rhodococcus fascians D188 plasmid unnamed2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP015235 Rhodococcus fascians D188 chromosome, complete genome 2 crisprs csa3,cas3,WYL,RT,DEDDh,DinG,cas4 0 1 1 0

Results visualization

1. NZ_CP015235
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015235_1 2740979-2741106 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015235_2 3229010-3229117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015235_1 1.2|2741056|25|NZ_CP015235|CRISPRCasFinder 2741056-2741080 25 JF937105 Mycobacterium phage Rey, complete genome 53074-53098 4 0.84

1. spacer 1.2|2741056|25|NZ_CP015235|CRISPRCasFinder matches to JF937105 (Mycobacterium phage Rey, complete genome) position: , mismatch: 4, identity: 0.84

cgtcgatgtgagctgatcccgtgac	CRISPR spacer
cgtcgaagtgagccgatcccgtgga	Protospacer
****** ******.*********. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4662227 : 4670856 7 Indivirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage