Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014659 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DEDDh,DinG 0 8 16 0
NZ_CP014660 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 plasmid pSAN1-06-0624, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP014659
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014659_1 972631-973940 TypeI-E I-E
21 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014659_2 990254-990404 TypeI-E I-E
2 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 27359-27390 0 1.0
NZ_CP014659_2 2.2|990344|32|NZ_CP014659|CRISPRCasFinder 990344-990375 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 35345-35376 0 1.0
NZ_CP014659_2 2.2|990344|32|NZ_CP014659|CRISPRCasFinder 990344-990375 32 NZ_CP029990 Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence 95164-95195 1 0.969
NZ_CP014659_2 2.2|990344|32|NZ_CP014659|CRISPRCasFinder 990344-990375 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 9403-9434 1 0.969
NZ_CP014659_2 2.2|990344|32|NZ_CP014659|CRISPRCasFinder 990344-990375 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 39737-39768 1 0.969
NZ_CP014659_2 2.2|990344|32|NZ_CP014659|CRISPRCasFinder 990344-990375 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 113376-113407 1 0.969
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 CP054337 Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence 47898-47929 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 30480-30511 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 8985-9016 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 71040-71071 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP023732 Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence 48005-48036 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 116267-116298 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 27391-27422 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 71244-71275 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP041922 Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence 64019-64050 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 33729-33760 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 64871-64902 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 54320-54351 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NC_050152 Enterobacteria phage P7, complete genome 86888-86919 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NC_042128 Escherichia phage RCS47, complete genome 91937-91968 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NC_031129 Salmonella phage SJ46, complete genome 84791-84822 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 5645-5676 3 0.906
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP042632 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence 40633-40664 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP042620 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-5, complete sequence 54231-54262 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_AP018804 Escherichia coli strain E2863 plasmid pE2863-2, complete sequence 19433-19464 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 110385-110416 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP021537 Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence 23452-23483 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP027309 Escherichia coli strain 2015C-3108 plasmid unnamed2, complete sequence 32859-32890 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 CP050999 Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_2 40868-40899 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP047663 Escherichia coli strain LD93-1 plasmid pLD93-1-90kb, complete sequence 62453-62484 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP029365 Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence 65901-65932 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 NZ_CP020051 Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence 61123-61154 4 0.875
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 KY271396 Klebsiella phage 2 LV-2017, complete genome 41444-41475 4 0.875
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NC_018023 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence 93299-93330 6 0.812
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 708331-708362 6 0.812
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 231594-231625 6 0.812
NZ_CP014659_1 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973209-973240 32 NZ_CP034838 Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence 103026-103057 6 0.812
NZ_CP014659_1 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973209-973240 32 NZ_CP034839 Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence 103026-103057 6 0.812
NZ_CP014659_1 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973392-973423 32 NZ_CP018865 Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence 205587-205618 6 0.812
NZ_CP014659_1 1.16|973575|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973575-973606 32 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1236642-1236673 6 0.812
NZ_CP014659_1 1.16|973575|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973575-973606 32 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1370300-1370331 6 0.812
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 307066-307097 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 MH179480 Pseudomonas phage 98PfluR60PP, complete genome 28143-28174 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 609446-609477 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 718070-718101 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 386281-386312 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1547494-1547525 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 501784-501815 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 220607-220638 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 217160-217191 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 4180-4211 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1834887-1834918 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 639726-639757 7 0.781
NZ_CP014659_1 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973209-973240 32 NZ_CP053542 Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence 229056-229087 7 0.781
NZ_CP014659_1 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973209-973240 32 NZ_CP009356 Vibrio tubiashii ATCC 19109 plasmid p251, complete sequence 46871-46902 7 0.781
NZ_CP014659_1 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973331-973362 32 MK575466 Vibrio phage Rostov 7, complete genome 14119-14150 7 0.781
NZ_CP014659_2 2.2|990344|32|NZ_CP014659|CRISPRCasFinder 990344-990375 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 270963-270994 7 0.781
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP009453 Sphingopyxis sp. 113P3 plasmid unnamed, complete sequence 71746-71777 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NC_048697 Pseudomonas phage Littlefix, complete genome 2843-2874 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 106134-106165 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 58548-58579 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1719417-1719448 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 487914-487945 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 49061-49092 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1699393-1699424 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1516547-1516578 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 108042-108073 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 88358-88389 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 343357-343388 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 360629-360660 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2707713-2707744 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NC_014035 Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence 128795-128826 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 MK765650 Tortoise microvirus 97 isolate 97_SP_4, complete genome 2912-2943 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 MK765551 Tortoise microvirus 1 isolate 1_SP_22, complete genome 2912-2943 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 AJ298552 Bacteriophage HK113 O gene, N gene, M gene, L gene and X gene (partial) 2568-2599 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 AJ298561 Bacteriophage PhiD218 O gene, N gene, M gene, L gene and X gene (partial) 2568-2599 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 KU886270 Freshwater phage uvFW-CGR-AMD-COM-C429, complete genome 28970-29001 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 AJ298560 Bacteriophage PhiD160 O gene, N gene, M gene, L gene and X gene (partial) 2568-2599 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 AJ298551 Bacteriophage HK111 O gene, N gene, M gene, L gene and X gene (partial) 2568-2599 8 0.75
NZ_CP014659_1 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973392-973423 32 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 176307-176338 8 0.75
NZ_CP014659_1 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973392-973423 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 332281-332312 8 0.75
NZ_CP014659_1 1.19|973758|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973758-973789 32 NZ_CP025224 Enterococcus sp. CR-Ec1 plasmid pCREc1, complete sequence 62016-62047 8 0.75
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1655546-1655577 8 0.75
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1565948-1565979 8 0.75
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1565949-1565980 8 0.75
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 476607-476638 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 98951-98982 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 169759-169790 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 163646-163677 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 511161-511192 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 253690-253721 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 223269-223300 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_LR134438 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 29 49239-49270 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 KF301602 Caulobacter phage Cr30, complete genome 136081-136112 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 MN813693 Mycobacterium phage Imvubu, complete genome 26875-26906 9 0.719
NZ_CP014659_1 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973209-973240 32 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 374514-374545 9 0.719
NZ_CP014659_1 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973392-973423 32 AP018399 Xanthomonas phage XacN1 DNA, complete genome 89668-89699 9 0.719
NZ_CP014659_1 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973392-973423 32 NC_030917 Gordonia phage OneUp, complete genome 3597-3628 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1578348-1578379 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1496565-1496596 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1568471-1568502 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1495587-1495618 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1496557-1496588 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1495910-1495941 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1496547-1496578 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1578515-1578546 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1578498-1578529 9 0.719
NZ_CP014659_1 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT 973880-973911 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1578478-1578509 9 0.719
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1341473-1341504 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 883624-883655 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1289467-1289498 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 778732-778763 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1893115-1893146 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 528277-528308 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1365638-1365669 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1372928-1372959 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1544461-1544492 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1120520-1120551 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1668276-1668307 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1289440-1289471 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1374245-1374276 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1754469-1754500 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1794562-1794593 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1373095-1373126 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1480248-1480279 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1081888-1081919 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1295560-1295591 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1332371-1332402 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1292286-1292317 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1483629-1483660 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1744394-1744425 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1259490-1259521 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 697281-697312 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1384558-1384589 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1483596-1483627 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1347512-1347543 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1383811-1383842 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1482390-1482421 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1282964-1282995 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1347512-1347543 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1383811-1383842 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1482426-1482457 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1347512-1347543 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1282986-1283017 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1347516-1347547 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1383811-1383842 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1383811-1383842 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1383811-1383842 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1482426-1482457 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 38257-38288 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 671775-671806 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1482415-1482446 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1282986-1283017 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1289824-1289855 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1270485-1270516 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1323350-1323381 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1363489-1363520 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 801349-801380 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1482415-1482446 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1282986-1283017 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1347511-1347542 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1417459-1417490 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1483417-1483448 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1282986-1283017 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1282986-1283017 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1482426-1482457 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1383814-1383845 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 659985-660016 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1482437-1482468 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1482238-1482269 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 659985-660016 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 66814-66845 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 314161-314192 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 326316-326347 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 102648-102679 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 350440-350471 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 GQ468526 Enterobacteria phage 285P, complete genome 30326-30357 10 0.688
NZ_CP014659_1 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 973392-973423 32 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 161882-161913 10 0.688
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 47060-47091 11 0.656
NZ_CP014659_1 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT 972843-972874 32 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 31654-31685 11 0.656

1. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggaatgatttttaacgctgagatggtg	Protospacer
********************************

2. spacer 2.2|990344|32|NZ_CP014659|CRISPRCasFinder matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatatccgcccatcggcc	Protospacer
********************************

3. spacer 2.2|990344|32|NZ_CP014659|CRISPRCasFinder matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

4. spacer 2.2|990344|32|NZ_CP014659|CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

5. spacer 2.2|990344|32|NZ_CP014659|CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

6. spacer 2.2|990344|32|NZ_CP014659|CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

7. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

8. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

9. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

10. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

11. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023732 (Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

12. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

13. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

14. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

15. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041922 (Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

16. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

17. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

18. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

19. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

20. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_042128 (Escherichia phage RCS47, complete genome) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

21. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
agcgcggcatgatttttaacgatgagatggtc	Protospacer
******* ************* ********* 

22. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 3, identity: 0.906

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcggaatgatttttaacgccgatatggtg	Protospacer
*.********************.** ******

23. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042632 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

24. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042620 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-5, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

25. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018804 (Escherichia coli strain E2863 plasmid pE2863-2, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

26. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

27. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021537 (Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

28. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027309 (Escherichia coli strain 2015C-3108 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

29. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to CP050999 (Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_2) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

30. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047663 (Escherichia coli strain LD93-1 plasmid pLD93-1-90kb, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

31. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029365 (Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

32. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020051 (Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacgcgggatgatttttaacgatgagatggtc	Protospacer
*.*****.************* ********* 

33. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 4, identity: 0.875

agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
aacacggaatgatttttaacggggagatggtg	Protospacer
*.*.*****************  *********

34. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_018023 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence) position: , mismatch: 6, identity: 0.812

gccagcgcgcctgcggcagcaccgg--cagcaat	CRISPR spacer
accagcgcgccggcggcggcaccggcccacca--	Protospacer
.********** *****.*******  ** **  

35. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

gccagcg-cgcctgcggcagcaccggcagcaat	CRISPR spacer
-ccagcaccgcctgcgccagcaccggccgcacc	Protospacer
 *****. ******** ********** *** .

36. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 6, identity: 0.812

gccagcgcgcctgcggcagca-ccggcagcaat	CRISPR spacer
gccagcgcgcctccggccgcacccagccgcca-	Protospacer
************ **** *** **.** ** * 

37. spacer 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 6, identity: 0.812

gctgtcggtcgcagtgtggatattgcgatcaa	CRISPR spacer
gcaacgggtcgcagcgtggatatcgcgatcaa	Protospacer
** .. ********.********.********

38. spacer 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 6, identity: 0.812

gctgtcggtcgcagtgtggatattgcgatcaa	CRISPR spacer
gcaacgggtcgcagcgtggatatcgcgatcaa	Protospacer
** .. ********.********.********

39. spacer 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 6, identity: 0.812

taccgcgacaccgtcaacgacagcaaccactt	CRISPR spacer
aaccgcgtcaccggcaacgacagcaaccggct	Protospacer
 ****** ***** **************. .*

40. spacer 1.16|973575|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 6, identity: 0.812

tgtcttaactccattgctgagtcga-ttgtgaa	CRISPR spacer
tgctttaactccatttttgagtcgatttgtgc-	Protospacer
**..*********** .******** *****  

41. spacer 1.16|973575|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 6, identity: 0.812

tgtcttaactccattgctgagtcga-ttgtgaa	CRISPR spacer
tgctttaactccatttttgagtcgatttgtgc-	Protospacer
**..*********** .******** *****  

42. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.781

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gtcagcgcgccggcggcagcaccggccgtgcc	Protospacer
*.********* ************** *.. .

43. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to MH179480 (Pseudomonas phage 98PfluR60PP, complete genome) position: , mismatch: 7, identity: 0.781

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctggagcgcctgcgggagcaccgccagcaac	Protospacer
 *..* ********** ******* ******.

44. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.781

-gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
taccaac-cgcctgcggcatcaccgccagcagc	Protospacer
 .***.* *********** ***** *****..

45. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.781

gccagcgcgcctgcggcagcaccggcagcaat--	CRISPR spacer
gccagcgcgcctccggccgcacc--cagccgccg	Protospacer
************ **** *****  **** ..  

46. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781

-gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctcggcg-gcctgcgccatcaccggcagcaag	Protospacer
  .*.*** ******* ** ************ 

47. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781

--gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ccgcca--gcggctggggcagcaccggcagcgcc	Protospacer
  ****  *** *** ***************. .

48. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781

-gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctcggcg-gcctgcgccatcaccggcagcaag	Protospacer
  .*.*** ******* ** ************ 

49. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gccagc-gcgcctgcggcagcaccggcagcaat	CRISPR spacer
-cgatcggcgcctgcagcagcaccgacagccgt	Protospacer
 * * * ********.*********.**** .*

50. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 7, identity: 0.781

gccagcgcgcctgcggcagcaccggcagcaat--	CRISPR spacer
gccagcgcgcctccggccgcacc--cagccgccg	Protospacer
************ **** *****  **** ..  

51. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ccgcca--gcggctggggcagcaccggcagcgcc	Protospacer
  ****  *** *** ***************. .

52. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ccgcca--gcggctggggcagcaccggcagcgcc	Protospacer
  ****  *** *** ***************. .

53. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

-gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctcggcg-gcctgcgccatcaccggcagcaag	Protospacer
  .*.*** ******* ** ************ 

54. spacer 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053542 (Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence) position: , mismatch: 7, identity: 0.781

gctgtcggtcgcagtgtggatattgcgatcaa	CRISPR spacer
ggtgtcggtagcagtgtggattttggtaccat	Protospacer
* ******* *********** ***  *.** 

55. spacer 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009356 (Vibrio tubiashii ATCC 19109 plasmid p251, complete sequence) position: , mismatch: 7, identity: 0.781

gctgtcggtcgcagtgtggatattgcgatcaa	CRISPR spacer
ggtgtcggtagcagtgtggattttggtaccat	Protospacer
* ******* *********** ***  *.** 

56. spacer 1.12|973331|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to MK575466 (Vibrio phage Rostov 7, complete genome) position: , mismatch: 7, identity: 0.781

-agcgcggaatgatttttaacgctgagatggtg	CRISPR spacer
tagttc-caatgatttttaacactgacatggtt	Protospacer
 **. *  *************.**** ***** 

57. spacer 2.2|990344|32|NZ_CP014659|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgagaaacgcctggatctccgcccaccgccg	Protospacer
*** . *********** ********.** * 

58. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009453 (Sphingopyxis sp. 113P3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
tcacccgcgtctgcggcagcaccggcaccacc	Protospacer
 *   ****.***************** ** .

59. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_048697 (Pseudomonas phage Littlefix, complete genome) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
tttggagcgcctgcggtagcaccgccagcaac	Protospacer
 ...* **********.******* ******.

60. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctacggcgcctgcggctgcaccggcggcatc	Protospacer
 *.*  *********** ********.*** .

61. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctacggcgcctgcggctgcaccggcggcatc	Protospacer
 *.*  *********** ********.*** .

62. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gtcagcgcgccggcggcagcacctgccgtgcc	Protospacer
*.********* *********** ** *.. .

63. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctacggcgcctgcggctgcaccggcggcatc	Protospacer
 *.*  *********** ********.*** .

64. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
tcttgtcggcctgcggcagctcccgcagcaat	Protospacer
 *. *.  ************ ** ********

65. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gtcagcgcgccggcggcagcacctgccgtgcc	Protospacer
*.********* *********** ** *.. .

66. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gcggccatgcctgcggcagcgccgccagcaag	Protospacer
** . *..************.*** ****** 

67. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gcagcagcgcctgcggcagccccggctgcggt	Protospacer
** .  ************** ***** **..*

68. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gccagcgcacctgcggcatcaccaccgtcacg	Protospacer
********.********* ****. *. **  

69. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gttcgagcgcctgcggcagcgccgtcagcgtt	Protospacer
*.. * **************.*** ****. *

70. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gttcgagcgcctgcggcagcgccgtcagcgtt	Protospacer
*.. * **************.*** ****. *

71. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

--gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cgtcca--gcgcctgccgcagcagcggcagcggc	Protospacer
   ***  ******** ****** *******...

72. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_014035 (Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
acctgcgcgcccgcggcagcaccgcctcgcat	Protospacer
.** *******.************ *    **

73. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to MK765650 (Tortoise microvirus 97 isolate 97_SP_4, complete genome) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gcagcagcacctgcggcagcacctgcagctac	Protospacer
** .  **.************** ***** *.

74. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to MK765551 (Tortoise microvirus 1 isolate 1_SP_22, complete genome) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gcagcagcacctgcggcagcacctgcagctac	Protospacer
** .  **.************** ***** *.

75. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to AJ298552 (Bacteriophage HK113 O gene, N gene, M gene, L gene and X gene (partial)) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gccagcgcacctgcggcatcaccaccgtcacg	Protospacer
********.********* ****. *. **  

76. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to AJ298561 (Bacteriophage PhiD218 O gene, N gene, M gene, L gene and X gene (partial)) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gccagcgcacctgcggcatcaccaccgtcacg	Protospacer
********.********* ****. *. **  

77. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to KU886270 (Freshwater phage uvFW-CGR-AMD-COM-C429, complete genome) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
agcagtttgcctgcgtcagcacctgcagcaac	Protospacer
. ***. .******* ******* *******.

78. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to AJ298560 (Bacteriophage PhiD160 O gene, N gene, M gene, L gene and X gene (partial)) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gccagcgcncctgcggcatcaccaccgtcacg	Protospacer
******** ********* ****. *. **  

79. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to AJ298551 (Bacteriophage HK111 O gene, N gene, M gene, L gene and X gene (partial)) position: , mismatch: 8, identity: 0.75

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gccagcgcacctgcggcatcaccaccgtcacg	Protospacer
********.********* ****. *. **  

80. spacer 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.75

taccgcgacaccgtcaacgacagcaaccactt	CRISPR spacer
cgccgcgacaccgtcaacgacatcatcctgcc	Protospacer
..******************** ** **  ..

81. spacer 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

taccgcgacaccgtcaacgacagcaaccactt--	CRISPR spacer
gacagcgacaccgtcatcgacagca--cggtgaa	Protospacer
 ** ************ ********  *. *   

82. spacer 1.19|973758|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025224 (Enterococcus sp. CR-Ec1 plasmid pCREc1, complete sequence) position: , mismatch: 8, identity: 0.75

tttttaaatccggacagaccctgtaacggatc	CRISPR spacer
tttttaaatccggaaagacactgtcaaaaaag	Protospacer
************** **** **** * ..*  

83. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
ccagagcggcaaatggatttcgacgacctacg	Protospacer
*  ***.******* ***********   ** 

84. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
ccagagcggcaaatggatttcgacgacctacg	Protospacer
*  ***.******* ***********   ** 

85. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
ccagagcggcaaatggatttcgacgacctacg	Protospacer
*  ***.******* ***********   ** 

86. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cccagcgcgcctccggcagcgccggcgcgggg	Protospacer
 *********** *******.*****.  .. 

87. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctcggcagcctgcgccatcaccggcagcaag	Protospacer
 *. *   ******* ** ************ 

88. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ggcgcagcgcctgcggcagcaccaccagccgc	Protospacer
* *.  *****************. **** ..

89. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gtcagcgcgccggcggcggcaccggttccgtc	Protospacer
*.********* *****.*******.  *. .

90. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctcggcagcctgcgccatcaccggcagcaag	Protospacer
 *. *   ******* ** ************ 

91. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctcggcagcctgcgccatcaccggcagcaag	Protospacer
 *. *   ******* ** ************ 

92. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cctcggcagcctgcgccatcaccggcagcaag	Protospacer
 *. *   ******* ** ************ 

93. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134438 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 29) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gcggcaagacctgcagcagcacccgcagcaat	Protospacer
** .  . .*****.******** ********

94. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to KF301602 (Caulobacter phage Cr30, complete genome) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ccttgcgcgcctgcgacagcaccagcaactcc	Protospacer
 *. ***********.*******.***.*  .

95. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 9, identity: 0.719

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ggatgtgcgccagcggcagcagcggcagccgc	Protospacer
*   *.***** ********* ******* ..

96. spacer 1.10|973209|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 9, identity: 0.719

gctgtcggtcgcagtgtggatattgcgatcaa	CRISPR spacer
gctgtcggtcgcggtgtggacatggtcactct	Protospacer
************.*******.** *. *..  

97. spacer 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

taccgcgacaccgtcaacgacagcaaccactt	CRISPR spacer
acttgcgacaccgacaccgacagcaacccgta	Protospacer
  ..********* ** ***********  * 

98. spacer 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_030917 (Gordonia phage OneUp, complete genome) position: , mismatch: 9, identity: 0.719

taccgcgacaccgtcaacgacagcaaccactt	CRISPR spacer
gtgagctacaccgtcaacgacatcaacgagta	Protospacer
    ** *************** **** * * 

99. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

100. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

101. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

102. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

103. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

104. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

105. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

106. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

107. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

108. spacer 1.21|973880|32|NZ_CP014659|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

109. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

110. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcacc	Protospacer
...  .***** ************** *** .

111. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

112. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

113. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

114. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

115. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

116. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

117. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

118. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

119. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

120. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

121. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

122. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

123. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

124. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

125. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

126. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

127. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

128. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

129. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

130. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

131. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

132. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

133. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

134. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

135. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

136. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

137. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

138. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

139. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

140. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

141. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

142. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

143. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

144. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

145. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

146. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

147. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

148. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

149. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

150. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
agtcctgcgcctgcggcagcatctgcagcagc	Protospacer
. .  .***************.* ******..

151. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

152. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

153. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

154. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

155. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

156. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

157. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

158. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

159. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

160. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

161. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

162. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

163. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

164. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

165. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

166. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

167. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

168. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

169. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

170. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

171. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
atttctgcgccagcggcagcaccggctgcatc	Protospacer
...  .***** ************** *** .

172. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gccagcgcccctgcggcggcacccatcaggac	Protospacer
******** ********.***** .. . .*.

173. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
gccagcgcccctgcggcggcacccatcaggac	Protospacer
******** ********.***** .. . .*.

174. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ctcgcagcgcctgcggcagcaccaccagccgg	Protospacer
 .*.  *****************. **** . 

175. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ctcgcagcgcctgcggcagcaccaccagccgg	Protospacer
 .*.  *****************. **** . 

176. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cgatgggcgcctgcagcagcaccgacagccgc	Protospacer
    * ********.*********.**** ..

177. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to GQ468526 (Enterobacteria phage 285P, complete genome) position: , mismatch: 10, identity: 0.688

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
ttacggagacctgcggcaacaccgtcagcaat	Protospacer
 .  * . .*********.***** *******

178. spacer 1.13|973392|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 10, identity: 0.688

taccgcgacaccgtcaacgacagcaaccactt	CRISPR spacer
agccgcgccaccggcaacgacagcacgaagac	Protospacer
 .***** ***** ***********   *  .

179. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 11, identity: 0.656

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
cgatccgcgcgtgcggctgcaccggcaggcca	Protospacer
     ***** ****** **********    

180. spacer 1.4|972843|32|NZ_CP014659|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

gccagcgcgcctgcggcagcaccggcagcaat	CRISPR spacer
aggcgcgcgcctgcggcatcaacggcaaactg	Protospacer
.   ************** ** *****.    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1155264 : 1161068 8 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_2 1164596 : 1291349 125 Salmonella_phage(52.44%) plate,tail,portal,transposase,terminase,lysis,holin,integrase,tRNA,head,capsid attL 1158445:1158461|attR 1246693:1246709
DBSCAN-SWA_3 1391705 : 1437628 53 Salmonella_phage(67.35%) terminase,holin,integrase,tail attL 1373414:1373429|attR 1398209:1398224
DBSCAN-SWA_4 1790720 : 1799891 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_5 1867983 : 1874280 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_6 1902135 : 1942039 57 Salmonella_phage(79.25%) protease,plate,tail,portal,terminase,holin,integrase,head,capsid attL 1893533:1893547|attR 1929609:1929623
DBSCAN-SWA_7 2020719 : 2032104 12 Stenotrophomonas_phage(25.0%) integrase attL 2006607:2006622|attR 2022144:2022159
DBSCAN-SWA_8 2135365 : 2143128 12 Enterobacteria_phage(28.57%) integrase attL 2137575:2137597|attR 2149698:2149720
DBSCAN-SWA_9 2748443 : 2829939 103 Salmonella_phage(58.33%) plate,protease,tail,portal,transposase,terminase,holin,tRNA,head,capsid NA
DBSCAN-SWA_10 2974750 : 3074561 104 Salmonella_phage(86.36%) protease,tail,portal,terminase,lysis,integrase,tRNA,head,capsid attL 2998879:2998898|attR 3071634:3071653
DBSCAN-SWA_11 3146117 : 3155199 8 Ralstonia_phage(16.67%) protease,integrase attL 3144510:3144522|attR 3163696:3163708
DBSCAN-SWA_12 3755218 : 3822448 59 Enterobacteria_phage(20.0%) plate,transposase NA
DBSCAN-SWA_13 4238268 : 4247216 12 Enterobacteria_phage(83.33%) capsid,integrase attL 4235492:4235508|attR 4247386:4247402
DBSCAN-SWA_14 4496880 : 4541128 61 Shigella_phage(45.28%) plate,protease,tail,portal,terminase,holin,integrase,tRNA,head,capsid attL 4499014:4499029|attR 4502420:4502435
DBSCAN-SWA_15 4566958 : 4585113 23 Burkholderia_phage(45.0%) plate,tail NA
DBSCAN-SWA_16 4657141 : 4738606 88 Enterobacteria_phage(74.51%) plate,protease,tail,portal,terminase,holin,integrase,tRNA,head,capsid attL 4727400:4727415|attR 4740904:4740919
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage