Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015062 Mesorhizobium ciceri strain CC1192 chromosome, complete genome 6 crisprs cas3,csa3,DEDDh,WYL 0 1 3 0
NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP015062
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015062_1 1086648-1086730 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015062_2 2261520-2261620 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015062_3 3637039-3637137 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015062_4 3637393-3637475 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015062_5 3638437-3638526 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015062_6 3638782-3638879 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015062_1 1.1|1086675|29|NZ_CP015062|CRISPRCasFinder 1086675-1086703 29 NZ_CP024936 Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence 355069-355097 7 0.759
NZ_CP015062_1 1.1|1086675|29|NZ_CP015062|CRISPRCasFinder 1086675-1086703 29 NZ_CP014309 Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence 381038-381066 7 0.759
NZ_CP015062_1 1.1|1086675|29|NZ_CP015062|CRISPRCasFinder 1086675-1086703 29 NZ_CP014308 Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence 454062-454090 7 0.759

1. spacer 1.1|1086675|29|NZ_CP015062|CRISPRCasFinder matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 7, identity: 0.759

tgcgactgatcgcgccagacaaaggtcca	CRISPR spacer
tgcgacggatcgcgccagacacccatcag	Protospacer
****** **************   .** .

2. spacer 1.1|1086675|29|NZ_CP015062|CRISPRCasFinder matches to NZ_CP014309 (Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

tgcgactgatcgcgccagacaaaggtcca	CRISPR spacer
tgcgacggatcgcgccagacacccatcag	Protospacer
****** **************   .** .

3. spacer 1.1|1086675|29|NZ_CP015062|CRISPRCasFinder matches to NZ_CP014308 (Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

tgcgactgatcgcgccagacaaaggtcca	CRISPR spacer
tgcgacggatcgcgccagacacccatcag	Protospacer
****** **************   .** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2330393 : 2348683 31 uncultured_Mediterranean_phage(35.71%) NA NA
DBSCAN-SWA_2 2369796 : 2380603 18 Ruegeria_phage(10.0%) NA NA
DBSCAN-SWA_3 2389272 : 2401243 17 Rhizobium_phage(22.22%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage