Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015074 Escherichia coli strain Ecol_745 chromosome, complete genome 5 crisprs RT,cas3,csa3,DEDDh,c2c9_V-U4,DinG 0 4 6 0
NZ_CP015075 Escherichia coli strain Ecol_745 plasmid pEC745_OXA48, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP015074
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015074_1 2209158-2209281 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015074_2 2975873-2975996 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015074_3 3512946-3513058 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015074_4 3695986-3696077 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015074_5 3817734-3817816 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015074_3 3.1|3512969|24|NZ_CP015074|PILER-CR 3512969-3512992 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37675 0 1.0
NZ_CP015074_3 3.1|3512969|24|NZ_CP015074|PILER-CR 3512969-3512992 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37958 0 1.0
NZ_CP015074_3 3.2|3513016|25|NZ_CP015074|PILER-CR 3513016-3513040 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37628 0 1.0
NZ_CP015074_3 3.2|3513016|25|NZ_CP015074|PILER-CR 3513016-3513040 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37911 0 1.0
NZ_CP015074_3 3.1|3512969|24|NZ_CP015074|PILER-CR 3512969-3512992 24 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44595 1 0.958
NZ_CP015074_3 3.2|3513016|25|NZ_CP015074|PILER-CR 3513016-3513040 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44548 1 0.96
NZ_CP015074_2 2.1|2975916|38|NZ_CP015074|CRISPRCasFinder 2975916-2975953 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP015074_4 4.1|3696012|40|NZ_CP015074|CRISPRCasFinder 3696012-3696051 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 2 0.95
NZ_CP015074_3 3.2|3513016|25|NZ_CP015074|PILER-CR 3513016-3513040 25 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35685 4 0.84

1. spacer 3.1|3512969|24|NZ_CP015074|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

2. spacer 3.1|3512969|24|NZ_CP015074|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

3. spacer 3.2|3513016|25|NZ_CP015074|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

4. spacer 3.2|3513016|25|NZ_CP015074|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

5. spacer 3.1|3512969|24|NZ_CP015074|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.958

cgcctttacctgatttgggtaaac	CRISPR spacer
tgcctttacctgatttgggtaaac	Protospacer
.***********************

6. spacer 3.2|3513016|25|NZ_CP015074|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttaaggtaaactttat	Protospacer
*********** *************

7. spacer 2.1|2975916|38|NZ_CP015074|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

8. spacer 4.1|3696012|40|NZ_CP015074|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 2, identity: 0.95

gcgctgcgggtcatttttgaaattacctccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.***********.************

9. spacer 3.2|3513016|25|NZ_CP015074|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84

tttacctctttcaggtaaactttat	CRISPR spacer
ggtatctcattcaggtaaactttat	Protospacer
  **.*** ****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1473861 : 1533301 46 Stx2-converting_phage(31.25%) transposase,protease NA
DBSCAN-SWA_2 1839558 : 1846698 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_3 2277678 : 2368512 87 Burkholderia_virus(34.0%) capsid,protease,plate,transposase,tail,integrase,holin attL 2286501:2286518|attR 2356114:2356131
DBSCAN-SWA_4 3056713 : 3116571 77 Enterobacteria_phage(44.23%) capsid,terminase,head,lysis,portal,transposase,tail NA
DBSCAN-SWA_5 3474802 : 3525681 67 Enterobacteria_phage(56.36%) capsid,terminase,head,lysis,portal,transposase,tRNA,tail,integrase attL 3470927:3470942|attR 3533031:3533046
DBSCAN-SWA_6 3532753 : 3582697 67 Escherichia_phage(40.74%) capsid,terminase,head,lysis,portal,tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage