Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011164 Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc37, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011166 Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc46, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011165 Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc32, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011163 Xanthomonas citri pv. aurantifolii strain FDC 1609 chromosome, complete genome 2 crisprs cas3,WYL,DinG,csa3,DEDDh 0 11 27 0

Results visualization

1. NZ_CP011163
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011163_1 29121-29418 Orphan NA
5 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011163_2 244880-244980 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 110715-110744 6 0.8
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 847803-847832 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 841350-841379 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 841096-841125 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 741215-741244 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 513843-513872 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 811281-811310 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 740330-740359 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 742908-742937 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 742897-742926 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 741202-741231 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 741221-741250 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 741199-741228 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 841419-841448 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 841418-841447 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 841403-841432 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP032297 Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence 533041-533070 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 112243-112272 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 115413-115442 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP034838 Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence 115691-115720 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP034839 Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence 115691-115720 6 0.8
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP034837 Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence 93604-93633 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 841350-841379 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 841096-841125 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 741215-741244 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 513843-513872 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 811281-811310 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 740330-740359 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 742908-742937 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 742897-742926 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 741202-741231 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 741221-741250 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 741199-741228 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 841419-841448 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 841418-841447 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 841403-841432 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP032297 Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence 533041-533070 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 112243-112272 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 115413-115442 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP034838 Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence 115691-115720 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP034839 Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence 115691-115720 6 0.8
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP034837 Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence 93604-93633 6 0.8
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 120445-120474 7 0.767
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 117739-117768 7 0.767
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 813583-813612 7 0.767
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 813131-813160 7 0.767
NZ_CP011163_1 1.8|29254|30|NZ_CP011163|CRISPRCasFinder 29254-29283 30 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 150331-150360 7 0.767
NZ_CP011163_1 1.8|29254|30|NZ_CP011163|CRISPRCasFinder 29254-29283 30 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 81611-81640 7 0.767
NZ_CP011163_1 1.9|29308|33|NZ_CP011163|CRISPRCasFinder 29308-29340 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614843-1614875 7 0.788
NZ_CP011163_1 1.10|29365|30|NZ_CP011163|CRISPRCasFinder 29365-29394 30 NZ_CP023712 Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence 83288-83317 7 0.767
NZ_CP011163_1 1.12|29255|30|NZ_CP011163|PILER-CR 29255-29284 30 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 150331-150360 7 0.767
NZ_CP011163_1 1.12|29255|30|NZ_CP011163|PILER-CR 29255-29284 30 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 81611-81640 7 0.767
NZ_CP011163_1 1.13|29309|33|NZ_CP011163|PILER-CR 29309-29341 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614843-1614875 7 0.788
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 NC_027204 Sinorhizobium phage phiM12, complete genome 74902-74931 8 0.733
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 KR052482 Sinorhizobium phage phiN3, complete genome 76608-76637 8 0.733
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 KR052481 Sinorhizobium phage phiM19, complete genome 72551-72580 8 0.733
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 KR052480 Sinorhizobium phage phiM7, complete genome 72291-72320 8 0.733
NZ_CP011163_1 1.6|29146|30|NZ_CP011163|CRISPRCasFinder 29146-29175 30 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 58430-58459 8 0.733
NZ_CP011163_1 1.8|29254|30|NZ_CP011163|CRISPRCasFinder 29254-29283 30 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 934481-934510 8 0.733
NZ_CP011163_1 1.10|29365|30|NZ_CP011163|CRISPRCasFinder 29365-29394 30 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 380720-380749 8 0.733
NZ_CP011163_1 1.12|29255|30|NZ_CP011163|PILER-CR 29255-29284 30 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 934481-934510 8 0.733
NZ_CP011163_1 1.7|29200|30|NZ_CP011163|CRISPRCasFinder 29200-29229 30 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 114529-114558 9 0.7
NZ_CP011163_1 1.9|29308|33|NZ_CP011163|CRISPRCasFinder 29308-29340 33 MH271303 Microbacterium phage MementoMori, complete genome 20739-20771 9 0.727
NZ_CP011163_1 1.9|29308|33|NZ_CP011163|CRISPRCasFinder 29308-29340 33 MN813682 Microbacterium phage Matzah, complete genome 21015-21047 9 0.727
NZ_CP011163_1 1.9|29308|33|NZ_CP011163|CRISPRCasFinder 29308-29340 33 MK937591 Microbacterium phage Cinna, complete genome 21039-21071 9 0.727
NZ_CP011163_1 1.11|29201|30|NZ_CP011163|PILER-CR 29201-29230 30 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 114529-114558 9 0.7
NZ_CP011163_1 1.13|29309|33|NZ_CP011163|PILER-CR 29309-29341 33 MH271303 Microbacterium phage MementoMori, complete genome 20739-20771 9 0.727
NZ_CP011163_1 1.13|29309|33|NZ_CP011163|PILER-CR 29309-29341 33 MN813682 Microbacterium phage Matzah, complete genome 21015-21047 9 0.727
NZ_CP011163_1 1.13|29309|33|NZ_CP011163|PILER-CR 29309-29341 33 MK937591 Microbacterium phage Cinna, complete genome 21039-21071 9 0.727
NZ_CP011163_1 1.2|29194|35|NZ_CP011163|CRT 29194-29228 35 NZ_AP017604 Sphingopyxis sp. EG6 plasmid pSREG01, complete sequence 1759-1793 10 0.714
NZ_CP011163_1 1.4|29302|38|NZ_CP011163|CRT 29302-29339 38 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614844-1614881 10 0.737
NZ_CP011163_1 1.5|29359|35|NZ_CP011163|CRT 29359-29393 35 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 138975-139009 10 0.714
NZ_CP011163_1 1.9|29308|33|NZ_CP011163|CRISPRCasFinder 29308-29340 33 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 116466-116498 10 0.697
NZ_CP011163_1 1.9|29308|33|NZ_CP011163|CRISPRCasFinder 29308-29340 33 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 22147-22179 10 0.697
NZ_CP011163_1 1.9|29308|33|NZ_CP011163|CRISPRCasFinder 29308-29340 33 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 72444-72476 10 0.697
NZ_CP011163_1 1.13|29309|33|NZ_CP011163|PILER-CR 29309-29341 33 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 116466-116498 10 0.697
NZ_CP011163_1 1.13|29309|33|NZ_CP011163|PILER-CR 29309-29341 33 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 22147-22179 10 0.697
NZ_CP011163_1 1.13|29309|33|NZ_CP011163|PILER-CR 29309-29341 33 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 72444-72476 10 0.697

1. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
aatgacgattcaggcaagacctatggcgcc	Protospacer
*..*  *** * ******************

2. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8

agcgcagat----gccggcaagacctatggcgcc	CRISPR spacer
----ctgatcggggccggcaagaccgatggcgcc	Protospacer
    * ***    ************ ********

3. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

4. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

5. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

6. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gcattgggtgccggtgcgcaagccaacaac	Protospacer
* . * ***************.**** ***

7. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

8. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

9. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

10. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

11. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

12. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

13. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

14. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

15. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

16. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

17. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP032297 (Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

18. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

19. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

20. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

21. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

22. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP034837 (Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

23. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

24. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

25. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

26. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gcattgggtgccggtgcgcaagccaacaac	Protospacer
* . * ***************.**** ***

27. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

28. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

29. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

30. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

31. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

32. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

33. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

34. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

35. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

36. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgat	Protospacer
****.*********.********* * .*.

37. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP032297 (Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

38. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

39. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

40. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

41. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

42. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP034837 (Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence) position: , mismatch: 6, identity: 0.8

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
gataactttgccggtgcgcaaatcaagaaa	Protospacer
** * *  **************.****** 

43. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.767

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
tccggctatgtcggcaagacctatcgcgcc	Protospacer
  **   ***.************* *****

44. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.767

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
tccggctatgtcggcaagacctatcgcgcc	Protospacer
  **   ***.************* *****

45. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.767

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
cgacgaaatgccggcaagaccgatggcggc	Protospacer
 *   *.************** ****** *

46. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.767

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
cgacgaaatgccggcaagaccgatggcggc	Protospacer
 *   *.************** ****** *

47. spacer 1.8|29254|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.767

cgcatcggcgacaacgcgcgtaccgggggc	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgcc	Protospacer
  **.***************.****  * *

48. spacer 1.8|29254|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.767

cgcatcggcgacaacgcgcgtaccgggggc	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgcc	Protospacer
  **.***************.****  * *

49. spacer 1.9|29308|33|NZ_CP011163|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ttcgtcgagcgcggcagccagatcatggggctg	Protospacer
.***.********************  **   *

50. spacer 1.10|29365|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gggctggtgggaaccgagctcggcaagggc	CRISPR spacer
ggcgagctgggcaccgagctcggcaaggtg	Protospacer
**   * **** ****************  

51. spacer 1.12|29255|30|NZ_CP011163|PILER-CR matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.767

cgcatcggcgacaacgcgcgtaccgggggc	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgcc	Protospacer
  **.***************.****  * *

52. spacer 1.12|29255|30|NZ_CP011163|PILER-CR matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.767

cgcatcggcgacaacgcgcgtaccgggggc	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgcc	Protospacer
  **.***************.****  * *

53. spacer 1.13|29309|33|NZ_CP011163|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ttcgtcgagcgcggcagccagatcatggggctg	Protospacer
.***.********************  **   *

54. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to NC_027204 (Sinorhizobium phage phiM12, complete genome) position: , mismatch: 8, identity: 0.733

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
gacgaagatgacggcaagacctatgaaacg	Protospacer
..** ***** **************. .* 

55. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to KR052482 (Sinorhizobium phage phiN3, complete genome) position: , mismatch: 8, identity: 0.733

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
gacgaagatgacggcaagacctatgaaacg	Protospacer
..** ***** **************. .* 

56. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to KR052481 (Sinorhizobium phage phiM19, complete genome) position: , mismatch: 8, identity: 0.733

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
gacgaagatgacggcaagacctatgaaacg	Protospacer
..** ***** **************. .* 

57. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to KR052480 (Sinorhizobium phage phiM7, complete genome) position: , mismatch: 8, identity: 0.733

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
gacgaagatgacggcaagacctatgaaacg	Protospacer
..** ***** **************. .* 

58. spacer 1.6|29146|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 8, identity: 0.733

agcgcagatgccggcaagacctatggcgcc	CRISPR spacer
cgcaacgatgccggcgagacctatggcctt	Protospacer
 **.  *********.*********** ..

59. spacer 1.8|29254|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.733

cgcatcggcgacaacgcgcgtaccgggggc	CRISPR spacer
cgcagcggcgacaacgcgcgcaccatcttg	Protospacer
**** ***************.***.     

60. spacer 1.10|29365|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 8, identity: 0.733

gggctggtgggaaccgagctcggcaagggc	CRISPR spacer
ctgctggtgggaatcgagttcggcaccgca	Protospacer
  ***********.****.******  *  

61. spacer 1.12|29255|30|NZ_CP011163|PILER-CR matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.733

cgcatcggcgacaacgcgcgtaccgggggc	CRISPR spacer
cgcagcggcgacaacgcgcgcaccatcttg	Protospacer
**** ***************.***.     

62. spacer 1.7|29200|30|NZ_CP011163|CRISPRCasFinder matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 9, identity: 0.7

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
cagagcggtgccggtgcgcatacctctggg	Protospacer
 *** *************** ***   .. 

63. spacer 1.9|29308|33|NZ_CP011163|CRISPRCasFinder matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 9, identity: 0.727

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctg	Protospacer
**************** ** ****  .  *  *

64. spacer 1.9|29308|33|NZ_CP011163|CRISPRCasFinder matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 9, identity: 0.727

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctg	Protospacer
**************** ** ****  .  *  *

65. spacer 1.9|29308|33|NZ_CP011163|CRISPRCasFinder matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 9, identity: 0.727

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctg	Protospacer
**************** ** ****  .  *  *

66. spacer 1.11|29201|30|NZ_CP011163|PILER-CR matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 9, identity: 0.7

gagatcggtgccggtgcgcaaaccaagaac	CRISPR spacer
cagagcggtgccggtgcgcatacctctggg	Protospacer
 *** *************** ***   .. 

67. spacer 1.13|29309|33|NZ_CP011163|PILER-CR matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 9, identity: 0.727

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctg	Protospacer
**************** ** ****  .  *  *

68. spacer 1.13|29309|33|NZ_CP011163|PILER-CR matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 9, identity: 0.727

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctg	Protospacer
**************** ** ****  .  *  *

69. spacer 1.13|29309|33|NZ_CP011163|PILER-CR matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 9, identity: 0.727

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctg	Protospacer
**************** ** ****  .  *  *

70. spacer 1.2|29194|35|NZ_CP011163|CRT matches to NZ_AP017604 (Sphingopyxis sp. EG6 plasmid pSREG01, complete sequence) position: , mismatch: 10, identity: 0.714

tccatcgagatcggtgccggtgcgcaaaccaagaa	CRISPR spacer
gccgtcgcgatcggtgccggtgcgcagcacctggg	Protospacer
 **.*** ******************.  *  *..

71. spacer 1.4|29302|38|NZ_CP011163|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

agcatcctcgccgagcgcggcagccagatcagtggcgg	CRISPR spacer
atgttcttcgtcgagcgcggcagccagatcatggggct	Protospacer
*   **.***.********************  **   

72. spacer 1.5|29359|35|NZ_CP011163|CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

agcatcgggctggtgggaaccgagctcggcaaggg	CRISPR spacer
agcatcgggcgggtgggcaccgagccgaccatcat	Protospacer
********** ****** *******. . **  . 

73. spacer 1.9|29308|33|NZ_CP011163|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 10, identity: 0.697

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtag	Protospacer
 .**********.****** ******.    .*

74. spacer 1.9|29308|33|NZ_CP011163|CRISPRCasFinder matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 10, identity: 0.697

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtag	Protospacer
 .**********.****** ******.    .*

75. spacer 1.9|29308|33|NZ_CP011163|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.697

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ctcggcgagcgcggcggccagatcctcctccat	Protospacer
**** **********.********  .  * . 

76. spacer 1.13|29309|33|NZ_CP011163|PILER-CR matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 10, identity: 0.697

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtag	Protospacer
 .**********.****** ******.    .*

77. spacer 1.13|29309|33|NZ_CP011163|PILER-CR matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 10, identity: 0.697

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtag	Protospacer
 .**********.****** ******.    .*

78. spacer 1.13|29309|33|NZ_CP011163|PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.697

ctcgccgagcgcggcagccagatcagtggcggg	CRISPR spacer
ctcggcgagcgcggcggccagatcctcctccat	Protospacer
**** **********.********  .  * . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2899 : 82312 58 Leptospira_phage(45.45%) transposase,protease NA
DBSCAN-SWA_2 379357 : 439873 49 Leptospira_phage(57.14%) transposase,tRNA,integrase attL 401203:401219|attR 444461:444477
DBSCAN-SWA_3 627586 : 671364 37 Ralstonia_phage(42.86%) transposase NA
DBSCAN-SWA_4 765138 : 841616 60 Leptospira_phage(18.18%) transposase,tRNA NA
DBSCAN-SWA_5 902798 : 984766 53 Ralstonia_phage(30.0%) transposase NA
DBSCAN-SWA_6 1413880 : 1510181 111 Xanthomonas_virus(25.0%) terminase,tail,head,capsid,protease,portal,transposase,tRNA,integrase attL 1469869:1469928|attR 1509127:1510201
DBSCAN-SWA_7 1530651 : 1588980 39 Ralstonia_phage(25.0%) transposase,protease NA
DBSCAN-SWA_8 1673857 : 1735094 50 Leptospira_phage(20.0%) holin,transposase NA
DBSCAN-SWA_9 2034508 : 2099804 55 Leptospira_phage(23.08%) transposase NA
DBSCAN-SWA_10 2172127 : 2231706 48 Pseudomonas_phage(37.5%) transposase,tail,tRNA,protease NA
DBSCAN-SWA_11 2241299 : 2300105 44 Ralstonia_phage(20.0%) coat,transposase,tRNA,protease NA
DBSCAN-SWA_12 2534976 : 2574106 29 Ralstonia_phage(42.86%) transposase NA
DBSCAN-SWA_13 2722962 : 2797938 57 Leptospira_phage(27.27%) transposase,tRNA,integrase attL 2769071:2769130|attR 2779698:2780867
DBSCAN-SWA_14 2823679 : 2876374 49 Xanthomonas_phage(52.38%) transposase,integrase attL 2841591:2841650|attR 2870757:2871915
DBSCAN-SWA_15 2879566 : 2937677 49 Leptospira_phage(35.0%) transposase,integrase attL 2871910:2871969|attR 2925318:2926514
DBSCAN-SWA_16 3016254 : 3026960 7 Leptospira_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_17 3202910 : 3264396 50 Leptospira_phage(21.43%) transposase,tRNA,protease NA
DBSCAN-SWA_18 3309312 : 3374933 45 uncultured_Caudovirales_phage(33.33%) transposase NA
DBSCAN-SWA_19 3422999 : 3488832 59 Leptospira_phage(23.08%) transposase,tRNA,integrase attL 3412115:3412131|attR 3495724:3495740
DBSCAN-SWA_20 3492057 : 3566793 58 Leptospira_phage(21.43%) transposase,tRNA NA
DBSCAN-SWA_21 3805087 : 3939466 117 Stenotrophomonas_phage(20.59%) terminase,holin,tail,capsid,protease,portal,transposase NA
DBSCAN-SWA_22 4062045 : 4119757 47 Leptospira_phage(23.08%) transposase NA
DBSCAN-SWA_23 4326397 : 4454695 97 Leptospira_phage(20.83%) tail,protease,transposase,tRNA,integrase attL 4417466:4417525|attR 4435649:4436652
DBSCAN-SWA_24 4667984 : 4686298 30 Pseudomonas_phage(56.25%) transposase NA
DBSCAN-SWA_25 4770329 : 4847801 53 Ralstonia_phage(33.33%) plate,transposase NA
DBSCAN-SWA_26 4884767 : 4940757 40 Ralstonia_phage(75.0%) transposase NA
DBSCAN-SWA_27 5038213 : 5122712 50 Ralstonia_phage(25.0%) tail,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage