Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013229 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP013228 UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP013227 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP013231 Staphylococcus aureus strain UTSW MRSA 55 chromosome, complete genome 9 crisprs DEDDh,DinG,cas3,csa3,WYL 8 4 9 1
NZ_CP013230 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_4, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP013231
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_1 117372-117459 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_2 1059408-1059486 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_3 1294357-1294507 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_4 1418274-1418467 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_5 2338066-2338166 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_6 2582356-2582448 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_7 2758166-2758251 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_8 2801494-2801575 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013231_9 2864305-2864587 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP013231_4 4.2|1418353|36|NZ_CP013231|CRT 1418353-1418388 36 NZ_CP013231.1 201651-201686 0 1.0
NZ_CP013231_8 8.1|2801518|34|NZ_CP013231|CRISPRCasFinder 2801518-2801551 34 NZ_CP013231.1 409877-409910 0 1.0
NZ_CP013231_8 8.1|2801518|34|NZ_CP013231|CRISPRCasFinder 2801518-2801551 34 NZ_CP013231.1 499069-499102 0 1.0
NZ_CP013231_2 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder 1059431-1059463 33 NZ_CP013231.1 201707-201739 1 0.97
NZ_CP013231_2 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder 1059431-1059463 33 NZ_CP013231.1 409832-409864 1 0.97
NZ_CP013231_2 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder 1059431-1059463 33 NZ_CP013231.1 724348-724380 1 0.97
NZ_CP013231_2 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder 1059431-1059463 33 NZ_CP013231.1 1695792-1695824 1 0.97
NZ_CP013231_2 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder 1059431-1059463 33 NZ_CP013231.1 2758232-2758264 1 0.97
NZ_CP013231_4 4.2|1418353|36|NZ_CP013231|CRT 1418353-1418388 36 NZ_CP013231.1 902798-902833 1 0.972
NZ_CP013231_7 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder 2758196-2758221 26 NZ_CP013231.1 1861212-1861237 1 0.962
NZ_CP013231_7 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder 2758196-2758221 26 NZ_CP013231.1 1861268-1861293 1 0.962
NZ_CP013231_7 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder 2758196-2758221 26 NZ_CP013231.1 2721133-2721158 1 0.962
NZ_CP013231_9 9.1|2864335|26|NZ_CP013231|CRT 2864335-2864360 26 NZ_CP013231.1 2864279-2864304 1 0.962
NZ_CP013231_9 9.3|2864449|26|NZ_CP013231|CRT 2864449-2864474 26 NZ_CP013231.1 2758252-2758277 1 0.962
NZ_CP013231_2 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder 1059431-1059463 33 NZ_CP013231.1 499115-499147 2 0.939
NZ_CP013231_4 4.1|1418297|33|NZ_CP013231|CRT 1418297-1418329 33 NZ_CP013231.1 201707-201739 2 0.939
NZ_CP013231_4 4.1|1418297|33|NZ_CP013231|CRT 1418297-1418329 33 NZ_CP013231.1 409832-409864 2 0.939
NZ_CP013231_4 4.1|1418297|33|NZ_CP013231|CRT 1418297-1418329 33 NZ_CP013231.1 499115-499147 2 0.939
NZ_CP013231_4 4.1|1418297|33|NZ_CP013231|CRT 1418297-1418329 33 NZ_CP013231.1 1695792-1695824 2 0.939
NZ_CP013231_4 4.1|1418297|33|NZ_CP013231|CRT 1418297-1418329 33 NZ_CP013231.1 2758232-2758264 2 0.939
NZ_CP013231_4 4.2|1418353|36|NZ_CP013231|CRT 1418353-1418388 36 NZ_CP013231.1 724287-724322 2 0.944
NZ_CP013231_4 4.2|1418353|36|NZ_CP013231|CRT 1418353-1418388 36 NZ_CP013231.1 1070234-1070269 2 0.944
NZ_CP013231_4 4.3|1418412|33|NZ_CP013231|CRT 1418412-1418444 33 NZ_CP013231.1 201707-201739 2 0.939
NZ_CP013231_4 4.3|1418412|33|NZ_CP013231|CRT 1418412-1418444 33 NZ_CP013231.1 409832-409864 2 0.939
NZ_CP013231_4 4.3|1418412|33|NZ_CP013231|CRT 1418412-1418444 33 NZ_CP013231.1 1695792-1695824 2 0.939
NZ_CP013231_4 4.3|1418412|33|NZ_CP013231|CRT 1418412-1418444 33 NZ_CP013231.1 2758232-2758264 2 0.939
NZ_CP013231_7 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder 2758196-2758221 26 NZ_CP013231.1 2721189-2721214 2 0.923
NZ_CP013231_7 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder 2758196-2758221 26 NZ_CP013231.1 2864279-2864304 2 0.923
NZ_CP013231_9 9.1|2864335|26|NZ_CP013231|CRT 2864335-2864360 26 NZ_CP013231.1 1861212-1861237 2 0.923
NZ_CP013231_9 9.1|2864335|26|NZ_CP013231|CRT 2864335-2864360 26 NZ_CP013231.1 1861268-1861293 2 0.923
NZ_CP013231_9 9.1|2864335|26|NZ_CP013231|CRT 2864335-2864360 26 NZ_CP013231.1 2721133-2721158 2 0.923
NZ_CP013231_9 9.3|2864449|26|NZ_CP013231|CRT 2864449-2864474 26 NZ_CP013231.1 2299400-2299425 2 0.923

1. spacer 4.2|1418353|36|NZ_CP013231|CRT matches to position: 201651-201686, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

2. spacer 8.1|2801518|34|NZ_CP013231|CRISPRCasFinder matches to position: 409877-409910, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 8.1|2801518|34|NZ_CP013231|CRISPRCasFinder matches to position: 499069-499102, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

4. spacer 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder matches to position: 201707-201739, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

5. spacer 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder matches to position: 409832-409864, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

6. spacer 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder matches to position: 724348-724380, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattatagtaagctgacttttcgtcagcttctg	Protospacer
****** **************************

7. spacer 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder matches to position: 1695792-1695824, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

8. spacer 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder matches to position: 2758232-2758264, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

9. spacer 4.2|1418353|36|NZ_CP013231|CRT matches to position: 902798-902833, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

10. spacer 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder matches to position: 1861212-1861237, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
************.*************

11. spacer 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder matches to position: 1861268-1861293, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctttgttggggccccg	Protospacer
************ *************

12. spacer 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder matches to position: 2721133-2721158, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctgtgttggggccccg	Protospacer
***** ********************

13. spacer 9.1|2864335|26|NZ_CP013231|CRT matches to position: 2864279-2864304, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaggctggtgg	Protospacer
***********************.**

14. spacer 9.3|2864449|26|NZ_CP013231|CRT matches to position: 2758252-2758277, mismatch: 1, identity: 0.962

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacacagaagctgacga	Protospacer
**********************.***

15. spacer 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder matches to position: 499115-499147, mismatch: 2, identity: 0.939

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
******.******************* ******

16. spacer 4.1|1418297|33|NZ_CP013231|CRT matches to position: 201707-201739, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

17. spacer 4.1|1418297|33|NZ_CP013231|CRT matches to position: 409832-409864, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

18. spacer 4.1|1418297|33|NZ_CP013231|CRT matches to position: 499115-499147, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

19. spacer 4.1|1418297|33|NZ_CP013231|CRT matches to position: 1695792-1695824, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

20. spacer 4.1|1418297|33|NZ_CP013231|CRT matches to position: 2758232-2758264, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

21. spacer 4.2|1418353|36|NZ_CP013231|CRT matches to position: 724287-724322, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

22. spacer 4.2|1418353|36|NZ_CP013231|CRT matches to position: 1070234-1070269, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

23. spacer 4.3|1418412|33|NZ_CP013231|CRT matches to position: 201707-201739, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

24. spacer 4.3|1418412|33|NZ_CP013231|CRT matches to position: 409832-409864, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

25. spacer 4.3|1418412|33|NZ_CP013231|CRT matches to position: 1695792-1695824, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

26. spacer 4.3|1418412|33|NZ_CP013231|CRT matches to position: 2758232-2758264, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

27. spacer 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder matches to position: 2721189-2721214, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

28. spacer 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder matches to position: 2864279-2864304, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

29. spacer 9.1|2864335|26|NZ_CP013231|CRT matches to position: 1861212-1861237, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
*************.***.********

30. spacer 9.1|2864335|26|NZ_CP013231|CRT matches to position: 1861268-1861293, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacaaagaagctggcgg	Protospacer
************* ***.********

31. spacer 9.1|2864335|26|NZ_CP013231|CRT matches to position: 2721133-2721158, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
*****************.** *****

32. spacer 9.3|2864449|26|NZ_CP013231|CRT matches to position: 2299400-2299425, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacaaagaagctgacga	Protospacer
************* ********.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013231_9 9.4|2864505|53|NZ_CP013231|CRT 2864505-2864557 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
NZ_CP013231_7 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder 2758196-2758221 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
NZ_CP013231_7 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder 2758196-2758221 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
NZ_CP013231_7 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder 2758196-2758221 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808
NZ_CP013231_9 9.3|2864449|26|NZ_CP013231|CRT 2864449-2864474 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
NZ_CP013231_2 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder 1059431-1059463 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 9.4|2864505|53|NZ_CP013231|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttgagaaactatcatttctgtcccactccctt	Protospacer
************************ **** *********************  

2. spacer 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

3. spacer 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

4. spacer 7.1|2758196|26|NZ_CP013231|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

5. spacer 9.3|2864449|26|NZ_CP013231|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcga	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
...****.***************** 

6. spacer 2.1|1059431|33|NZ_CP013231|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
ttttatcgtaaggtgagttttcgtcaagcacct	Protospacer
. ********** *** *********. . *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 102596 : 111069 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 552841 : 640079 106 Staphylococcus_phage(84.21%) portal,terminase,capsid,tRNA,plate,holin,head,tail,protease,integrase attL 589204:589224|attR 635097:635117
DBSCAN-SWA_3 695910 : 704222 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_4 773359 : 782401 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_5 907861 : 987193 75 Staphylococcus_phage(96.61%) tRNA,protease,transposase NA
DBSCAN-SWA_6 1072330 : 1172570 120 Staphylococcus_phage(88.75%) portal,terminase,capsid,tRNA,tail,holin,head,protease,integrase attL 1133756:1133773|attR 1158687:1158704
DBSCAN-SWA_7 2689824 : 2697644 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_8 2709616 : 2724347 14 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_9 2803056 : 2822286 25 Staphylococcus_phage(63.16%) capsid,terminase,integrase attL 2805593:2805609|attR 2819549:2819565
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP013231.1|WP_001790641.1|2713199_2713301_+|hypothetical-protein 2713199_2713301_+ 33 aa aa NA NA NA 2709616-2724347 yes