Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP005188 Sphingobium sp. MI1205 chromosome 1, complete sequence 2 crisprs cas3,csa3,WYL,DinG 0 2 9 0
NZ_CP005193 Sphingobium sp. MI1205 plasmid pMI4, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 1 crisprs NA 0 1 1 0
NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP005189 Sphingobium sp. MI1205 chromosome 2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP005191 Sphingobium sp. MI1205 plasmid pMI2, complete sequence 0 crisprs csa3,RT 0 0 4 0

Results visualization

1. NZ_CP005188
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005188_1 552110-552198 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005188_2 2380574-2380762 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP005188_2 2.1|2380601|27|NZ_CP005188|CRISPRCasFinder 2380601-2380627 27 NZ_CP041068 Bacillus megaterium strain KNU-01 plasmid pKNU_01_4, complete sequence 45019-45045 5 0.815
NZ_CP005188_2 2.1|2380601|27|NZ_CP005188|CRISPRCasFinder 2380601-2380627 27 NZ_CP018878 Bacillus megaterium strain JX285 plasmid 5, complete sequence 3200-3226 5 0.815
NZ_CP005188_2 2.1|2380601|27|NZ_CP005188|CRISPRCasFinder 2380601-2380627 27 CP041516 Bacillus aryabhattai strain KNU10 plasmid unnamed, complete sequence 9074-9100 5 0.815
NZ_CP005188_2 2.2|2380655|27|NZ_CP005188|CRISPRCasFinder 2380655-2380681 27 NC_029047 Verrucomicrobia phage P8625, complete genome 22404-22430 7 0.741

1. spacer 2.1|2380601|27|NZ_CP005188|CRISPRCasFinder matches to NZ_CP041068 (Bacillus megaterium strain KNU-01 plasmid pKNU_01_4, complete sequence) position: , mismatch: 5, identity: 0.815

aacttctaacaggtccagatatgggcc	CRISPR spacer
catttgtaacaggtccagatatgagca	Protospacer
 *.** *****************.** 

2. spacer 2.1|2380601|27|NZ_CP005188|CRISPRCasFinder matches to NZ_CP018878 (Bacillus megaterium strain JX285 plasmid 5, complete sequence) position: , mismatch: 5, identity: 0.815

aacttctaacaggtccagatatgggcc	CRISPR spacer
catttgtaacaggtccagatatgagca	Protospacer
 *.** *****************.** 

3. spacer 2.1|2380601|27|NZ_CP005188|CRISPRCasFinder matches to CP041516 (Bacillus aryabhattai strain KNU10 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aacttctaacaggtccagatatgggcc	CRISPR spacer
catttgtaacaggtccagatatgagca	Protospacer
 *.** *****************.** 

4. spacer 2.2|2380655|27|NZ_CP005188|CRISPRCasFinder matches to NC_029047 (Verrucomicrobia phage P8625, complete genome) position: , mismatch: 7, identity: 0.741

tattgacatgaacccaaaagacggccc	CRISPR spacer
tattgacatgaacccaaaaatagaatt	Protospacer
*******************.  *. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 300898 : 340587 54 Burkholderia_phage(24.14%) terminase,head,plate,integrase,tail,protease,portal,capsid attL 302715:302752|attR 340620:340657
DBSCAN-SWA_2 409178 : 457401 44 Enterobacteria_phage(33.33%) transposase NA
DBSCAN-SWA_3 958398 : 965813 10 Synechococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_4 2311539 : 2353409 48 uncultured_Mediterranean_phage(10.53%) head,tail,tRNA,protease,portal,capsid NA
DBSCAN-SWA_5 2489771 : 2495281 8 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_6 2537563 : 2577218 39 Yellowstone_lake_phycodnavirus(14.29%) integrase attL 2567070:2567086|attR 2579249:2579265
DBSCAN-SWA_7 2616818 : 2623063 6 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_8 2987062 : 3006391 23 Rhodobacter_phage(16.67%) head,terminase,tail,protease,portal,capsid NA
DBSCAN-SWA_9 3214363 : 3275754 59 Trichoplusia_ni_ascovirus(25.0%) integrase,transposase attL 3271785:3271805|attR 3283962:3283982
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP005193
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005193_1 18214-18303 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP005193_1 1.1|18238|42|NZ_CP005193|CRISPRCasFinder 18238-18279 42 NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 31147-31188 0 1.0
NZ_CP005193_1 1.1|18238|42|NZ_CP005193|CRISPRCasFinder 18238-18279 42 NZ_CP005087 Sphingobium sp. TKS plasmid pTK3, complete sequence 20315-20356 0 1.0
NZ_CP005193_1 1.1|18238|42|NZ_CP005193|CRISPRCasFinder 18238-18279 42 NC_020562 Sphingomonas sp. MM-1 plasmid pISP1, complete sequence 159529-159570 0 1.0
NZ_CP005193_1 1.1|18238|42|NZ_CP005193|CRISPRCasFinder 18238-18279 42 NZ_CP005193 Sphingobium sp. MI1205 plasmid pMI4, complete sequence 18238-18279 0 1.0
NZ_CP005193_1 1.1|18238|42|NZ_CP005193|CRISPRCasFinder 18238-18279 42 NC_020563 Sphingomonas sp. MM-1 plasmid pISP4, complete sequence 33102-33143 0 1.0
NZ_CP005193_1 1.1|18238|42|NZ_CP005193|CRISPRCasFinder 18238-18279 42 NZ_CP005088 Sphingobium sp. TKS plasmid pTK4, complete sequence 56281-56322 0 1.0
NZ_CP005193_1 1.1|18238|42|NZ_CP005193|CRISPRCasFinder 18238-18279 42 NZ_AP017658 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence 34773-34814 1 0.976
NZ_CP005193_1 1.1|18238|42|NZ_CP005193|CRISPRCasFinder 18238-18279 42 NZ_CP047220 Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence 56938-56979 2 0.952

1. spacer 1.1|18238|42|NZ_CP005193|CRISPRCasFinder matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtgagtgttggggtagccttcggtgagttttggggtcggt	CRISPR spacer
gcgtgagtgttggggtagccttcggtgagttttggggtcggt	Protospacer
******************************************

2. spacer 1.1|18238|42|NZ_CP005193|CRISPRCasFinder matches to NZ_CP005087 (Sphingobium sp. TKS plasmid pTK3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtgagtgttggggtagccttcggtgagttttggggtcggt	CRISPR spacer
gcgtgagtgttggggtagccttcggtgagttttggggtcggt	Protospacer
******************************************

3. spacer 1.1|18238|42|NZ_CP005193|CRISPRCasFinder matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtgagtgttggggtagccttcggtgagttttggggtcggt	CRISPR spacer
gcgtgagtgttggggtagccttcggtgagttttggggtcggt	Protospacer
******************************************

4. spacer 1.1|18238|42|NZ_CP005193|CRISPRCasFinder matches to NZ_CP005193 (Sphingobium sp. MI1205 plasmid pMI4, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtgagtgttggggtagccttcggtgagttttggggtcggt	CRISPR spacer
gcgtgagtgttggggtagccttcggtgagttttggggtcggt	Protospacer
******************************************

5. spacer 1.1|18238|42|NZ_CP005193|CRISPRCasFinder matches to NC_020563 (Sphingomonas sp. MM-1 plasmid pISP4, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtgagtgttggggtagccttcggtgagttttggggtcggt	CRISPR spacer
gcgtgagtgttggggtagccttcggtgagttttggggtcggt	Protospacer
******************************************

6. spacer 1.1|18238|42|NZ_CP005193|CRISPRCasFinder matches to NZ_CP005088 (Sphingobium sp. TKS plasmid pTK4, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtgagtgttggggtagccttcggtgagttttggggtcggt	CRISPR spacer
gcgtgagtgttggggtagccttcggtgagttttggggtcggt	Protospacer
******************************************

7. spacer 1.1|18238|42|NZ_CP005193|CRISPRCasFinder matches to NZ_AP017658 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence) position: , mismatch: 1, identity: 0.976

gcgtgagtgttggggtagccttcggtgagttttggggtcggt	CRISPR spacer
gcgtgagttttggggtagccttcggtgagttttggggtcggt	Protospacer
******** *********************************

8. spacer 1.1|18238|42|NZ_CP005193|CRISPRCasFinder matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.952

gcgtgagtgttggggtagccttcggtgagttttggggtcggt	CRISPR spacer
gcgtgagttttagggtagccttcggtgagttttggggtcggt	Protospacer
******** **.******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP005192
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005192_1 31123-31212 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP005192_1 1.1|31147|42|NZ_CP005192|CRISPRCasFinder 31147-31188 42 NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 31147-31188 0 1.0
NZ_CP005192_1 1.1|31147|42|NZ_CP005192|CRISPRCasFinder 31147-31188 42 NZ_CP005087 Sphingobium sp. TKS plasmid pTK3, complete sequence 20315-20356 0 1.0
NZ_CP005192_1 1.1|31147|42|NZ_CP005192|CRISPRCasFinder 31147-31188 42 NC_020562 Sphingomonas sp. MM-1 plasmid pISP1, complete sequence 159529-159570 0 1.0
NZ_CP005192_1 1.1|31147|42|NZ_CP005192|CRISPRCasFinder 31147-31188 42 NZ_CP005193 Sphingobium sp. MI1205 plasmid pMI4, complete sequence 18238-18279 0 1.0
NZ_CP005192_1 1.1|31147|42|NZ_CP005192|CRISPRCasFinder 31147-31188 42 NC_020563 Sphingomonas sp. MM-1 plasmid pISP4, complete sequence 33102-33143 0 1.0
NZ_CP005192_1 1.1|31147|42|NZ_CP005192|CRISPRCasFinder 31147-31188 42 NZ_CP005088 Sphingobium sp. TKS plasmid pTK4, complete sequence 56281-56322 0 1.0
NZ_CP005192_1 1.1|31147|42|NZ_CP005192|CRISPRCasFinder 31147-31188 42 NZ_AP017658 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence 34773-34814 1 0.976
NZ_CP005192_1 1.1|31147|42|NZ_CP005192|CRISPRCasFinder 31147-31188 42 NZ_CP047220 Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence 56938-56979 2 0.952

1. spacer 1.1|31147|42|NZ_CP005192|CRISPRCasFinder matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 0, identity: 1.0

accgaccccaaaactcaccgaaggctaccccaacactcacgc	CRISPR spacer
accgaccccaaaactcaccgaaggctaccccaacactcacgc	Protospacer
******************************************

2. spacer 1.1|31147|42|NZ_CP005192|CRISPRCasFinder matches to NZ_CP005087 (Sphingobium sp. TKS plasmid pTK3, complete sequence) position: , mismatch: 0, identity: 1.0

accgaccccaaaactcaccgaaggctaccccaacactcacgc	CRISPR spacer
accgaccccaaaactcaccgaaggctaccccaacactcacgc	Protospacer
******************************************

3. spacer 1.1|31147|42|NZ_CP005192|CRISPRCasFinder matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 0, identity: 1.0

accgaccccaaaactcaccgaaggctaccccaacactcacgc	CRISPR spacer
accgaccccaaaactcaccgaaggctaccccaacactcacgc	Protospacer
******************************************

4. spacer 1.1|31147|42|NZ_CP005192|CRISPRCasFinder matches to NZ_CP005193 (Sphingobium sp. MI1205 plasmid pMI4, complete sequence) position: , mismatch: 0, identity: 1.0

accgaccccaaaactcaccgaaggctaccccaacactcacgc	CRISPR spacer
accgaccccaaaactcaccgaaggctaccccaacactcacgc	Protospacer
******************************************

5. spacer 1.1|31147|42|NZ_CP005192|CRISPRCasFinder matches to NC_020563 (Sphingomonas sp. MM-1 plasmid pISP4, complete sequence) position: , mismatch: 0, identity: 1.0

accgaccccaaaactcaccgaaggctaccccaacactcacgc	CRISPR spacer
accgaccccaaaactcaccgaaggctaccccaacactcacgc	Protospacer
******************************************

6. spacer 1.1|31147|42|NZ_CP005192|CRISPRCasFinder matches to NZ_CP005088 (Sphingobium sp. TKS plasmid pTK4, complete sequence) position: , mismatch: 0, identity: 1.0

accgaccccaaaactcaccgaaggctaccccaacactcacgc	CRISPR spacer
accgaccccaaaactcaccgaaggctaccccaacactcacgc	Protospacer
******************************************

7. spacer 1.1|31147|42|NZ_CP005192|CRISPRCasFinder matches to NZ_AP017658 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence) position: , mismatch: 1, identity: 0.976

accgaccccaaaactcaccgaaggctaccccaacactcacgc	CRISPR spacer
accgaccccaaaactcaccgaaggctaccccaaaactcacgc	Protospacer
********************************* ********

8. spacer 1.1|31147|42|NZ_CP005192|CRISPRCasFinder matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.952

accgaccccaaaactcaccgaaggctaccccaacactcacgc	CRISPR spacer
accgaccccaaaactcaccgaaggctaccctaaaactcacgc	Protospacer
******************************.** ********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10064 : 55763 46 Escherichia_phage(30.43%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP005190
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 140373 : 181043 45 Escherichia_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP005191
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5312 : 30230 28 Escherichia_phage(33.33%) transposase,integrase NA
DBSCAN-SWA_2 66363 : 114183 49 Lactococcus_phage(40.0%) transposase,integrase attL 61457:61471|attR 120099:120113
DBSCAN-SWA_3 145567 : 166842 17 Mycobacterium_phage(25.0%) transposase,integrase attL 145746:145761|attR 170492:170507
DBSCAN-SWA_4 188667 : 218263 32 Salmonella_phage(18.18%) transposase,integrase attL 182724:182739|attR 206640:206655
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage