Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014034 Vibrio fluvialis strain FDAARGOS_104 chromosome 1, complete sequence 2 crisprs DEDDh,cas3,cas6f,cas7f,cas5f,cas8f,cas3f,cas1,WYL,csa3 0 8 1 0
NZ_CP014035 Vibrio fluvialis strain FDAARGOS_104 chromosome 2, complete sequence 1 crisprs DinG,csa3,DEDDh,cas5f,cas7f,cas6f,csx1,TnsE_C,RT,cas3 0 2 4 0

Results visualization

1. NZ_CP014034
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014034_1 859756-859844 TypeI-F I-F
1 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014034_2 859857-861144 TypeI-F I-F
21 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545746 Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 952-983 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545746 Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 3677-3708 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545746 Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 6402-6433 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664577 Vibrio phage CTX transgenic isolate recombinant pCTX1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), and Kan (kan) genes, complete cds; and CtxB (ctxB) gene, partial sequence 890-921 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ434666 Vibrio phage CTX RstC (rstC) gene, partial cds; and RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 607-638 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664574 Vibrio phage CTX transgenic isolate CTX-RS1 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence 2198-2229 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466611 Vibrio phage CTX strain IB1617 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), and RstR (rstR) genes, complete cds 877-908 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466611 Vibrio phage CTX strain IB1617 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), and RstR (rstR) genes, complete cds 7800-7831 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KJ540271 Vibrio phage CTX plasmid pCTX-5 Kan, complete sequence 589-620 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GU942563 Vibrio phage CTX chromosome I prophage, complete sequence 689-720 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GU942563 Vibrio phage CTX chromosome I prophage, complete sequence 3414-3445 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GU942563 Vibrio phage CTX chromosome I prophage, complete sequence 6261-6292 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GU942563 Vibrio phage CTX chromosome I prophage, complete sequence 11726-11757 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485654 Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 882-913 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485654 Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 3607-3638 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 AB428550 Vibrio phage CTX ctxB, hp1, rstR, rstA, and rstB genes for cholera toxin B subunit, hypothetical protein, transcriptional repressor RstR, RstA and RstB proteins, partial and complete cds 577-608 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KM352500 Vibrio phage CTX strain 81, partial genome 993-1024 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 NC_015209 Vibrio phage CTX chromosome I, complete genome 892-923 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 NC_015209 Vibrio phage CTX chromosome I, complete genome 3617-3648 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485650 Vibrio phage CTX strain IB4322 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 898-929 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485650 Vibrio phage CTX strain IB4322 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 3623-3654 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664572 Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 681-712 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449748 Vibrio phage CTX strain E1781 RstR (rstR) gene, complete cds 667-698 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664580 Vibrio phage CTX transgenic plasmid pCTX-1-1kan, complete sequence 467-498 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664575 Vibrio phage CTX transgenic isolate recombinant CTX1 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence 2527-2558 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466609 Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 678-709 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466609 Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7719-7750 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466610 Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 879-910 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466610 Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 7920-7951 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545745 Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 952-983 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545745 Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 3677-3708 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545745 Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 6402-6433 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ499847 Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), Ace (ace), ZOT (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds; and unknown gene 853-884 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 DQ012295 Vibrio phage CTX CtxB (ctxB) gene, partial cds; RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 952-983 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485644 Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 881-912 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485644 Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7929-7960 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449741 Vibrio phage CTX strain 07.95vp CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds 1127-1158 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664567 Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 671-702 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664567 Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7718-7749 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449743 Vibrio phage CTX strain MG116926 RstR (rstR) gene, complete cds 667-698 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KJ619459 Vibrio phage CTX, complete genome 8-39 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449744 Vibrio phage CTX strain MG116926 CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds 1127-1158 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485653 Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 734-765 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485653 Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 3459-3490 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664568 Vibrio phage CTX isolate recombinant CTX-RS1 plasmid pCTX-1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 891-922 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664568 Vibrio phage CTX isolate recombinant CTX-RS1 plasmid pCTX-1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 7807-7838 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466612 Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 678-709 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466612 Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7726-7757 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485649 Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 667-698 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485649 Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7708-7739 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KJ540270 Vibrio phage CTX plasmid pCTX-3 Kan, complete sequence 589-620 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485646 Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 667-698 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485646 Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7715-7746 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545744 Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 952-983 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545744 Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 3677-3708 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 JN545744 Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 6401-6432 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 MF155889 Vibrio virus CTXphi, complete genome 26-57 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664579 Vibrio phage CTX transgenic plasmid pCTX-1kan, complete sequence 467-498 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KJ540269 Vibrio phage CTX plasmid pCTX1*Kan, complete sequence 589-620 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485652 Vibrio phage CTX strain 01.07vp RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 898-929 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485652 Vibrio phage CTX strain 01.07vp RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 3623-3654 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449738 Vibrio phage CTX strain 07.95vp RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds 858-889 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485648 Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 667-698 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485648 Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7715-7746 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449752 Vibrio phage CTX strain IB4642 RstC (rstC) gene, partial cds; RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds 557-588 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664578 Vibrio phage CTX transgenic plasmid pCTX3 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), and Kan (kan) genes, complete cds; and CtxB (ctxB) gene, partial sequence 1012-1043 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664581 Vibrio phage CTX transgenic plasmid pCTX-3kan, complete sequence 589-620 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449751 Vibrio phage CTX strain IB4642 RstR (rstR) gene, partial cds 870-901 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449747 Vibrio phage CTX strain E1781 RstC (rstC) gene, partial cds; and RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 607-638 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449749 Vibrio phage CTX strain E1781 CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds 1107-1138 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664566 Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 898-929 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664566 Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 3623-3654 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664566 Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 10539-10570 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KJ540272 Vibrio phage CTX plasmid pCTX-6 Kan, complete sequence 589-620 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485651 Vibrio phage CTX strain IB4642 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 898-929 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485651 Vibrio phage CTX strain IB4642 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 3623-3654 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KT728931 Vibrio phage pre-CTX, complete genome 558-589 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 HQ224500 Vibrio phage CTX, complete sequence 892-923 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 HQ224500 Vibrio phage CTX, complete sequence 3617-3648 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485645 Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 881-912 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485645 Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7929-7960 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ449746 Vibrio phage CTX strain E1781 RstR (rstR) gene, partial cds 734-765 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466608 Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 879-910 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466608 Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 7920-7951 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ466608 Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 10879-10910 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485647 Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 667-698 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 GQ485647 Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 7715-7746 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 FJ434665 Vibrio phage CTX RstR (rstR) gene, partial cds 882-913 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 KF664573 Vibrio phage CTX transgenic isolate recombinant PM7 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence 2198-2229 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 AY145126 Vibrio phage CTX RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds 21-52 0 1.0
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 MN200778 Vibrio phage VAI1, complete genome 5459-5490 1 0.969
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 MN200777 Vibrio phage VAI2, complete genome 5459-5490 1 0.969
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 AF416590 Vibrio phage CTX core region Cep (cep), OrfU (orfU), Ace (ace), and Zot (zot) genes, complete cds and Vibrio cholerae serogroup 0139, partial sequence 3686-3717 1 0.969
NZ_CP014034_2 2.7|860245|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860245-860276 32 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 374479-374510 5 0.844
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 AF416590 Vibrio phage CTX core region Cep (cep), OrfU (orfU), Ace (ace), and Zot (zot) genes, complete cds and Vibrio cholerae serogroup 0139, partial sequence 3807-3838 5 0.844
NZ_CP014034_2 2.14|860665|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860665-860696 32 NZ_CP015744 Shinella sp. HZN7 plasmid pShin-08, complete sequence 43071-43102 6 0.812
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 NC_001956 Vibrio phage fs2, complete genome 90-121 6 0.812
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 AB002632 Vibrio phage fs2 DNA, complete genome 90-121 6 0.812
NZ_CP014034_2 2.5|860125|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860125-860156 32 NZ_CP017104 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872c, complete sequence 255721-255752 8 0.75
NZ_CP014034_2 2.10|860425|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860425-860456 32 MN034288 Leviviridae sp. isolate H4_Bulk_47_scaffold_485 RNA-dependent RNA polymerase (H4Bulk47485_000001) and hypothetical protein (H4Bulk47485_000002) genes, complete cds; and hypothetical protein (H4Bulk47485_000003) gene, partial cds 2903-2934 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_KY940428 UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence 192831-192862 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NC_014172 Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence 298702-298733 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP009595 Bacillus cereus strain 3a plasmid pBFC_3, complete sequence 174313-174344 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP053290 Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence 372261-372292 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 277182-277213 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP009606 Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence 40548-40579 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP041978 Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence 122224-122255 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NC_011655 Bacillus cereus AH187 plasmid pAH187_270, complete sequence 173924-173955 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NC_010924 Bacillus cereus strain AH187 plasmid pCER270, complete sequence 230333-230364 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 CP045776 Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence 222758-222789 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP053994 Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence 114319-114350 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 CP041980 Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence 105181-105212 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NC_016792 Bacillus cereus NC7401 plasmid pNCcld, complete sequence 229202-229233 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP040343 Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence 338244-338275 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 247748-247779 8 0.75
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 NZ_CP053992 Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence 97335-97366 8 0.75
NZ_CP014034_2 2.4|860065|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860065-860096 32 MH460463 Dickeya phage vB_DsoM_AD1, complete genome 98992-99023 9 0.719
NZ_CP014034_2 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860965-860996 32 MN693807 Marine virus AFVG_250M375, complete genome 40833-40864 9 0.719
NZ_CP014034_2 2.8|860305|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860305-860336 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1287163-1287194 10 0.688
NZ_CP014034_2 2.10|860425|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860425-860456 32 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 124612-124643 10 0.688
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 NZ_CP028563 Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p2_045096, complete sequence 7334-7365 10 0.688
NZ_CP014034_2 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860845-860876 32 NZ_CP016173 Bordetella flabilis strain AU10664 plasmid unnamed1, complete sequence 71143-71174 10 0.688
NZ_CP014034_2 2.8|860305|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder 860305-860336 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1177209-1177240 11 0.656

1. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545746 (Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

2. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545746 (Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

3. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545746 (Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

4. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664577 (Vibrio phage CTX transgenic isolate recombinant pCTX1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), and Kan (kan) genes, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

5. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ434666 (Vibrio phage CTX RstC (rstC) gene, partial cds; and RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

6. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664574 (Vibrio phage CTX transgenic isolate CTX-RS1 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

7. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466611 (Vibrio phage CTX strain IB1617 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), and RstR (rstR) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

8. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466611 (Vibrio phage CTX strain IB1617 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), and RstR (rstR) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

9. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ540271 (Vibrio phage CTX plasmid pCTX-5 Kan, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

10. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GU942563 (Vibrio phage CTX chromosome I prophage, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

11. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GU942563 (Vibrio phage CTX chromosome I prophage, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

12. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GU942563 (Vibrio phage CTX chromosome I prophage, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

13. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GU942563 (Vibrio phage CTX chromosome I prophage, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

14. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485654 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

15. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485654 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

16. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AB428550 (Vibrio phage CTX ctxB, hp1, rstR, rstA, and rstB genes for cholera toxin B subunit, hypothetical protein, transcriptional repressor RstR, RstA and RstB proteins, partial and complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

17. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KM352500 (Vibrio phage CTX strain 81, partial genome) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

18. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_015209 (Vibrio phage CTX chromosome I, complete genome) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

19. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_015209 (Vibrio phage CTX chromosome I, complete genome) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

20. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485650 (Vibrio phage CTX strain IB4322 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

21. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485650 (Vibrio phage CTX strain IB4322 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

22. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664572 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

23. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449748 (Vibrio phage CTX strain E1781 RstR (rstR) gene, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

24. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664580 (Vibrio phage CTX transgenic plasmid pCTX-1-1kan, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

25. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664575 (Vibrio phage CTX transgenic isolate recombinant CTX1 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

26. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466609 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

27. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466609 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

28. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466610 (Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

29. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466610 (Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

30. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545745 (Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

31. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545745 (Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

32. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545745 (Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

33. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ499847 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), Ace (ace), ZOT (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds; and unknown gene) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

34. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to DQ012295 (Vibrio phage CTX CtxB (ctxB) gene, partial cds; RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

35. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485644 (Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

36. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485644 (Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

37. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449741 (Vibrio phage CTX strain 07.95vp CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

38. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664567 (Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

39. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664567 (Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

40. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449743 (Vibrio phage CTX strain MG116926 RstR (rstR) gene, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

41. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ619459 (Vibrio phage CTX, complete genome) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

42. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449744 (Vibrio phage CTX strain MG116926 CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

43. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485653 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

44. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485653 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

45. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664568 (Vibrio phage CTX isolate recombinant CTX-RS1 plasmid pCTX-1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

46. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664568 (Vibrio phage CTX isolate recombinant CTX-RS1 plasmid pCTX-1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

47. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466612 (Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

48. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466612 (Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

49. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485649 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

50. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485649 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

51. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ540270 (Vibrio phage CTX plasmid pCTX-3 Kan, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

52. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485646 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

53. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485646 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

54. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545744 (Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

55. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545744 (Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

56. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545744 (Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

57. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MF155889 (Vibrio virus CTXphi, complete genome) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

58. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664579 (Vibrio phage CTX transgenic plasmid pCTX-1kan, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

59. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ540269 (Vibrio phage CTX plasmid pCTX1*Kan, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

60. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485652 (Vibrio phage CTX strain 01.07vp RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

61. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485652 (Vibrio phage CTX strain 01.07vp RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

62. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449738 (Vibrio phage CTX strain 07.95vp RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

63. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485648 (Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

64. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485648 (Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

65. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449752 (Vibrio phage CTX strain IB4642 RstC (rstC) gene, partial cds; RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

66. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664578 (Vibrio phage CTX transgenic plasmid pCTX3 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), and Kan (kan) genes, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

67. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664581 (Vibrio phage CTX transgenic plasmid pCTX-3kan, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

68. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449751 (Vibrio phage CTX strain IB4642 RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

69. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449747 (Vibrio phage CTX strain E1781 RstC (rstC) gene, partial cds; and RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

70. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449749 (Vibrio phage CTX strain E1781 CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

71. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664566 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

72. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664566 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

73. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664566 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

74. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ540272 (Vibrio phage CTX plasmid pCTX-6 Kan, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

75. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485651 (Vibrio phage CTX strain IB4642 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

76. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485651 (Vibrio phage CTX strain IB4642 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

77. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KT728931 (Vibrio phage pre-CTX, complete genome) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

78. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to HQ224500 (Vibrio phage CTX, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

79. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to HQ224500 (Vibrio phage CTX, complete sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

80. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485645 (Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

81. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485645 (Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

82. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449746 (Vibrio phage CTX strain E1781 RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

83. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466608 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

84. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466608 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

85. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466608 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

86. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485647 (Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

87. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485647 (Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

88. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ434665 (Vibrio phage CTX RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

89. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664573 (Vibrio phage CTX transgenic isolate recombinant PM7 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

90. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AY145126 (Vibrio phage CTX RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds) position: , mismatch: 0, identity: 1.0

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa	Protospacer
********************************

91. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MN200778 (Vibrio phage VAI1, complete genome) position: , mismatch: 1, identity: 0.969

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacac	Protospacer
******************************* 

92. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MN200777 (Vibrio phage VAI2, complete genome) position: , mismatch: 1, identity: 0.969

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgaatacac	Protospacer
******************************* 

93. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AF416590 (Vibrio phage CTX core region Cep (cep), OrfU (orfU), Ace (ace), and Zot (zot) genes, complete cds and Vibrio cholerae serogroup 0139, partial sequence) position: , mismatch: 1, identity: 0.969

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgctaatacaa	Protospacer
************************ *******

94. spacer 2.7|860245|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 5, identity: 0.844

-tcggtcgcaggcttgctcccttatccctgcgg	CRISPR spacer
agaggtcgc-ggcttgctcccttctccccgcgg	Protospacer
   ****** ************* ****.****

95. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AF416590 (Vibrio phage CTX core region Cep (cep), OrfU (orfU), Ace (ace), and Zot (zot) genes, complete cds and Vibrio cholerae serogroup 0139, partial sequence) position: , mismatch: 5, identity: 0.844

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgattgcgaagtcct	Protospacer
******************* *******  *  

96. spacer 2.14|860665|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015744 (Shinella sp. HZN7 plasmid pShin-08, complete sequence) position: , mismatch: 6, identity: 0.812

tcgtaatccggttcacgtcgttcgacttcata-	CRISPR spacer
tcgtcatcaggttcacgtcgttc-tcgacatag	Protospacer
**** *** **************  *  **** 

97. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_001956 (Vibrio phage fs2, complete genome) position: , mismatch: 6, identity: 0.812

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgttacccc	Protospacer
*************************    *  

98. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AB002632 (Vibrio phage fs2 DNA, complete genome) position: , mismatch: 6, identity: 0.812

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactggcgcgctacgcttgcgttacccc	Protospacer
*************************    *  

99. spacer 2.5|860125|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017104 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872c, complete sequence) position: , mismatch: 8, identity: 0.75

cattgggttttgatgtagtcctgcaggtattt	CRISPR spacer
ggttgggttttgaggtattcctgcaggaagcg	Protospacer
 .*********** *** ********* * . 

100. spacer 2.10|860425|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MN034288 (Leviviridae sp. isolate H4_Bulk_47_scaffold_485 RNA-dependent RNA polymerase (H4Bulk47485_000001) and hypothetical protein (H4Bulk47485_000002) genes, complete cds; and hypothetical protein (H4Bulk47485_000003) gene, partial cds) position: , mismatch: 8, identity: 0.75

atcgatacgcttggcaaccgttatgttgggct	CRISPR spacer
atcgatacggttggcaaccgctagtttactcc	Protospacer
********* **********.**  **.  *.

101. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

102. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

103. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

104. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

105. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

106. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

107. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

108. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

109. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

110. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

111. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

112. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

113. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

114. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040343 (Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

115. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

116. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

--ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt	Protospacer
  *..*** ..*  **************.*****

117. spacer 2.4|860065|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MH460463 (Dickeya phage vB_DsoM_AD1, complete genome) position: , mismatch: 9, identity: 0.719

tttcaatcaccgtcaccacttcttttgattgc	CRISPR spacer
tgatttgcaccgtggccacttcttttgatttc	Protospacer
*  .   ****** .*************** *

118. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MN693807 (Marine virus AFVG_250M375, complete genome) position: , mismatch: 9, identity: 0.719

ggctacgcatggatatgtggaaaaaacaaagt	CRISPR spacer
ggaactctttggatgtgtggaaaaaacaatgt	Protospacer
**   . . *****.************** **

119. spacer 2.8|860305|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

aaacgaatcaagtccgtcgccagcgacgaaaa	CRISPR spacer
gcaagaatcaactccatcgccagcgacatccg	Protospacer
. * ******* ***.***********.   .

120. spacer 2.10|860425|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 10, identity: 0.688

atcgatacgcttggcaaccgttatgttgggct	CRISPR spacer
gccgatgcgcttggcaacctttatgtctcagc	Protospacer
..****.************ ******.  . .

121. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028563 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p2_045096, complete sequence) position: , mismatch: 10, identity: 0.688

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
aaaaaactgccgcgctacgcttgccgcctccc	Protospacer
 *** **** ************** . . *  

122. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016173 (Bordetella flabilis strain AU10664 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

caaacactggcgcgctacgcttgcgaatacaa	CRISPR spacer
caaacactgacgcgctccgcttgtcggcccct	Protospacer
*********.****** ******. ... *  

123. spacer 2.8|860305|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 11, identity: 0.656

aaacgaatcaagtccgtcgccagcgacgaaaa	CRISPR spacer
ggtgccttcaagtccgtcgccggcggcgaact	Protospacer
..     **************.***.****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 527167 : 561794 47 Vibrio_phage(20.0%) head,integrase,tail,portal,terminase,capsid,plate attL 525134:525176|attR 561892:561934
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014035
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014035_1 709944-710094 Unclear NA
2 spacers
cas6f,cas7f,cas5f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014035_1 1.1|709975|29|NZ_CP014035|PILER-CR 709975-710003 29 NZ_CP046854 Vibrio fluvialis strain F8658 plasmid unnamed1, complete sequence 34357-34385 0 1.0
NZ_CP014035_1 1.3|709974|32|NZ_CP014035|CRISPRCasFinder 709974-710005 32 NZ_CP046854 Vibrio fluvialis strain F8658 plasmid unnamed1, complete sequence 34355-34386 0 1.0
NZ_CP014035_1 1.1|709975|29|NZ_CP014035|PILER-CR 709975-710003 29 MN694290 Marine virus AFVG_250M636, complete genome 36357-36385 5 0.828
NZ_CP014035_1 1.3|709974|32|NZ_CP014035|CRISPRCasFinder 709974-710005 32 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 334124-334155 10 0.688

1. spacer 1.1|709975|29|NZ_CP014035|PILER-CR matches to NZ_CP046854 (Vibrio fluvialis strain F8658 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggagcttttttgccgcaaaactggcagc	CRISPR spacer
tggagcttttttgccgcaaaactggcagc	Protospacer
*****************************

2. spacer 1.3|709974|32|NZ_CP014035|CRISPRCasFinder matches to NZ_CP046854 (Vibrio fluvialis strain F8658 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttggagcttttttgccgcaaaactggcagctt	CRISPR spacer
ttggagcttttttgccgcaaaactggcagctt	Protospacer
********************************

3. spacer 1.1|709975|29|NZ_CP014035|PILER-CR matches to MN694290 (Marine virus AFVG_250M636, complete genome) position: , mismatch: 5, identity: 0.828

tggagcttttttgccgcaaaactggcagc	CRISPR spacer
ttgggcatttttgccccaaaactggcacc	Protospacer
* *.** ******** *********** *

4. spacer 1.3|709974|32|NZ_CP014035|CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 10, identity: 0.688

ttggagcttttttgccgcaaaactggcagctt	CRISPR spacer
gcaccccgtttttgccgcaaaacgggtagctc	Protospacer
 ..   * *************** **.****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 320427 : 326971 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 1261695 : 1271212 11 Vibrio_phage(90.0%) NA NA
DBSCAN-SWA_3 2052598 : 2059646 9 Megavirus(16.67%) NA NA
DBSCAN-SWA_4 2270956 : 2282062 9 uncultured_Mediterranean_phage(25.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage