Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014306 Burkholderia sp. PAMC 26561 chromosome 1, complete sequence 2 crisprs csa3,DEDDh,PD-DExK,cas3,cas2,cas1,cas4,cas7,cas8c,cas5,RT,DinG 0 24 3 0
NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 1 crisprs RT 0 1 0 0
NZ_CP014308 Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP014310 Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence 0 crisprs RT,WYL 0 0 24 0
NZ_CP014307 Burkholderia sp. PAMC 26561 chromosome 2, complete sequence 0 crisprs cas3,csa3,DinG 0 0 1 0
NZ_CP014312 Burkholderia sp. PAMC 26561 plasmid unnamed5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014309 Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 3 0

Results visualization

1. NZ_CP014309
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 314919 : 359135 31 Bacillus_virus(25.0%) integrase,transposase attL 321252:321266|attR 360726:360740
DBSCAN-SWA_2 651022 : 666382 13 Acidithiobacillus_phage(50.0%) transposase NA
DBSCAN-SWA_3 694762 : 739416 41 Acidithiobacillus_phage(18.18%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014308
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 93408 : 184113 75 Acidithiobacillus_phage(18.75%) transposase NA
DBSCAN-SWA_2 394265 : 479538 59 Vibrio_phage(25.0%) integrase,transposase attL 406996:407011|attR 481443:481458
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP014311
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014311_1 151292-151379 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014311_1 1.1|151323|26|NZ_CP014311|CRISPRCasFinder 151323-151348 26 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 151323-151348 0 1.0

1. spacer 1.1|151323|26|NZ_CP014311|CRISPRCasFinder matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagcaaactgacagccagcatgctt	CRISPR spacer
ccagcaaactgacagccagcatgctt	Protospacer
**************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP014306
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014306_1 1344786-1347425 TypeI I-C
39 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014306_2 1355626-1358636 TypeI NA
45 spacers
cas3,cas5,cas8c,cas7,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014306_1 1.10|1345418|35|NZ_CP014306|CRISPRCasFinder,CRT 1345418-1345452 35 NZ_CP022483 Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence 93870-93904 6 0.829
NZ_CP014306_1 1.10|1345418|35|NZ_CP014306|CRISPRCasFinder,CRT 1345418-1345452 35 NZ_CP022767 Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence 104040-104074 6 0.829
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 369937-369970 6 0.824
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 262485-262518 6 0.824
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 183885-183918 6 0.824
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 437962-437995 6 0.824
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 233008-233041 6 0.824
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 368782-368815 6 0.824
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 261741-261774 6 0.824
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 288712-288745 6 0.824
NZ_CP014306_1 1.15|1345751|33|NZ_CP014306|CRISPRCasFinder,CRT 1345751-1345783 33 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 1347280-1347312 7 0.788
NZ_CP014306_1 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT 1346953-1346985 33 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 348584-348616 7 0.788
NZ_CP014306_1 1.45|1345417|36|NZ_CP014306|PILER-CR 1345417-1345452 36 NZ_CP022483 Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence 93870-93905 7 0.806
NZ_CP014306_1 1.45|1345417|36|NZ_CP014306|PILER-CR 1345417-1345452 36 NZ_CP022767 Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence 104039-104074 7 0.806
NZ_CP014306_1 1.68|1346955|34|NZ_CP014306|PILER-CR 1346955-1346988 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 348583-348616 7 0.794
NZ_CP014306_1 1.3|1344953|33|NZ_CP014306|CRISPRCasFinder,CRT 1344953-1344985 33 NZ_CP036222 Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed2, complete sequence 11550-11582 8 0.758
NZ_CP014306_1 1.3|1344953|33|NZ_CP014306|CRISPRCasFinder,CRT 1344953-1344985 33 NZ_CP009406 Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p18K, complete sequence 9209-9241 8 0.758
NZ_CP014306_1 1.4|1345018|33|NZ_CP014306|CRISPRCasFinder,CRT 1345018-1345050 33 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 59953-59985 8 0.758
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 650829-650860 8 0.75
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_HG917973 Mycobacterium marinum E11 plasmid pRAW, complete sequence 70952-70983 8 0.75
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_AP018497 Mycobacterium marinum strain ATCC 927 plasmid pMMRN, complete sequence 19175-19206 8 0.75
NZ_CP014306_1 1.50|1345750|34|NZ_CP014306|PILER-CR 1345750-1345783 34 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 1347280-1347313 8 0.765
NZ_CP014306_1 1.67|1346891|33|NZ_CP014306|PILER-CR 1346891-1346923 33 NZ_HG917973 Mycobacterium marinum E11 plasmid pRAW, complete sequence 70952-70984 8 0.758
NZ_CP014306_1 1.67|1346891|33|NZ_CP014306|PILER-CR 1346891-1346923 33 NZ_AP018497 Mycobacterium marinum strain ATCC 927 plasmid pMMRN, complete sequence 19175-19207 8 0.758
NZ_CP014306_1 1.68|1346955|34|NZ_CP014306|PILER-CR 1346955-1346988 34 NZ_CP010420 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence 115586-115619 8 0.765
NZ_CP014306_1 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT 1346425-1346458 34 NZ_CP018468 Xanthomonas vesicatoria strain LM159 plasmid pLM159.1, complete sequence 53958-53991 9 0.735
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 MN033156 Leviviridae sp. isolate H1_Bulk_28_FD_scaffold_73 hypothetical protein (H1Bulk28FD73_000001) gene, partial cds; and hypothetical protein (H1Bulk28FD73_000002), hypothetical protein (H1Bulk28FD73_000003), hypothetical protein (H1Bulk28FD73_000004), hypothetical protein (H1Bulk28FD73_000005), and RNA-dependent RNA polymerase (H1Bulk28FD73_000006) genes, complete cds 317-348 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 661718-661749 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP015268 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence 25454-25485 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 681195-681226 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 55497-55528 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 1007556-1007587 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 938470-938501 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 729254-729285 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1004895-1004926 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 280396-280427 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP043850 Micrococcus luteus strain NCCP 15687 plasmid unnamed, complete sequence 60407-60438 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 887092-887123 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1678728-1678759 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1362460-1362491 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 384633-384664 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1272671-1272702 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 400812-400843 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 814808-814839 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1602254-1602285 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 1360198-1360229 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 128790-128821 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 887205-887236 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1646386-1646417 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 524869-524900 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 875099-875130 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 1075810-1075841 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 853710-853741 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 626197-626228 9 0.719
NZ_CP014306_1 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT 1346889-1346920 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 661719-661750 9 0.719
NZ_CP014306_2 2.5|1355918|33|NZ_CP014306|CRISPRCasFinder,CRT 1355918-1355950 33 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 78570-78602 9 0.727
NZ_CP014306_2 2.6|1355982|34|NZ_CP014306|CRISPRCasFinder,CRT 1355982-1356015 34 NC_015724 Cupriavidus necator N-1 plasmid pBB2, complete sequence 189918-189951 9 0.735
NZ_CP014306_2 2.14|1356510|35|NZ_CP014306|CRISPRCasFinder,CRT 1356510-1356544 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 685509-685543 9 0.743
NZ_CP014306_2 2.49|1355919|33|NZ_CP014306|PILER-CR 1355919-1355951 33 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 78570-78602 9 0.727
NZ_CP014306_2 2.50|1355983|34|NZ_CP014306|PILER-CR 1355983-1356016 34 NC_015724 Cupriavidus necator N-1 plasmid pBB2, complete sequence 189918-189951 9 0.735
NZ_CP014306_2 2.58|1356511|35|NZ_CP014306|PILER-CR 1356511-1356545 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 685509-685543 9 0.743
NZ_CP014306_1 1.13|1345618|33|NZ_CP014306|CRISPRCasFinder,CRT 1345618-1345650 33 NZ_CP032858 Bacillus subtilis subsp. subtilis strain 2RL2-3 plasmid unnamed1, complete sequence 107682-107714 10 0.697
NZ_CP014306_1 1.13|1345618|33|NZ_CP014306|CRISPRCasFinder,CRT 1345618-1345650 33 NZ_CP032873 Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence 128720-128752 10 0.697
NZ_CP014306_1 1.30|1346758|34|NZ_CP014306|CRISPRCasFinder,CRT 1346758-1346791 34 NZ_CP022563 Pseudomonas monteilii strain B5 plasmid pSH5-1, complete sequence 102701-102734 10 0.706
NZ_CP014306_1 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT 1346953-1346985 33 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 14567-14599 10 0.697
NZ_CP014306_1 1.67|1346891|33|NZ_CP014306|PILER-CR 1346891-1346923 33 MN033156 Leviviridae sp. isolate H1_Bulk_28_FD_scaffold_73 hypothetical protein (H1Bulk28FD73_000001) gene, partial cds; and hypothetical protein (H1Bulk28FD73_000002), hypothetical protein (H1Bulk28FD73_000003), hypothetical protein (H1Bulk28FD73_000004), hypothetical protein (H1Bulk28FD73_000005), and RNA-dependent RNA polymerase (H1Bulk28FD73_000006) genes, complete cds 316-348 10 0.697
NZ_CP014306_1 1.68|1346955|34|NZ_CP014306|PILER-CR 1346955-1346988 34 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 14566-14599 10 0.706
NZ_CP014306_2 2.6|1355982|34|NZ_CP014306|CRISPRCasFinder,CRT 1355982-1356015 34 NZ_CP044550 Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence 157673-157706 10 0.706
NZ_CP014306_2 2.14|1356510|35|NZ_CP014306|CRISPRCasFinder,CRT 1356510-1356544 35 NZ_CP010866 Marinovum algicola DG 898 plasmid pMaD11, complete sequence 4182-4216 10 0.714
NZ_CP014306_2 2.33|1357776|35|NZ_CP014306|CRISPRCasFinder,CRT 1357776-1357810 35 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 26644-26678 10 0.714
NZ_CP014306_2 2.50|1355983|34|NZ_CP014306|PILER-CR 1355983-1356016 34 NZ_CP044550 Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence 157673-157706 10 0.706
NZ_CP014306_2 2.58|1356511|35|NZ_CP014306|PILER-CR 1356511-1356545 35 NZ_CP010866 Marinovum algicola DG 898 plasmid pMaD11, complete sequence 4182-4216 10 0.714
NZ_CP014306_2 2.77|1357777|35|NZ_CP014306|PILER-CR 1357777-1357811 35 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 26644-26678 10 0.714
NZ_CP014306_1 1.6|1345150|35|NZ_CP014306|CRISPRCasFinder,CRT 1345150-1345184 35 NC_017078 Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC1, complete sequence 83406-83440 11 0.686
NZ_CP014306_1 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT 1346953-1346985 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 877755-877787 11 0.667
NZ_CP014306_1 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT 1346953-1346985 33 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 328637-328669 11 0.667
NZ_CP014306_1 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT 1346953-1346985 33 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 456132-456164 11 0.667
NZ_CP014306_1 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT 1346953-1346985 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1254623-1254655 11 0.667
NZ_CP014306_1 1.34|1347018|34|NZ_CP014306|CRISPRCasFinder,CRT 1347018-1347051 34 NZ_AP017379 Desulfovibrio ferrophilus strain IS5 plasmid pDFE, complete sequence 2583-2616 11 0.676
NZ_CP014306_1 1.48|1345617|34|NZ_CP014306|PILER-CR 1345617-1345650 34 NZ_CP032858 Bacillus subtilis subsp. subtilis strain 2RL2-3 plasmid unnamed1, complete sequence 107681-107714 11 0.676
NZ_CP014306_1 1.48|1345617|34|NZ_CP014306|PILER-CR 1345617-1345650 34 NZ_CP032873 Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence 128719-128752 11 0.676
NZ_CP014306_1 1.68|1346955|34|NZ_CP014306|PILER-CR 1346955-1346988 34 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 877755-877788 11 0.676
NZ_CP014306_1 1.68|1346955|34|NZ_CP014306|PILER-CR 1346955-1346988 34 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1254622-1254655 11 0.676
NZ_CP014306_2 2.14|1356510|35|NZ_CP014306|CRISPRCasFinder,CRT 1356510-1356544 35 NC_011737 Gloeothece citriformis PCC 7424 plasmid pP742402, complete sequence 185577-185611 11 0.686
NZ_CP014306_2 2.58|1356511|35|NZ_CP014306|PILER-CR 1356511-1356545 35 NC_011737 Gloeothece citriformis PCC 7424 plasmid pP742402, complete sequence 185577-185611 11 0.686
NZ_CP014306_1 1.68|1346955|34|NZ_CP014306|PILER-CR 1346955-1346988 34 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 328636-328669 12 0.647
NZ_CP014306_1 1.68|1346955|34|NZ_CP014306|PILER-CR 1346955-1346988 34 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 456131-456164 12 0.647

1. spacer 1.10|1345418|35|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 6, identity: 0.829

aacgcgttgaccagcagcagcccgtgggttactcc	CRISPR spacer
aacgcgtcgaccagcagcaggccgtggctgaaccc	Protospacer
*******.************ ****** * * .**

2. spacer 1.10|1345418|35|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 6, identity: 0.829

aacgcgttgaccagcagcagcccgtgggttactcc	CRISPR spacer
aacgcgtcgaccagcagcaggccgtggctgaaccc	Protospacer
*******.************ ****** * * .**

3. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.824

cggcggaacaccaatcagggtcgcgacgctgcag-	CRISPR spacer
cagcggcacgccaatcagggtcgcgac-cgtcagt	Protospacer
*.**** **.***************** *  *** 

4. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 6, identity: 0.824

cggcggaacaccaatcagggtcgcgacgctgcag-	CRISPR spacer
cagcggtacaccaatcagggtcgctac-cgtcagt	Protospacer
*.**** ***************** ** *  *** 

5. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

cggcggaacaccaatcagggtcgcgacgctgcag-	CRISPR spacer
cagcggcacaccaatcagggtcgctac-cgtcagt	Protospacer
*.**** ***************** ** *  *** 

6. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 6, identity: 0.824

cggcggaacaccaatcagggtcgcgacgctgcag-	CRISPR spacer
cagcggtacaccaatcagggtcgctac-cgtcagt	Protospacer
*.**** ***************** ** *  *** 

7. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 6, identity: 0.824

cggcggaacaccaatcagggtcgcgacgctgcag-	CRISPR spacer
cagcggtacaccaatcagggtcgccac-cgtcagt	Protospacer
*.**** ***************** ** *  *** 

8. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 6, identity: 0.824

cggcggaacaccaatcagggtcgcgacgctgcag-	CRISPR spacer
cagcggtacaccaatcagggtcgctac-cgtcagt	Protospacer
*.**** ***************** ** *  *** 

9. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

cggcggaacaccaatcagggtcgcgacgctgcag-	CRISPR spacer
cagcggcacaccaatcagggtcgccac-cgtcagt	Protospacer
*.**** ***************** ** *  *** 

10. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

cggcggaacaccaatcagggtcgcgacgctgcag-	CRISPR spacer
cagcggcacgccaatcagggtcgcgac-cgtcagt	Protospacer
*.**** **.***************** *  *** 

11. spacer 1.15|1345751|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 7, identity: 0.788

cttcggtttcgaaccgtttaaagaagagtggtc	CRISPR spacer
attcggtatcgaagcgtttaaagaagaaggtac	Protospacer
 ****** ***** *************. *  *

12. spacer 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.788

aacccgtcggacgcctcgatcgcgccggctact-	CRISPR spacer
gacctgtcggtcgcctcgatcgcg-cggctgtcc	Protospacer
.***.***** ************* *****... 

13. spacer 1.45|1345417|36|NZ_CP014306|PILER-CR matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 7, identity: 0.806

caacgcgttgaccagcagcagcccgtgggttactcc	CRISPR spacer
gaacgcgtcgaccagcagcaggccgtggctgaaccc	Protospacer
 *******.************ ****** * * .**

14. spacer 1.45|1345417|36|NZ_CP014306|PILER-CR matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 7, identity: 0.806

caacgcgttgaccagcagcagcccgtgggttactcc	CRISPR spacer
gaacgcgtcgaccagcagcaggccgtggctgaaccc	Protospacer
 *******.************ ****** * * .**

15. spacer 1.68|1346955|34|NZ_CP014306|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.794

caacccgtcggacgcctcgatcgcgccggctact-	CRISPR spacer
cgacctgtcggtcgcctcgatcgcg-cggctgtcc	Protospacer
*.***.***** ************* *****... 

16. spacer 1.3|1344953|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP036222 (Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

gcgtggcgccggcggcaacgtgtacggcacgtg	CRISPR spacer
cggcggcgccggcggcatcgcgtacggccccgg	Protospacer
  *.************* **.******* *  *

17. spacer 1.3|1344953|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP009406 (Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p18K, complete sequence) position: , mismatch: 8, identity: 0.758

gcgtggcgccggcggcaacgtgtacggcacgtg	CRISPR spacer
cggcggcgccggcggcatcgcgtacggccccgg	Protospacer
  *.************* **.******* *  *

18. spacer 1.4|1345018|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 8, identity: 0.758

gtcgactacccccaagacgggttggcgttgaaa	CRISPR spacer
gtcgacgacccccaagacgggctgagattggcg	Protospacer
****** **************.**. .***. .

19. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaacacctcgccgtggccgacctc	Protospacer
  .***********.***********  * .*

20. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_HG917973 (Mycobacterium marinum E11 plasmid pRAW, complete sequence) position: , mismatch: 8, identity: 0.75

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
atcaccacaaacacatcgccgtggccgtcgtc	Protospacer
 . .* ******** *********** ***.*

21. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_AP018497 (Mycobacterium marinum strain ATCC 927 plasmid pMMRN, complete sequence) position: , mismatch: 8, identity: 0.75

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
atcaccacaaacacatcgccgtggccgtcgtc	Protospacer
 . .* ******** *********** ***.*

22. spacer 1.50|1345750|34|NZ_CP014306|PILER-CR matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 8, identity: 0.765

ccttcggtttcgaaccgtttaaagaagagtggtc	CRISPR spacer
tattcggtatcgaagcgtttaaagaagaaggtac	Protospacer
. ****** ***** *************. *  *

23. spacer 1.67|1346891|33|NZ_CP014306|PILER-CR matches to NZ_HG917973 (Mycobacterium marinum E11 plasmid pRAW, complete sequence) position: , mismatch: 8, identity: 0.758

gtcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
gatcaccacaaacacatcgccgtggccgtcgtc	Protospacer
* . .* ******** *********** ***.*

24. spacer 1.67|1346891|33|NZ_CP014306|PILER-CR matches to NZ_AP018497 (Mycobacterium marinum strain ATCC 927 plasmid pMMRN, complete sequence) position: , mismatch: 8, identity: 0.758

gtcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
gatcaccacaaacacatcgccgtggccgtcgtc	Protospacer
* . .* ******** *********** ***.*

25. spacer 1.68|1346955|34|NZ_CP014306|PILER-CR matches to NZ_CP010420 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence) position: , mismatch: 8, identity: 0.765

caacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
caacgcttcggacgcctcgatcgcctaggccagc	Protospacer
**** * ***************** . ***.* .

26. spacer 1.25|1346425|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP018468 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.1, complete sequence) position: , mismatch: 9, identity: 0.735

cggcggaacaccaatcagggtcgcgacgctgcag	CRISPR spacer
cggcggaacaccaatcacagtcgccgagatgggt	Protospacer
***************** .***** . * ** . 

27. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to MN033156 (Leviviridae sp. isolate H1_Bulk_28_FD_scaffold_73 hypothetical protein (H1Bulk28FD73_000001) gene, partial cds; and hypothetical protein (H1Bulk28FD73_000002), hypothetical protein (H1Bulk28FD73_000003), hypothetical protein (H1Bulk28FD73_000004), hypothetical protein (H1Bulk28FD73_000005), and RNA-dependent RNA polymerase (H1Bulk28FD73_000006) genes, complete cds) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
agatcgtcaaacacgtcgccgtggccttgagg	Protospacer
  * ** ******* ************* .  

28. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

29. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
atcaccacaaacacatcgccgtggccgtcatc	Protospacer
 . .* ******** *********** **..*

30. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

31. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
atcaccacaaacacatcgccgtggccgtcatc	Protospacer
 . .* ******** *********** **..*

32. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

33. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

34. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

35. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

36. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

37. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP043850 (Micrococcus luteus strain NCCP 15687 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
cgcaggcccaacacttcgcggtggccgtcgcc	Protospacer
.  . * * ********** ****** *****

38. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

39. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

40. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

41. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

42. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

43. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

44. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

45. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

46. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

47. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

48. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

49. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

50. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

51. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

52. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

53. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

54. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

55. spacer 1.32|1346889|32|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aaggcgacaaagacgtcgccgtggccgacctc	Protospacer
  .******** ** ***********  * .*

56. spacer 2.5|1355918|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.727

tgtgacgtgcatctccaggcgacgggctggatc	CRISPR spacer
ccggacgggcatctccaggcgaccggccgcgac	Protospacer
.  **** *************** ***.* . *

57. spacer 2.6|1355982|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 9, identity: 0.735

tggatcaatcggcgcgcgagttgaatgcggcgct	CRISPR spacer
tatcgaaacaggcgcgcgagttgaaggcggcact	Protospacer
*.    **. *************** *****.**

58. spacer 2.14|1356510|35|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agggcaagagtggcgatgacgagtgttttcatggc------	CRISPR spacer
agggcaagagtgccggtgacgagtg------cggcggaacg	Protospacer
************ **.*********      .***      

59. spacer 2.49|1355919|33|NZ_CP014306|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.727

tgtgacgtgcatctccaggcgacgggctggatc	CRISPR spacer
ccggacgggcatctccaggcgaccggccgcgac	Protospacer
.  **** *************** ***.* . *

60. spacer 2.50|1355983|34|NZ_CP014306|PILER-CR matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 9, identity: 0.735

tggatcaatcggcgcgcgagttgaatgcggcgct	CRISPR spacer
tatcgaaacaggcgcgcgagttgaaggcggcact	Protospacer
*.    **. *************** *****.**

61. spacer 2.58|1356511|35|NZ_CP014306|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agggcaagagtggcgatgacgagtgttttcatggc------	CRISPR spacer
agggcaagagtgccggtgacgagtg------cggcggaacg	Protospacer
************ **.*********      .***      

62. spacer 1.13|1345618|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP032858 (Bacillus subtilis subsp. subtilis strain 2RL2-3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

catagatagcgtcgatcttttcgagtgcacgca	CRISPR spacer
catatatagcgttgatcttttcgatggtggttg	Protospacer
**** *******.***********  *..  ..

63. spacer 1.13|1345618|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP032873 (Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

catagatagcgtcgatcttttcgagtgcacgca	CRISPR spacer
catatatagcgttgatcttttcgatggtggttg	Protospacer
**** *******.***********  *..  ..

64. spacer 1.30|1346758|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP022563 (Pseudomonas monteilii strain B5 plasmid pSH5-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggatattccgactgccgcggcttcgtcttcggac	CRISPR spacer
cgcagtagggacggccgcggcttcatcttcggat	Protospacer
 *  .*   *** ***********.********.

65. spacer 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

aacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
gcgccgtcgagcgcctcgatcgcgccgatcgcc	Protospacer
.  ******..****************....*.

66. spacer 1.67|1346891|33|NZ_CP014306|PILER-CR matches to MN033156 (Leviviridae sp. isolate H1_Bulk_28_FD_scaffold_73 hypothetical protein (H1Bulk28FD73_000001) gene, partial cds; and hypothetical protein (H1Bulk28FD73_000002), hypothetical protein (H1Bulk28FD73_000003), hypothetical protein (H1Bulk28FD73_000004), hypothetical protein (H1Bulk28FD73_000005), and RNA-dependent RNA polymerase (H1Bulk28FD73_000006) genes, complete cds) position: , mismatch: 10, identity: 0.697

gtcagcgacaaacacttcgccgtggccttcgcc	CRISPR spacer
aagatcgtcaaacacgtcgccgtggccttgagg	Protospacer
.  * ** ******* ************* .  

67. spacer 1.68|1346955|34|NZ_CP014306|PILER-CR matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

caacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
cgcgccgtcgagcgcctcgatcgcgccgatcgcc	Protospacer
*.  ******..****************....*.

68. spacer 2.6|1355982|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP044550 (Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence) position: , mismatch: 10, identity: 0.706

tggatcaatcggcgcgcgagttgaatgcggcgct	CRISPR spacer
tcttgcgtgcggcgcgcgagttgaaggcggagcg	Protospacer
*    *.  **************** **** ** 

69. spacer 2.14|1356510|35|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP010866 (Marinovum algicola DG 898 plasmid pMaD11, complete sequence) position: , mismatch: 10, identity: 0.714

agggcaagagtggcgatgacgagtgttttcatggc	CRISPR spacer
cctttctgagcggcgatgacgagcgttttcatggg	Protospacer
    .  ***.************.********** 

70. spacer 2.33|1357776|35|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 10, identity: 0.714

cctgaggtgtggatcgcggcggccagcatcgaatc	CRISPR spacer
atgttcgtgcggatcgcggcggccagcatcgatat	Protospacer
 .    ***.**********************  .

71. spacer 2.50|1355983|34|NZ_CP014306|PILER-CR matches to NZ_CP044550 (Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence) position: , mismatch: 10, identity: 0.706

tggatcaatcggcgcgcgagttgaatgcggcgct	CRISPR spacer
tcttgcgtgcggcgcgcgagttgaaggcggagcg	Protospacer
*    *.  **************** **** ** 

72. spacer 2.58|1356511|35|NZ_CP014306|PILER-CR matches to NZ_CP010866 (Marinovum algicola DG 898 plasmid pMaD11, complete sequence) position: , mismatch: 10, identity: 0.714

agggcaagagtggcgatgacgagtgttttcatggc	CRISPR spacer
cctttctgagcggcgatgacgagcgttttcatggg	Protospacer
    .  ***.************.********** 

73. spacer 2.77|1357777|35|NZ_CP014306|PILER-CR matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 10, identity: 0.714

cctgaggtgtggatcgcggcggccagcatcgaatc	CRISPR spacer
atgttcgtgcggatcgcggcggccagcatcgatat	Protospacer
 .    ***.**********************  .

74. spacer 1.6|1345150|35|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_017078 (Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC1, complete sequence) position: , mismatch: 11, identity: 0.686

gcaatgtgctggcgtatgttgacatacctagacag	CRISPR spacer
aacatgtgctgtcgtttgttgacataccggagatg	Protospacer
.  ******** *** ************ ...  *

75. spacer 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.667

aacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
cgaccgtcgaacgcctcgaccgcgccgagacgc	Protospacer
 . ******.*********.*******.    .

76. spacer 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 11, identity: 0.667

aacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
tcgccgtcgaacgcctcgatcgcgacgcgggag	Protospacer
   ******.************** **   .  

77. spacer 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 11, identity: 0.667

aacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
tcgccgtcgaacgcctcgatcgcgacgcgggag	Protospacer
   ******.************** **   .  

78. spacer 1.33|1346953|33|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 11, identity: 0.667

aacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
cgaccgtcgaacgcctcgaccgcgccgagacgc	Protospacer
 . ******.*********.*******.    .

79. spacer 1.34|1347018|34|NZ_CP014306|CRISPRCasFinder,CRT matches to NZ_AP017379 (Desulfovibrio ferrophilus strain IS5 plasmid pDFE, complete sequence) position: , mismatch: 11, identity: 0.676

gatcgccggagaaaaccctttcgcacaagcctac	CRISPR spacer
ctacgccgacgaaaaccctttcgcacacggaaca	Protospacer
   *****. ***************** *     

80. spacer 1.48|1345617|34|NZ_CP014306|PILER-CR matches to NZ_CP032858 (Bacillus subtilis subsp. subtilis strain 2RL2-3 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

ccatagatagcgtcgatcttttcgagtgcacgca	CRISPR spacer
gcatatatagcgttgatcttttcgatggtggttg	Protospacer
 **** *******.***********  *..  ..

81. spacer 1.48|1345617|34|NZ_CP014306|PILER-CR matches to NZ_CP032873 (Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

ccatagatagcgtcgatcttttcgagtgcacgca	CRISPR spacer
gcatatatagcgttgatcttttcgatggtggttg	Protospacer
 **** *******.***********  *..  ..

82. spacer 1.68|1346955|34|NZ_CP014306|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676

caacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
ccgaccgtcgaacgcctcgaccgcgccgagacgc	Protospacer
* . ******.*********.*******.    .

83. spacer 1.68|1346955|34|NZ_CP014306|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 11, identity: 0.676

caacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
ccgaccgtcgaacgcctcgaccgcgccgagacgc	Protospacer
* . ******.*********.*******.    .

84. spacer 2.14|1356510|35|NZ_CP014306|CRISPRCasFinder,CRT matches to NC_011737 (Gloeothece citriformis PCC 7424 plasmid pP742402, complete sequence) position: , mismatch: 11, identity: 0.686

agggcaagagtggcgatgacgagtgttttcatggc	CRISPR spacer
ccactgagagaggcgatgacgagagttttcataaa	Protospacer
  . ..**** ************ ********.. 

85. spacer 2.58|1356511|35|NZ_CP014306|PILER-CR matches to NC_011737 (Gloeothece citriformis PCC 7424 plasmid pP742402, complete sequence) position: , mismatch: 11, identity: 0.686

agggcaagagtggcgatgacgagtgttttcatggc	CRISPR spacer
ccactgagagaggcgatgacgagagttttcataaa	Protospacer
  . ..**** ************ ********.. 

86. spacer 1.68|1346955|34|NZ_CP014306|PILER-CR matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 12, identity: 0.647

caacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
atcgccgtcgaacgcctcgatcgcgacgcgggag	Protospacer
    ******.************** **   .  

87. spacer 1.68|1346955|34|NZ_CP014306|PILER-CR matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 12, identity: 0.647

caacccgtcggacgcctcgatcgcgccggctact	CRISPR spacer
atcgccgtcgaacgcctcgatcgcgacgcgggag	Protospacer
    ******.************** **   .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 289355 : 297583 8 Tanapox_virus(16.67%) NA NA
DBSCAN-SWA_2 1808694 : 1817751 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 2014993 : 2024273 9 Streptococcus_phage(16.67%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP014307
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 912017 : 964752 43 Tupanvirus(50.0%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP014310
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 90652 63 Stx2-converting_phage(14.29%) integrase,transposase attL 14008:14023|attR 57853:57868
DBSCAN-SWA_2 99388 : 106785 6 Gordonia_phage(33.33%) NA NA
DBSCAN-SWA_3 113600 : 114365 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_4 119731 : 119953 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_5 123515 : 129883 7 Salmonella_phage(25.0%) NA NA
DBSCAN-SWA_6 135114 : 136245 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_7 140480 : 200374 43 Ectocarpus_siliculosus_virus(25.0%) integrase,protease,transposase attL 139352:139366|attR 180025:180039
DBSCAN-SWA_8 229729 : 299788 49 Acinetobacter_phage(14.29%) transposase,integrase,protease attL 227091:227105|attR 302061:302075
DBSCAN-SWA_9 303357 : 305016 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_10 321069 : 379442 37 Lactococcus_phage(30.0%) integrase,transposase attL 361242:361301|attR 381989:383256
DBSCAN-SWA_11 385678 : 386557 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_12 406019 : 411784 5 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_13 417152 : 423049 7 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_14 433211 : 434684 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_15 445076 : 448977 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_16 459138 : 460791 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_17 468407 : 469616 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_18 473296 : 508888 23 Acidithiobacillus_phage(25.0%) integrase,transposase attL 470228:470287|attR 508131:508972
DBSCAN-SWA_19 518740 : 519745 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_20 532188 : 533661 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_21 569159 : 570101 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_22 573361 : 582539 5 uncultured_Caudovirales_phage(25.0%) transposase NA
DBSCAN-SWA_23 592186 : 594432 3 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_24 599972 : 600758 1 Bacillus_virus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage