Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP017309 Leptolyngbya sp. NIES-3755 plasmid plasmid1 DNA, complete genome 0 crisprs RT,csa3,PD-DExK 0 0 1 0
NZ_AP017311 Leptolyngbya sp. NIES-3755 plasmid plasmid3 DNA, complete sequence 1 crisprs PD-DExK 0 1 0 0
NZ_AP017308 Leptolyngbya sp. NIES-3755 DNA, complete genome 14 crisprs csa3,Cas14u_CAS-V,cas14j,PD-DExK,cas3,DEDDh,cmr5gr11,cmr4gr7,cmr3gr5,cas10,WYL,cas10d,csc2gr7,csc1gr5,cas6,cas4,cas1,cas2,c2c5_V-U5,cas14k,c2c9_V-U4,Cas9_archaeal,DinG 1 5 9 0
NZ_AP017310 Leptolyngbya sp. NIES-3755 plasmid plasmid2 DNA, complete genome 0 crisprs PD-DExK 0 0 5 0

Results visualization

1. NZ_AP017311
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017311_1 78011-78084 Orphan NA
1 spacers
PD-DExK

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP017311_1 1.1|78034|28|NZ_AP017311|CRISPRCasFinder 78034-78061 28 NZ_AP017311 Leptolyngbya sp. NIES-3755 plasmid plasmid3 DNA, complete sequence 78034-78061 0 1.0
NZ_AP017311_1 1.1|78034|28|NZ_AP017311|CRISPRCasFinder 78034-78061 28 MN850656 Flavobacterium phage fF4, complete genome 5567-5594 7 0.75

1. spacer 1.1|78034|28|NZ_AP017311|CRISPRCasFinder matches to NZ_AP017311 (Leptolyngbya sp. NIES-3755 plasmid plasmid3 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

acttcgataattttcatcgtctcaaaca	CRISPR spacer
acttcgataattttcatcgtctcaaaca	Protospacer
****************************

2. spacer 1.1|78034|28|NZ_AP017311|CRISPRCasFinder matches to MN850656 (Flavobacterium phage fF4, complete genome) position: , mismatch: 7, identity: 0.75

acttcgataattttcatcgtctcaaaca	CRISPR spacer
gttgtgataattttcatcgtgtcaaagt	Protospacer
..* .*************** *****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP017309
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3589 : 37415 32 Wolbachia_phage(14.29%) integrase,transposase attL 17115:17132|attR 40943:40960
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_AP017308
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_1 165914-166004 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_2 769038-769144 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_3 1544646-1544773 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_4 2221361-2222417 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_5 2276712-2276905 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_6 2341404-2342462 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_7 3147145-3147234 TypeIII NA
1 spacers
cmr5gr11,cmr4gr7,cmr3gr5,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_8 3147939-3148195 TypeIII NA
3 spacers
cmr5gr11,cmr4gr7,cmr3gr5,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_9 3149255-3149652 TypeIII NA
5 spacers
cmr5gr11,cmr4gr7,cmr3gr5,cas10,cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_10 3155436-3155691 TypeIII NA
3 spacers
cas10,cmr3gr5,cmr4gr7,cmr5gr11,cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_11 3479425-3479608 TypeI-D NA
2 spacers
cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_12 3530172-3530276 TypeV,TypeI-A NA
1 spacers
cas14j,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_13 4241978-4242117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017308_14 4661158-4661265 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP017308_3 3.1|1544669|22|NZ_AP017308|CRISPRCasFinder 1544669-1544690 22 NZ_AP017308.1 1544759-1544780 1 0.955

1. spacer 3.1|1544669|22|NZ_AP017308|CRISPRCasFinder matches to position: 1544759-1544780, mismatch: 1, identity: 0.955

ccgtaaatctgctccactaaaa	CRISPR spacer
ccgtaaatctgctccacaaaaa	Protospacer
***************** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP017308_3 3.1|1544669|22|NZ_AP017308|CRISPRCasFinder 1544669-1544690 22 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 334863-334884 2 0.909
NZ_AP017308_3 3.1|1544669|22|NZ_AP017308|CRISPRCasFinder 1544669-1544690 22 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 221900-221921 2 0.909
NZ_AP017308_10 10.2|3155548|34|NZ_AP017308|CRISPRCasFinder 3155548-3155581 34 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 304967-305000 9 0.735
NZ_AP017308_5 5.1|2276735|34|NZ_AP017308|CRISPRCasFinder 2276735-2276768 34 MT774401 CrAssphage cr6_1, complete genome 40486-40519 10 0.706
NZ_AP017308_8 8.5|3148130|35|NZ_AP017308|PILER-CR 3148130-3148164 35 MN013090 Erwinia phage vB_EamM_TropicalSun, complete genome 61535-61569 11 0.686
NZ_AP017308_5 5.4|2276734|36|NZ_AP017308|PILER-CR 2276734-2276769 36 MT774401 CrAssphage cr6_1, complete genome 40484-40519 12 0.667

1. spacer 3.1|1544669|22|NZ_AP017308|CRISPRCasFinder matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

ccgtaaatctgctccactaaaa	CRISPR spacer
tcataaatctgctccactaaaa	Protospacer
.*.*******************

2. spacer 3.1|1544669|22|NZ_AP017308|CRISPRCasFinder matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

ccgtaaatctgctccactaaaa	CRISPR spacer
tcgtaaatctgcaccactaaaa	Protospacer
.*********** *********

3. spacer 10.2|3155548|34|NZ_AP017308|CRISPRCasFinder matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 9, identity: 0.735

gtacgtgctcaaagtggggcttgacgaagttaag	CRISPR spacer
cgccgttctcaaagtggggcatgacgaaataggg	Protospacer
   *** ************* *******.* ..*

4. spacer 5.1|2276735|34|NZ_AP017308|CRISPRCasFinder matches to MT774401 (CrAssphage cr6_1, complete genome) position: , mismatch: 10, identity: 0.706

cctagagatttgtttgcttctaatgtatccgcag	CRISPR spacer
aatagagatttgtttgattataatgtattttata	Protospacer
  ************** ** ********..   .

5. spacer 8.5|3148130|35|NZ_AP017308|PILER-CR matches to MN013090 (Erwinia phage vB_EamM_TropicalSun, complete genome) position: , mismatch: 11, identity: 0.686

gactcccgatactggagtgattatggatggattta	CRISPR spacer
ccttgagaatgctggagtgattatgggtggattcg	Protospacer
  .*   .**.***************.******..

6. spacer 5.4|2276734|36|NZ_AP017308|PILER-CR matches to MT774401 (CrAssphage cr6_1, complete genome) position: , mismatch: 12, identity: 0.667

tgcctagagatttgtttgcttctaatgtatccgcag	CRISPR spacer
gtaatagagatttgtttgattataatgtattttata	Protospacer
    ************** ** ********..   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1087239 : 1094091 9 Indivirus(16.67%) tRNA NA
DBSCAN-SWA_2 1118599 : 1170552 45 Hokovirus(33.33%) integrase,transposase attL 1129510:1129569|attR 1171042:1172193
DBSCAN-SWA_3 1699990 : 1709160 8 Mycobacterium_virus(16.67%) NA NA
DBSCAN-SWA_4 2611293 : 2661808 51 Emiliania_huxleyi_virus(11.11%) protease,tail NA
DBSCAN-SWA_5 3128448 : 3188634 59 Prochlorococcus_phage(14.29%) transposase,protease,integrase,tRNA attL 3130686:3130732|attR 3147354:3147400
DBSCAN-SWA_6 3323657 : 3357770 24 Acinetobacter_phage(33.33%) plate,tail,transposase NA
DBSCAN-SWA_7 3508161 : 3520758 8 uncultured_phage(28.57%) tail NA
DBSCAN-SWA_8 3528847 : 3537610 6 Acanthamoeba_polyphaga_moumouvirus(16.67%) NA NA
DBSCAN-SWA_9 4443037 : 4451268 8 Escherichia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_AP017310
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 22440 3 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_2 27053 : 32159 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_3 43407 : 53976 8 Planktothrix_phage(20.0%) integrase attL 27150:27165|attR 64652:64667
DBSCAN-SWA_4 75748 : 77436 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_5 85398 : 94342 2 Tupanvirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage