Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 0 crisprs cas3 0 0 1 0
NZ_AP014953 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_2, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_AP014951 Klebsiella oxytoca strain JKo3 2 crisprs RT,DEDDh,WYL,DinG,cas3,csa3 0 3 417 0
NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 0 crisprs RT,csa3 0 0 3 0
NZ_AP014955 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_AP014954
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2960 : 43494 48 Leptospira_phage(12.5%) transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP014953
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 103515 107 Salmonella_phage(90.32%) tail,transposase,integrase,portal,terminase attL 1058:1080|attR 104138:104160
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_AP014951
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014951_1 3268536-3268633 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014951_2 4026620-4026891 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP014951_2 2.3|4026770|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026770-4026802 33 MK416015 Klebsiella phage ST16-OXA48phi5.4, complete genome 20203-20235 0 1.0
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 103639-103671 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 57757-57789 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 101396-101428 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 29447-29479 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 68313-68345 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 178077-178109 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 104766-104798 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 83888-83920 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 109637-109669 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 41461-41493 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 50333-50365 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 73510-73542 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 88139-88171 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 60944-60976 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP032198 Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence 24022-24054 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 84999-85031 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 83285-83317 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 39269-39301 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 11908-11940 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 84999-85031 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 106984-107016 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 73311-73343 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 96042-96074 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 57213-57245 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 65703-65735 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 41573-41605 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 32675-32707 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 63439-63471 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 169451-169483 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 52744-52776 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 100604-100636 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 18997-19029 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 150255-150287 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 163582-163614 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 78779-78811 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 201101-201133 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 82641-82673 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 59143-59175 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 1239-1271 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 57906-57938 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 88811-88843 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 170120-170152 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 43439-43471 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 220683-220715 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 83798-83830 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 171618-171650 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 64776-64808 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 200166-200198 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 36745-36777 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 58819-58851 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 67256-67288 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 103904-103936 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 69468-69500 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 110334-110366 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 43691-43723 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 81381-81413 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 140982-141014 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 48886-48918 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 132164-132196 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 132573-132605 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 131331-131363 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 88145-88177 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 78336-78368 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 124413-124445 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 94800-94832 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 170923-170955 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 200057-200089 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 77035-77067 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 85000-85032 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 2006-2038 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 88214-88246 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 364649-364681 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 56015-56047 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 66457-66489 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 111970-112002 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 40243-40275 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 83599-83631 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 78-110 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 1239-1271 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 98161-98193 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 230842-230874 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 139898-139930 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 6256-6288 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 49579-49611 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 52321-52353 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 70733-70765 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 85825-85857 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 78189-78221 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 97459-97491 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 66726-66758 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 1821-1853 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 35295-35327 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 3469-3501 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 158624-158656 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 88809-88841 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 24767-24799 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 42956-42988 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 55118-55150 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 134928-134960 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 85000-85032 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 131444-131476 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 43554-43586 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 13611-13643 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 42435-42467 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 78458-78490 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 66734-66766 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 50327-50359 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 238230-238262 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 38628-38660 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 35033-35065 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 36746-36778 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 37277-37309 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 63920-63952 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 68728-68760 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 76605-76637 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 62614-62646 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 183897-183929 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_LT991960 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3 37390-37422 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 127491-127523 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 16482-16514 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 140982-141014 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 127401-127433 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 125786-125818 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 114638-114670 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 205430-205462 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 194625-194657 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 67816-67848 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 142842-142874 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 59343-59375 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 21674-21706 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 84343-84375 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 88811-88843 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 211404-211436 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 122856-122888 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 68645-68677 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 120051-120083 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 33567-33599 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 127685-127717 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 56018-56050 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 45682-45714 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 6213-6245 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 79019-79051 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 229571-229603 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 107108-107140 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 195402-195434 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 199015-199047 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 117175-117207 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 58533-58565 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 59249-59281 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 72951-72983 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 50524-50556 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 70700-70732 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 77805-77837 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 88811-88843 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 24005-24037 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 153413-153445 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 78409-78441 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP046943 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4 5172-5204 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP009115 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence 66610-66642 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 70503-70535 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 67634-67666 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 130669-130701 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 94982-95014 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041249 Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence 39804-39836 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 55383-55415 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 67809-67841 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 182378-182410 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 89805-89837 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 36746-36778 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 37277-37309 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 63919-63951 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 193659-193691 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 100609-100641 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 165977-166009 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 114503-114535 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 177151-177183 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 114646-114678 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 77695-77727 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 190782-190814 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 107611-107643 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 101332-101364 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 198860-198892 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 37204-37236 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 153447-153479 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 78409-78441 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 144946-144978 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 56574-56606 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 112066-112098 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 112368-112400 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 140728-140760 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 257535-257567 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 57666-57698 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 162447-162479 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 161165-161197 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 115944-115976 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 56049-56081 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 207505-207537 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 222523-222555 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 40414-40446 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 209472-209504 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 160219-160251 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 122076-122108 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 186402-186434 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 77183-77215 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 89024-89056 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 194205-194237 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 14896-14928 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 76998-77030 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 101566-101598 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 13494-13526 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 94575-94607 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 13966-13998 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 211412-211444 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 158624-158656 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 8623-8655 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 63088-63120 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 4274-4306 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 68367-68399 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 204074-204106 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 104919-104951 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 33823-33855 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 80977-81009 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 83486-83518 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 117677-117709 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 188026-188058 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 204267-204299 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 132103-132135 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 38833-38865 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 87717-87749 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 82646-82678 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 37128-37160 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 119435-119467 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 88814-88846 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 27427-27459 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 199031-199063 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 47281-47313 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 59552-59584 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_016846 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence 70033-70065 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 12315-12347 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 209475-209507 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 76039-76071 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 36920-36952 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 39259-39291 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 88794-88826 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 88812-88844 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 41573-41605 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 179865-179897 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 35134-35166 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 132621-132653 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 85388-85420 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 88812-88844 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 22555-22587 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 150025-150057 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 54141-54173 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 57213-57245 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 212583-212615 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 126595-126627 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 148861-148893 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 52487-52519 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 95207-95239 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 215999-216031 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 58073-58105 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 130991-131023 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 151617-151649 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 81442-81474 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 81731-81763 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 25770-25802 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 42328-42360 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 239633-239665 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 66456-66488 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015393 Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence 128793-128825 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 146883-146915 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018955 Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence 10432-10464 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 137117-137149 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP047635 Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence 112018-112050 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN891678 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence 58859-58891 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 189366-189398 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 1537-1569 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 93841-93873 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 60619-60651 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 101127-101159 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP044045 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence 42477-42509 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 66292-66324 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 219797-219829 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MH909340 Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence 72581-72613 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 77597-77629 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 198481-198513 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MK413718 Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence 40258-40290 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 38529-38561 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 74763-74795 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 60407-60439 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 69829-69861 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 97606-97638 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 174338-174370 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 33018-33050 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 174738-174770 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 63312-63344 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 200639-200671 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 59714-59746 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 192227-192259 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MG252894 Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence 126197-126229 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 237174-237206 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 1277-1309 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 84794-84826 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 178943-178975 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 75688-75720 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 49042-49074 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 67608-67640 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 136177-136209 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 58000-58032 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MT108210 Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence 85470-85502 2 0.939
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 330812-330844 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP046942 Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697 96912-96944 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 79700-79732 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 6498-6530 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 2973-3005 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 2238-2270 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY399973 Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence 63004-63036 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY399972 Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence 63004-63036 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KY454639 Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence 101841-101873 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 53497-53529 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 63242-63274 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 268973-269005 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 93314-93346 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_KP868646 Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence 63005-63037 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 48807-48839 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 91950-91982 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 136614-136646 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 64309-64341 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 127808-127840 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 12813-12845 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 109460-109492 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 109090-109122 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 151358-151390 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 165543-165575 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 63214-63246 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 108242-108274 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 189312-189344 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 135932-135964 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 10888-10920 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 113331-113363 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 129232-129264 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 176456-176488 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 271798-271830 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 85733-85765 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 147242-147274 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 10416-10448 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 50671-50703 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 HG969996 Klebsiella pneumoniae plasmid pIT-12C47, complete sequence 73356-73388 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 139422-139454 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 195922-195954 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 8501-8533 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 100463-100495 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 142422-142454 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 30245-30277 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022275 Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence 127856-127888 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 139409-139441 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 67800-67832 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 101029-101061 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 111152-111184 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 15235-15267 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 142825-142857 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 152455-152487 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 27589-27621 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 136614-136646 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 31549-31581 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 168147-168179 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 140543-140575 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 7762-7794 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 118943-118975 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 75335-75367 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 147786-147818 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 155353-155385 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 15684-15716 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 130214-130246 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 167647-167679 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 95839-95871 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 76569-76601 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 112418-112450 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 74987-75019 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 122666-122698 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022349 Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence 103245-103277 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 166084-166116 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 99231-99263 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 147278-147310 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 169751-169783 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 194792-194824 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 75622-75654 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 110622-110654 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 308316-308348 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 113112-113144 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 74273-74305 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031851 Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence 108538-108570 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 75348-75380 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 43620-43652 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 136275-136307 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 140214-140246 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 135849-135881 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 113999-114031 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 98959-98991 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 131065-131097 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 165353-165385 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 113263-113295 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 175952-175984 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 214300-214332 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 102173-102205 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 44574-44606 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 39873-39905 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 166032-166064 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 132544-132576 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 62974-63006 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 129632-129664 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 91622-91654 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 159794-159826 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 84074-84106 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP038275 Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence 70813-70845 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP038276 Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence 99554-99586 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 108229-108261 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028930 Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence 33144-33176 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP050168 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence 79757-79789 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 123574-123606 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 143044-143076 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP016922 Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence 15073-15105 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 155042-155074 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 145118-145150 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 167495-167527 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 50573-50605 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP022613 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence 61367-61399 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP050373 Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence 69619-69651 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 95846-95878 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 224445-224477 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 54635-54667 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 141569-141601 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026148 Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence 38838-38870 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026151 Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence 21785-21817 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 108922-108954 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 158406-158438 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 167999-168031 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 99223-99255 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP020904 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence 19180-19212 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028181 Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence 138503-138535 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026139 Klebsiella pneumoniae strain F77 plasmid pF77_3, complete sequence 21970-22002 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 1822-1854 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 124525-124557 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015754 Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence 119795-119827 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 133868-133900 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 157388-157420 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 89978-90010 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 131188-131220 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 39056-39088 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 120852-120884 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP018749 Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence 63958-63990 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 17858-17890 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011634 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence 104534-104566 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 69607-69639 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 108229-108261 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 26670-26702 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 79009-79041 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 144429-144461 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 136270-136302 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 158511-158543 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 140510-140542 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 37687-37719 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 136520-136552 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 299546-299578 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 177078-177110 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP036439 Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence 112891-112923 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 135771-135803 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 133963-133995 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011577 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence 57848-57880 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 29827-29859 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 101912-101944 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 32258-32290 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP023186 Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence 89160-89192 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027161 Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence 205214-205246 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP026161 Klebsiella pneumoniae strain F93-1 plasmid pF93-1_1, complete sequence 8268-8300 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP018751 Klebsiella pneumoniae strain KP64 plasmid pKP6401, complete sequence 63200-63232 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 221199-221231 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025009 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence 136396-136428 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP006800 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p2, complete sequence 92143-92175 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 144752-144784 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 96610-96642 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 105671-105703 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP028543 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence 131348-131380 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 91633-91665 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 27803-27835 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052477 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence 154303-154335 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 153836-153868 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP025006 Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence 127720-127752 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_LR792629 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II 147949-147981 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 27589-27621 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP016160 Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence 147683-147715 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052469 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence 167479-167511 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 151820-151852 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 156175-156207 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 190446-190478 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 190446-190478 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP015395 Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence 81094-81126 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 CP052307 Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence 142893-142925 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 129957-129989 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 121911-121943 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 123665-123697 3 0.909
NZ_AP014951_2 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT 4026709-4026741 33 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 123509-123541 3 0.909
NZ_AP014951_1 1.1|3268568|34|NZ_AP014951|CRISPRCasFinder 3268568-3268601 34 MH178096 Aeromonas phage AsXd-1, complete genome 10853-10886 4 0.882

1. spacer 2.3|4026770|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK416015 (Klebsiella phage ST16-OXA48phi5.4, complete genome) position: , mismatch: 0, identity: 1.0

ccgtcatgagggcgggcagtgtgattgtgatgc	CRISPR spacer
ccgtcatgagggcgggcagtgtgattgtgatgc	Protospacer
*********************************

2. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

3. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

4. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

5. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

6. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

7. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

8. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

9. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

10. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

11. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

12. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

13. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

14. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

15. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

16. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

17. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

18. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

19. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

20. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

21. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

22. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

23. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

24. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

25. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

26. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

27. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

28. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

29. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

30. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

31. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

32. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

33. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

34. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

35. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

36. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

37. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

38. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

39. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

40. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

41. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

42. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

43. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

44. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

45. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

46. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

47. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

48. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

49. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

50. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

51. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

52. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

53. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

54. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

55. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

56. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

57. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

58. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

59. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

60. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

61. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

62. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

63. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

64. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

65. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

66. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

67. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

68. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

69. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

70. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

71. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

72. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

73. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

74. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

75. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

76. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

77. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

78. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

79. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

80. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

81. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

82. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

83. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

84. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

85. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

86. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

87. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

88. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

89. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtattcgacatgggtgatggctataagtcc	Protospacer
*****************.************** 

90. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

91. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

92. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

93. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

94. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

95. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

96. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

97. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

98. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

99. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

100. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

101. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

102. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

103. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

104. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

105. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

106. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

107. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

108. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

109. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

110. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

111. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

112. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

113. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

114. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

115. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

116. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

117. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

118. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

119. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

120. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

121. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

122. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

123. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

124. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

125. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

126. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

127. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

128. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

129. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

130. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

131. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

132. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

133. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

134. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

135. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

136. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

137. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

138. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

139. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

140. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

141. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

142. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

143. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

144. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

145. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

146. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

147. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

148. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

149. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

150. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

151. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

152. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

153. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

154. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

155. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

156. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

157. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

158. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

159. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046943 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

160. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

161. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

162. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

163. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

164. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

165. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtattcgacatgggcgacggctataagtcc	Protospacer
********************.*********** 

166. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

167. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

168. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

169. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

170. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

171. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

172. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

173. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

174. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

175. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

176. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

177. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

178. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

179. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

180. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

181. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

182. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

183. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

184. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

185. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

186. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

187. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

188. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

189. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

190. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

191. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

192. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

193. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

194. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

195. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

196. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

197. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

198. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

199. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

200. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

201. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

202. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

203. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

204. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

205. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

206. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

207. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

208. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

209. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

210. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

211. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

212. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

213. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

214. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

215. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

216. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

217. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

218. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

219. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

220. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

221. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

222. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

223. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

224. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

225. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

226. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

227. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

228. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

229. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

230. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

231. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

232. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

233. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

234. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

235. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

236. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

237. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

238. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

239. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

240. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

241. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

242. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

243. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

244. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

245. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

246. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

247. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

248. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

249. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

250. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

251. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

252. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

253. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

254. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

255. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

256. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

257. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

258. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

259. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

260. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

261. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

262. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

263. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

264. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

265. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

266. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

267. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

268. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

269. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

270. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

271. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

272. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

273. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

274. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

275. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

276. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

277. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN891678 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

278. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

279. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

280. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

281. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

282. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

283. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

284. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

285. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

286. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH909340 (Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

287. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

288. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

289. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK413718 (Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

290. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

291. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

292. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

293. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

294. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

295. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

296. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

297. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

298. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

299. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

300. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

301. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

302. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG252894 (Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

303. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

304. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

305. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

306. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

307. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

308. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

309. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

310. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

311. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

312. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 2, identity: 0.939

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgatggctataagtcc	Protospacer
*****.************************** 

313. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

314. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
cgggtgttcgacatgggcgatggctataagtcc	Protospacer
.****.************************** 

315. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
cgggtgttcgacatgggcgatggctataagtcc	Protospacer
.****.************************** 

316. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcg	Protospacer
*****.*********** **************.

317. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

318. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

319. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY399973 (Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

320. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY399972 (Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

321. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY454639 (Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

322. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

323. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

324. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

325. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

326. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP868646 (Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

327. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

328. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

329. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

330. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

331. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

332. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

333. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

334. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

335. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

336. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

337. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

338. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

339. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

340. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

341. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

342. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

343. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcg	Protospacer
*****.*********** **************.

344. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

345. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

346. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

347. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

348. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

349. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

350. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

351. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

352. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

353. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

354. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

355. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

356. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

357. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

358. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

359. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

360. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

361. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

362. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

363. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

364. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

365. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

366. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

367. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

368. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

369. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

370. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

371. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

372. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

373. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

374. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

375. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

376. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

377. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

378. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

379. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

380. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgacggctataagtcc	Protospacer
*****.**************.*********** 

381. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

382. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

383. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

384. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

385. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

386. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

387. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

388. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

389. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

390. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

391. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

392. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

393. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

394. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

395. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

396. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

397. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

398. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

399. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

400. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

401. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

402. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

403. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

404. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

405. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

406. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

407. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

408. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

409. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

410. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

411. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

412. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcg	Protospacer
*****.*********** **************.

413. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

414. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

415. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

416. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

417. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038275 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

418. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038276 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

419. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

420. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028930 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

421. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

422. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

423. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

424. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016922 (Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

425. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

426. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

427. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

428. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

429. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

430. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

431. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

432. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

433. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

434. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

435. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026148 (Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

436. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

437. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

438. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

439. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

440. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

441. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

442. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

443. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026139 (Klebsiella pneumoniae strain F77 plasmid pF77_3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

444. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

445. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

446. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015754 (Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

447. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

448. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcg	Protospacer
*****.*********** **************.

449. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcg	Protospacer
*****.*********** **************.

450. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

451. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

452. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

453. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018749 (Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

454. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggcgacggctataagtcc	Protospacer
*****.**************.*********** 

455. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

456. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

457. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

458. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

459. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

460. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

461. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

462. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

463. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

464. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

465. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

466. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

467. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

468. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcg	Protospacer
*****.*********** **************.

469. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

470. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

471. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

472. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

473. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

474. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

475. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023186 (Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

476. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

477. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026161 (Klebsiella pneumoniae strain F93-1 plasmid pF93-1_1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

478. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018751 (Klebsiella pneumoniae strain KP64 plasmid pKP6401, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

479. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

480. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

481. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006800 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

482. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

483. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

484. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

485. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

486. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

487. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

488. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

489. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

490. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

491. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR792629 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

492. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

493. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016160 (Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

494. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052469 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

495. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

496. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

497. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

498. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

499. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

500. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

501. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgacatgggggatggctataagtcc	Protospacer
*****.*********** ************** 

502. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

503. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

504. spacer 2.2|4026709|33|NZ_AP014951|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 3, identity: 0.909

tgggtattcgacatgggcgatggctataagtca	CRISPR spacer
tgggtgttcgatatgggcgatggctataagtcc	Protospacer
*****.*****.******************** 

505. spacer 1.1|3268568|34|NZ_AP014951|CRISPRCasFinder matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 4, identity: 0.882

ctagtgaatctgctgcaccaggtagtgaatgatt	CRISPR spacer
ggggtgaatctgctgcaccaggtagtgaacgatt	Protospacer
  .**************************.****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 9036 6 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_2 21672 : 24444 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 27464 : 28382 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_4 71595 : 73107 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_5 81365 : 84892 4 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_6 89565 : 90900 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_7 103297 : 106008 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_8 120748 : 122617 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_9 132690 : 134337 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_10 143971 : 150215 5 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_11 155748 : 157685 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_12 161735 : 166013 4 Catovirus(33.33%) NA NA
DBSCAN-SWA_13 174041 : 175694 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_14 185700 : 189559 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_15 193410 : 195237 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_16 205896 : 212074 7 Alteromonas_phage(33.33%) NA NA
DBSCAN-SWA_17 221165 : 221780 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_18 231532 : 254278 18 uncultured_Mediterranean_phage(14.29%) NA NA
DBSCAN-SWA_19 259535 : 268301 9 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_20 282037 : 285721 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_21 301901 : 302690 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_22 312457 : 313567 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_23 320702 : 321311 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_24 327039 : 329680 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_25 333484 : 338733 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_26 350546 : 351896 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_27 369468 : 376223 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_28 383308 : 384289 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_29 387513 : 389046 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_30 394712 : 396536 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_31 401872 : 408436 8 Burkholderia_virus(25.0%) NA NA
DBSCAN-SWA_32 422192 : 427761 5 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_33 438510 : 443728 6 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_34 449410 : 449956 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_35 454595 : 457839 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_36 463740 : 468101 3 Pithovirus(50.0%) NA NA
DBSCAN-SWA_37 508141 : 514764 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_38 535495 : 540092 3 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_39 548000 : 554012 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_40 558121 : 567022 6 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_41 580598 : 589057 8 Planktothrix_phage(33.33%) integrase attL 582429:582443|attR 594280:594294
DBSCAN-SWA_42 597937 : 602653 4 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_43 609315 : 612134 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_44 618485 : 618728 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_45 622941 : 624543 3 Yersinia_phage(50.0%) NA NA
DBSCAN-SWA_46 640961 : 642326 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_47 655061 : 660784 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_48 669058 : 672445 1 Serratia_phage(100.0%) holin NA
DBSCAN-SWA_49 678181 : 678766 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_50 695100 : 696938 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_51 720689 : 721670 1 Thermus_phage(100.0%) transposase NA
DBSCAN-SWA_52 733091 : 734114 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_53 741117 : 744274 3 Paramecium_bursaria_Chlorella_virus(50.0%) transposase NA
DBSCAN-SWA_54 747436 : 748716 2 Shigella_phage(50.0%) NA NA
DBSCAN-SWA_55 762026 : 764730 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_56 769394 : 770717 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_57 777026 : 782236 3 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_58 786200 : 787625 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_59 798706 : 799660 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_60 804046 : 818736 13 Chrysochromulina_ericina_virus(20.0%) tRNA NA
DBSCAN-SWA_61 824661 : 825630 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_62 842578 : 843727 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_63 852903 : 854272 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_64 866815 : 872267 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_65 878538 : 879240 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_66 899929 : 901654 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_67 925405 : 928825 5 Rhizoctonia_fumigata_mycovirus(50.0%) NA NA
DBSCAN-SWA_68 933148 : 933700 1 Thiobacimonas_phage(100.0%) NA NA
DBSCAN-SWA_69 944825 : 946250 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_70 957370 : 963912 5 Mamastrovirus(33.33%) NA NA
DBSCAN-SWA_71 969279 : 977265 7 unidentified_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_72 999594 : 1000392 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_73 1006340 : 1006685 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_74 1010800 : 1012240 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_75 1023904 : 1024663 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_76 1033497 : 1037615 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_77 1049853 : 1050885 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_78 1057377 : 1058181 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_79 1062222 : 1066433 5 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_80 1070522 : 1071104 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_81 1099257 : 1100238 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_82 1106668 : 1108144 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_83 1143264 : 1144782 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_84 1155645 : 1215440 63 Vibrio_phage(60.0%) head,tail,plate,integrase,transposase attL 1147514:1147528|attR 1223961:1223975
DBSCAN-SWA_85 1219260 : 1222976 5 Brazilian_cedratvirus(66.67%) NA NA
DBSCAN-SWA_86 1234322 : 1235369 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_87 1243342 : 1244110 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_88 1267990 : 1277215 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_89 1293607 : 1297947 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_90 1303104 : 1304772 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_91 1323931 : 1325608 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_92 1337960 : 1343010 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_93 1346372 : 1348322 2 Thermus_phage(50.0%) transposase NA
DBSCAN-SWA_94 1352750 : 1356294 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_95 1371124 : 1372234 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_96 1379407 : 1390759 12 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_97 1396276 : 1403700 9 Sodalis_phage(25.0%) transposase NA
DBSCAN-SWA_98 1417965 : 1424500 6 Pteropox_virus(33.33%) NA NA
DBSCAN-SWA_99 1427674 : 1428361 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_100 1436499 : 1438281 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_101 1445863 : 1447009 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_102 1458877 : 1461481 3 Moumouvirus(50.0%) tRNA NA
DBSCAN-SWA_103 1472260 : 1472974 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_104 1479301 : 1480177 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_105 1486956 : 1491810 4 Acinetobacter_phage(33.33%) tRNA NA
DBSCAN-SWA_106 1496568 : 1498053 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_107 1502062 : 1506707 5 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_108 1513942 : 1515367 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_109 1521231 : 1522212 1 Thermus_phage(100.0%) transposase NA
DBSCAN-SWA_110 1533994 : 1534744 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_111 1557940 : 1560664 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_112 1570840 : 1572884 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_113 1579121 : 1583799 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_114 1587511 : 1593429 4 Catovirus(50.0%) holin NA
DBSCAN-SWA_115 1596913 : 1598458 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_116 1609855 : 1614623 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_117 1624524 : 1631903 6 Thermus_phage(33.33%) transposase NA
DBSCAN-SWA_118 1648924 : 1667455 15 Cedratvirus(14.29%) NA NA
DBSCAN-SWA_119 1671541 : 1673072 3 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_120 1676974 : 1679417 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_121 1686433 : 1694494 5 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_122 1700341 : 1701388 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_123 1705457 : 1707119 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_124 1716435 : 1726384 7 Vibrio_phage(25.0%) tRNA NA
DBSCAN-SWA_125 1729388 : 1730162 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_126 1736608 : 1738093 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_127 1746357 : 1753807 6 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_128 1759604 : 1760396 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_129 1798610 : 1802129 4 Vibriophage(33.33%) NA NA
DBSCAN-SWA_130 1806523 : 1813047 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_131 1820212 : 1820944 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_132 1828577 : 1833519 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_133 1837194 : 1837917 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_134 1844460 : 1845366 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_135 1855175 : 1856915 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_136 1862056 : 1870504 8 Micromonas_pusilla_virus(20.0%) NA NA
DBSCAN-SWA_137 1877073 : 1882183 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_138 1886092 : 1893149 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_139 1900793 : 1903226 1 Citrobacter_phage(100.0%) NA NA
DBSCAN-SWA_140 1907404 : 1909258 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_141 1918988 : 1941856 35 Escherichia_phage(26.32%) holin,terminase NA
DBSCAN-SWA_142 1944884 : 1950859 5 Erwinia_phage(20.0%) NA NA
DBSCAN-SWA_143 1958389 : 1969915 13 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_144 1973179 : 1975919 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_145 1989794 : 2012889 16 uncultured_Mediterranean_phage(16.67%) tRNA,protease NA
DBSCAN-SWA_146 2020012 : 2023239 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_147 2027284 : 2028373 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_148 2033460 : 2038013 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_149 2055323 : 2063691 5 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_150 2070403 : 2072311 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_151 2085081 : 2087136 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_152 2102480 : 2104628 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_153 2114099 : 2114759 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_154 2134900 : 2135641 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_155 2152088 : 2152868 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_156 2157134 : 2158236 2 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_157 2170398 : 2171427 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_158 2176196 : 2177579 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_159 2190997 : 2191738 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_160 2202013 : 2202916 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_161 2206093 : 2212670 4 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_162 2226076 : 2228347 3 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_163 2245217 : 2248112 4 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_164 2257116 : 2258097 1 Thermus_phage(100.0%) transposase NA
DBSCAN-SWA_165 2262251 : 2262806 1 Infectious_spleen_and_kidney_necrosis_virus(100.0%) NA NA
DBSCAN-SWA_166 2271153 : 2272074 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_167 2275303 : 2275549 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_168 2296627 : 2297809 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_169 2301107 : 2301749 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_170 2317502 : 2317760 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_171 2324049 : 2327815 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_172 2331161 : 2332298 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_173 2340501 : 2341872 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_174 2345105 : 2355386 10 Phage_21(25.0%) NA NA
DBSCAN-SWA_175 2361120 : 2362035 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_176 2370167 : 2374520 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_177 2377850 : 2378705 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_178 2382352 : 2383606 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_179 2389294 : 2393443 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_180 2399322 : 2401278 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_181 2412160 : 2413381 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_182 2422813 : 2423641 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_183 2429856 : 2435595 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_184 2450513 : 2453471 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_185 2468171 : 2470769 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_186 2475609 : 2476200 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_187 2481766 : 2488486 6 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_188 2511357 : 2577117 72 Klebsiella_phage(36.17%) plate,terminase,integrase,holin,transposase attL 2510618:2510632|attR 2513234:2513248
DBSCAN-SWA_189 2591268 : 2591997 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_190 2604769 : 2608332 4 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_191 2611368 : 2615947 5 Diachasmimorpha_longicaudata_entomopoxvirus(25.0%) tRNA NA
DBSCAN-SWA_192 2620289 : 2626523 9 Enterobacterial_phage(33.33%) holin NA
DBSCAN-SWA_193 2641288 : 2642809 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_194 2689574 : 2690645 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_195 2699655 : 2704266 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_196 2711047 : 2714631 3 Vibrio_phage(33.33%) head,tail NA
DBSCAN-SWA_197 2723239 : 2727858 8 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_198 2735104 : 2736613 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_199 2751213 : 2753178 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_200 2759393 : 2760404 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_201 2775726 : 2777838 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_202 2788032 : 2788812 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_203 2801667 : 2802372 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_204 2807572 : 2809117 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_205 2815224 : 2818897 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_206 2823205 : 2823979 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_207 2833826 : 2835431 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_208 2839236 : 2844009 4 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_209 2864076 : 2867646 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_210 2875897 : 2877486 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_211 2890589 : 2894708 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_212 2911768 : 2912653 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_213 2919346 : 2920744 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_214 2929565 : 2964000 43 Erwinia_phage(37.5%) head,plate,terminase,integrase,transposase attL 2927483:2927501|attR 2962467:2962485
DBSCAN-SWA_215 2985923 : 2986670 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_216 2991305 : 2993300 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_217 3023741 : 3024578 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_218 3033944 : 3035477 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_219 3042472 : 3046802 4 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_220 3050611 : 3051421 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_221 3055462 : 3056920 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_222 3063787 : 3064528 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_223 3067781 : 3068573 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_224 3074691 : 3079059 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_225 3087550 : 3091049 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_226 3105440 : 3106853 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_227 3112373 : 3113135 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_228 3117690 : 3118452 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_229 3126011 : 3126392 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_230 3129663 : 3131169 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_231 3155386 : 3162594 5 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_232 3166562 : 3176954 9 Klosneuvirus(20.0%) NA NA
DBSCAN-SWA_233 3181705 : 3183832 3 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_234 3193362 : 3277650 93 Enterobacteria_phage(13.16%) head,tail,capsid,plate,protease,terminase,holin,integrase,portal attL 3183823:3183839|attR 3244259:3244275
DBSCAN-SWA_235 3292102 : 3293404 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_236 3304989 : 3305193 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_237 3310514 : 3311885 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_238 3323047 : 3324322 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_239 3332959 : 3334437 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_240 3338595 : 3347302 9 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_241 3361839 : 3365908 5 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_242 3370123 : 3371170 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_243 3374968 : 3376911 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_244 3391216 : 3392287 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_245 3408402 : 3412786 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_246 3424020 : 3425984 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_247 3440522 : 3441743 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_248 3459480 : 3477428 18 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_249 3485250 : 3488147 3 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_250 3496447 : 3502722 7 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_251 3506196 : 3507732 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_252 3524166 : 3524955 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_253 3530316 : 3536023 7 Mythimna_unipuncta_granulovirus(33.33%) NA NA
DBSCAN-SWA_254 3539239 : 3542117 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_255 3563077 : 3568028 4 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_256 3574838 : 3581039 6 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_257 3602404 : 3603016 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_258 3618511 : 3626590 7 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_259 3633757 : 3635113 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_260 3638955 : 3640515 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_261 3647952 : 3648162 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_262 3653422 : 3655471 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_263 3662939 : 3663593 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_264 3672842 : 3673811 2 Pectobacterium_phage(50.0%) NA NA
DBSCAN-SWA_265 3681269 : 3682745 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_266 3686695 : 3693026 7 Listeria_phage(25.0%) NA NA
DBSCAN-SWA_267 3697123 : 3751195 77 Escherichia_phage(15.0%) capsid,tRNA,plate,terminase,holin NA
DBSCAN-SWA_268 3758219 : 3759734 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_269 3776999 : 3777752 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_270 3784451 : 3796458 12 Burkholderia_phage(28.57%) NA NA
DBSCAN-SWA_271 3802870 : 3810721 4 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_272 3823073 : 3823742 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_273 3864432 : 3869411 3 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_274 3882527 : 3884585 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_275 3897095 : 3897995 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_276 3903539 : 3923372 17 Escherichia_phage(16.67%) transposase NA
DBSCAN-SWA_277 3931550 : 3932519 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_278 3942372 : 3949250 5 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_279 3966994 : 3967975 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_280 3986466 : 3994841 8 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_281 4017634 : 4026551 7 Mycobacterium_phage(25.0%) integrase NA
DBSCAN-SWA_282 4034835 : 4036869 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_283 4047802 : 4057334 10 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_284 4063908 : 4064463 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_285 4068700 : 4069435 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_286 4087272 : 4088793 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_287 4092549 : 4096633 3 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_288 4100749 : 4101607 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_289 4112858 : 4117167 4 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_290 4122926 : 4206529 95 Enterobacteria_phage(17.65%) head,tail,capsid,protease,terminase,holin,portal NA
DBSCAN-SWA_291 4210671 : 4221315 6 Pseudomonas_phage(40.0%) NA NA
DBSCAN-SWA_292 4229924 : 4231130 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_293 4234235 : 4236774 2 Tupanvirus(50.0%) transposase NA
DBSCAN-SWA_294 4258224 : 4258776 1 Escherichia_phage(100.0%) integrase attL 4250757:4250770|attR 4259404:4259417
DBSCAN-SWA_295 4277762 : 4278362 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_296 4290056 : 4291076 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_297 4295603 : 4297539 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_298 4301832 : 4303350 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_299 4309763 : 4310900 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_300 4319307 : 4320393 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_301 4329515 : 4331816 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_302 4336267 : 4337011 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_303 4354712 : 4364563 9 Lactobacillus_phage(25.0%) NA NA
DBSCAN-SWA_304 4368809 : 4377451 10 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_305 4410576 : 4412280 2 Rhodococcus_phage(50.0%) NA NA
DBSCAN-SWA_306 4419548 : 4420838 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_307 4424342 : 4426018 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_308 4438459 : 4438651 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_309 4442650 : 4445649 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_310 4457059 : 4457491 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_311 4466884 : 4473243 8 Mycoplasma_phage(20.0%) NA NA
DBSCAN-SWA_312 4487576 : 4509748 19 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_313 4515523 : 4520042 5 Cafeteria_roenbergensis_virus(25.0%) tRNA NA
DBSCAN-SWA_314 4525341 : 4526640 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_315 4532392 : 4534966 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_316 4541768 : 4542839 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_317 4558081 : 4558564 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_318 4561918 : 4562887 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_319 4567802 : 4569323 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_320 4575234 : 4578719 4 Mollivirus(50.0%) NA NA
DBSCAN-SWA_321 4594008 : 4599299 5 Gordonia_phage(25.0%) NA NA
DBSCAN-SWA_322 4613948 : 4622249 8 Vibrio_phage(20.0%) tRNA NA
DBSCAN-SWA_323 4627829 : 4628795 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_324 4668734 : 4669556 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_325 4677576 : 4678356 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_326 4682994 : 4683963 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_327 4688839 : 4694051 3 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_328 4704933 : 4707495 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_329 4713607 : 4717381 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_330 4720453 : 4722486 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_331 4742195 : 4747520 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_332 4750933 : 4756335 3 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_333 4763764 : 4764610 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_334 4776985 : 4777741 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_335 4788254 : 4790849 3 environmental_halophage(50.0%) tRNA NA
DBSCAN-SWA_336 4795753 : 4796569 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_337 4829567 : 4840680 5 Deep-sea_thermophilic_phage(25.0%) NA NA
DBSCAN-SWA_338 4846147 : 4853015 7 Geobacillus_virus(33.33%) NA NA
DBSCAN-SWA_339 4856025 : 4865181 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_340 4871063 : 4872191 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_341 4880402 : 4882894 2 Aichi_virus(50.0%) NA NA
DBSCAN-SWA_342 4913568 : 4915122 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_343 4920250 : 4921024 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_344 4928307 : 4929864 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_345 4937226 : 4938402 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_346 4941918 : 4944049 3 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_347 4954346 : 4958680 4 Salmonella_phage(50.0%) transposase NA
DBSCAN-SWA_348 4963340 : 4969423 5 Catovirus(25.0%) tRNA NA
DBSCAN-SWA_349 4981644 : 4987624 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_350 4995801 : 4997034 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_351 5014531 : 5016393 2 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_352 5023745 : 5024900 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_353 5031418 : 5032526 1 Leptospira_phage(100.0%) transposase NA
DBSCAN-SWA_354 5044125 : 5045208 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_355 5052267 : 5053638 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_356 5070503 : 5078974 6 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_357 5087704 : 5089600 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_358 5093922 : 5095757 2 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_359 5102810 : 5106095 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_360 5111205 : 5112447 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_361 5121706 : 5161798 49 Escherichia_phage(31.82%) lysis,head,tail,portal,capsid,plate,tRNA,terminase,holin,transposase NA
DBSCAN-SWA_362 5173639 : 5175019 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_363 5179312 : 5180800 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_364 5193151 : 5194120 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_365 5210552 : 5211698 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_366 5216837 : 5217647 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_367 5227283 : 5235700 11 Streptococcus_phage(20.0%) NA NA
DBSCAN-SWA_368 5252101 : 5254063 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_369 5259462 : 5271103 8 Cafeteria_roenbergensis_virus(25.0%) protease NA
DBSCAN-SWA_370 5277689 : 5279132 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_371 5283182 : 5297177 16 Staphylococcus_phage(28.57%) NA NA
DBSCAN-SWA_372 5304318 : 5304807 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_373 5308711 : 5313127 4 uncultured_Mediterranean_phage(50.0%) protease,transposase NA
DBSCAN-SWA_374 5318410 : 5319679 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_375 5338573 : 5339617 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_376 5357018 : 5358126 1 Leptospira_phage(100.0%) transposase NA
DBSCAN-SWA_377 5369582 : 5371054 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_378 5390938 : 5396509 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_379 5402138 : 5414990 12 Tupanvirus(14.29%) NA NA
DBSCAN-SWA_380 5427143 : 5427971 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_381 5442821 : 5448997 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_382 5452490 : 5453249 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_383 5456261 : 5458709 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_384 5468607 : 5470707 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_385 5479735 : 5481543 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_386 5489883 : 5491366 2 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_387 5499873 : 5505633 5 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_388 5508723 : 5512922 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_389 5519224 : 5523331 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_390 5529840 : 5534034 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_391 5548676 : 5550719 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_392 5561681 : 5563759 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_393 5572177 : 5572606 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_394 5609707 : 5615896 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_395 5633176 : 5634148 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_396 5637501 : 5641006 4 Morganella_phage(33.33%) transposase NA
DBSCAN-SWA_397 5644920 : 5645916 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_398 5650745 : 5652287 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_399 5673381 : 5675223 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_400 5691157 : 5700289 9 Rhizobium_phage(20.0%) NA NA
DBSCAN-SWA_401 5713050 : 5714437 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_402 5721288 : 5722936 2 Methanothermobacter_phage(50.0%) NA NA
DBSCAN-SWA_403 5726444 : 5727668 1 Morganella_phage(100.0%) integrase attL 5719810:5719821|attR 5728276:5728287
DBSCAN-SWA_404 5736445 : 5740651 3 Leptospira_phage(100.0%) transposase NA
DBSCAN-SWA_405 5757545 : 5762572 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_406 5777955 : 5778807 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_407 5781929 : 5783321 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_408 5820028 : 5821195 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_409 5825129 : 5826104 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_410 5840851 : 5846193 6 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_411 5858456 : 5864917 7 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_412 5870350 : 5877871 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_413 5882620 : 5885319 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_414 5891208 : 5892546 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_415 5898314 : 5905859 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_416 5920445 : 5921438 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_417 5924608 : 5930484 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_AP014952
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3199 : 12115 8 Macacine_betaherpesvirus(33.33%) NA NA
DBSCAN-SWA_2 42953 : 100534 48 Salmonella_phage(33.33%) transposase NA
DBSCAN-SWA_3 110553 : 159989 53 Stx2-converting_phage(31.58%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage