Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013374 Burkholderia sp. NRF60-BP8 chromosome 3, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP013372 Burkholderia sp. NRF60-BP8 chromosome 2, complete sequence 1 crisprs cas3,csa3,DinG 1 0 1 0
NZ_CP013373 Burkholderia sp. NRF60-BP8 chromosome 1, complete sequence 1 crisprs WYL,csa3,cas3,RT,DEDDh,Cas14u_CAS-V,DinG 0 0 3 0

Results visualization

1. NZ_CP013374
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 245045 : 251419 7 Escherichia_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP013373
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013373_1 1226914-1227027 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 410074 : 428921 22 Pseudomonas_phage(50.0%) protease,integrase,plate attL 410646:410684|attR 415212:415250
DBSCAN-SWA_2 727388 : 736454 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 1077358 : 1085641 8 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP013372
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013372_1 1235879-1235950 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP013372_1 1.1|1235902|26|NZ_CP013372|CRISPRCasFinder 1235902-1235927 26 NZ_CP013373.1 1986669-1986694 2 0.923
NZ_CP013372_1 1.1|1235902|26|NZ_CP013372|CRISPRCasFinder 1235902-1235927 26 NZ_CP013373.1 2703968-2703993 2 0.923
NZ_CP013372_1 1.1|1235902|26|NZ_CP013372|CRISPRCasFinder 1235902-1235927 26 NZ_CP013373.1 2704017-2704042 2 0.923

1. spacer 1.1|1235902|26|NZ_CP013372|CRISPRCasFinder matches to position: 1986669-1986694, mismatch: 2, identity: 0.923

cgcgaagcatgggaccggagtaaccg	CRISPR spacer
cgcgaagcatgggacccgagtaagcg	Protospacer
**************** ****** **

2. spacer 1.1|1235902|26|NZ_CP013372|CRISPRCasFinder matches to position: 2703968-2703993, mismatch: 2, identity: 0.923

cgcgaagcatgggaccggagtaaccg	CRISPR spacer
cgcgaagcatgggatcggagtaagcg	Protospacer
**************.******** **

3. spacer 1.1|1235902|26|NZ_CP013372|CRISPRCasFinder matches to position: 2704017-2704042, mismatch: 2, identity: 0.923

cgcgaagcatgggaccggagtaaccg	CRISPR spacer
cgcgaagcatgggatcggagtaagcg	Protospacer
**************.******** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1639248 : 1646887 15 Mycobacterium_phage(16.67%) integrase attL 1633602:1633616|attR 1657708:1657722
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage