Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011917 Burkholderia cenocepacia strain ST32 chromosome 1, complete sequence 0 crisprs DEDDh,DinG,RT,csa3,PD-DExK,WYL,cas3 0 0 6 0
NZ_CP011918 Burkholderia cenocepacia strain ST32 chromosome 2, complete sequence 1 crisprs csa3,cas3,PD-DExK,RT,DinG 0 0 1 0
NZ_CP011919 Burkholderia cenocepacia strain ST32 chromosome 3, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP011920 Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence 1 crisprs NA 0 2 1 0

Results visualization

1. NZ_CP011917
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 466 : 68817 48 Pseudomonas_phage(18.18%) plate,transposase NA
DBSCAN-SWA_2 263248 : 334279 58 uncultured_virus(62.5%) transposase NA
DBSCAN-SWA_3 345200 : 396682 46 uncultured_virus(30.0%) holin,transposase NA
DBSCAN-SWA_4 2819571 : 2892389 69 Burkholderia_phage(66.67%) plate,tail,holin,transposase,integrase attL 2869763:2869793|attR 2892458:2892488
DBSCAN-SWA_5 3040313 : 3099623 45 Paenibacillus_phage(28.57%) transposase NA
DBSCAN-SWA_6 3512994 : 3522045 7 Hokovirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP011918
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011918_1 173803-173881 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 27356 : 63988 36 Wolbachia_phage(33.33%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP011919
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 935121 : 983927 36 Mycobacterium_phage(20.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP011920
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011920_1 31504-31643 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011920_1 1.1|31524|33|NZ_CP011920|PILER-CR 31524-31556 33 NZ_CP011920 Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence 31524-31556 0 1.0
NZ_CP011920_1 1.2|31577|47|NZ_CP011920|PILER-CR 31577-31623 47 NZ_CP011920 Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence 31577-31623 0 1.0
NZ_CP011920_1 1.2|31577|47|NZ_CP011920|PILER-CR 31577-31623 47 NZ_CP011506 Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence 27361-27407 2 0.957
NZ_CP011920_1 1.1|31524|33|NZ_CP011920|PILER-CR 31524-31556 33 NC_008545 Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence 94200-94232 3 0.909
NZ_CP011920_1 1.1|31524|33|NZ_CP011920|PILER-CR 31524-31556 33 NC_011003 Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence 92403-92435 4 0.879

1. spacer 1.1|31524|33|NZ_CP011920|PILER-CR matches to NZ_CP011920 (Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence) position: , mismatch: 0, identity: 1.0

gtgggcatcttgtgagactccctatggaaaccc	CRISPR spacer
gtgggcatcttgtgagactccctatggaaaccc	Protospacer
*********************************

2. spacer 1.2|31577|47|NZ_CP011920|PILER-CR matches to NZ_CP011920 (Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence) position: , mismatch: 0, identity: 1.0

cgtttagaaccgaggttcatatgtgaccattcaacatcggatctgcg	CRISPR spacer
cgtttagaaccgaggttcatatgtgaccattcaacatcggatctgcg	Protospacer
***********************************************

3. spacer 1.2|31577|47|NZ_CP011920|PILER-CR matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 2, identity: 0.957

cgtttagaaccgaggttcatatgtgaccattcaacatcggatctgcg	CRISPR spacer
cgttaagaaccgaggttcatacgtgaccattcaacatcggatctgcg	Protospacer
**** ****************.*************************

4. spacer 1.1|31524|33|NZ_CP011920|PILER-CR matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

gtgggcatcttgtgagactccctatggaaaccc	CRISPR spacer
ttggacatcttgtgagactccctatagaaaccc	Protospacer
 ***.********************.*******

5. spacer 1.1|31524|33|NZ_CP011920|PILER-CR matches to NC_011003 (Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence) position: , mismatch: 4, identity: 0.879

gtgggcatcttgtgagactccctatggaaaccc	CRISPR spacer
ttggacatcttgtgagactccctatagaaaccg	Protospacer
 ***.********************.****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 962 : 69965 60 Acinetobacter_phage(11.76%) transposase,integrase,plate attL 58831:58846|attR 77655:77670
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage