Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013724 Listeria monocytogenes strain Lm N1546 chromosome, complete genome 3 crisprs DinG,WYL,csa3,cas3,casR,DEDDh 2 10 7 1
NZ_CP013725 Listeria monocytogenes strain Lm N1546 plasmid pLmN1546, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP013724
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013724_1 1340293-1340401 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013724_2 1715886-1716037 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013724_3 2023940-2024417 Orphan I-A
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP013724_3 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT 2023969-2024003 35 NZ_CP013724.1 2768555-2768589 0 1.0
NZ_CP013724_3 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT 2024289-2024324 36 NZ_CP013724.1 2767407-2767442 0 1.0

1. spacer 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT matches to position: 2768555-2768589, mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

2. spacer 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT matches to position: 2767407-2767442, mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013724_3 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT 2023969-2024003 35 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 214611-214645 0 1.0
NZ_CP013724_3 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT 2023969-2024003 35 MT500540 Listeria phage LP-HM00113468, complete genome 39834-39868 0 1.0
NZ_CP013724_3 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT 2023969-2024003 35 KJ094023 Listeria phage LP-101, complete genome 5084-5118 0 1.0
NZ_CP013724_3 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT 2024289-2024324 36 MT500540 Listeria phage LP-HM00113468, complete genome 683-718 0 1.0
NZ_CP013724_3 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT 2024289-2024324 36 NC_009812 Listeria phage B025, complete genome 3896-3931 0 1.0
NZ_CP013724_3 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT 2024289-2024324 36 KJ094023 Listeria phage LP-101, complete genome 3936-3971 0 1.0
NZ_CP013724_3 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT 2024354-2024388 35 DQ003642 Listeria phage A006, complete genome 15712-15746 0 1.0
NZ_CP013724_3 3.3|2024098|35|NZ_CP013724|PILER-CR,CRT 2024098-2024132 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_CP013724_3 3.5|2024225|35|NZ_CP013724|PILER-CR,CRT 2024225-2024259 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
NZ_CP013724_3 3.5|2024225|35|NZ_CP013724|PILER-CR,CRT 2024225-2024259 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
NZ_CP013724_3 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT 2024289-2024324 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213498 1 0.972
NZ_CP013724_3 3.8|2023969|36|NZ_CP013724|CRISPRCasFinder 2023969-2024004 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 214611-214646 1 0.972
NZ_CP013724_3 3.8|2023969|36|NZ_CP013724|CRISPRCasFinder 2023969-2024004 36 MT500540 Listeria phage LP-HM00113468, complete genome 39833-39868 1 0.972
NZ_CP013724_3 3.8|2023969|36|NZ_CP013724|CRISPRCasFinder 2023969-2024004 36 KJ094023 Listeria phage LP-101, complete genome 5084-5119 1 0.972
NZ_CP013724_3 3.10|2024098|36|NZ_CP013724|CRISPRCasFinder 2024098-2024133 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10174 1 0.972
NZ_CP013724_3 3.12|2024225|36|NZ_CP013724|CRISPRCasFinder 2024225-2024260 36 NC_021539 Listeria phage LP-030-2, complete genome 18926-18961 1 0.972
NZ_CP013724_3 3.12|2024225|36|NZ_CP013724|CRISPRCasFinder 2024225-2024260 36 KJ094023 Listeria phage LP-101, complete genome 22882-22917 1 0.972
NZ_CP013724_3 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder 2024289-2024325 37 NC_009812 Listeria phage B025, complete genome 3896-3932 1 0.973
NZ_CP013724_3 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder 2024289-2024325 37 KJ094023 Listeria phage LP-101, complete genome 3936-3972 1 0.973
NZ_CP013724_3 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder 2024289-2024325 37 MT500540 Listeria phage LP-HM00113468, complete genome 682-718 1 0.973
NZ_CP013724_3 3.14|2024354|36|NZ_CP013724|CRISPRCasFinder 2024354-2024389 36 DQ003642 Listeria phage A006, complete genome 15711-15746 1 0.972
NZ_CP013724_3 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT 2023969-2024003 35 NC_009812 Listeria phage B025, complete genome 5044-5078 2 0.943
NZ_CP013724_3 3.3|2024098|35|NZ_CP013724|PILER-CR,CRT 2024098-2024132 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
NZ_CP013724_3 3.5|2024225|35|NZ_CP013724|PILER-CR,CRT 2024225-2024259 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
NZ_CP013724_3 3.10|2024098|36|NZ_CP013724|CRISPRCasFinder 2024098-2024133 36 NC_009813 Listeria phage B054, complete genome 10139-10174 2 0.944
NZ_CP013724_3 3.12|2024225|36|NZ_CP013724|CRISPRCasFinder 2024225-2024260 36 NC_009812 Listeria phage B025, complete genome 23381-23416 2 0.944
NZ_CP013724_3 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder 2024289-2024325 37 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213499 2 0.946
NZ_CP013724_3 3.8|2023969|36|NZ_CP013724|CRISPRCasFinder 2023969-2024004 36 NC_009812 Listeria phage B025, complete genome 5044-5079 3 0.917
NZ_CP013724_3 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT 2024289-2024324 36 JN700520 Staphylococcus phage StB12, complete genome 6832-6867 5 0.861
NZ_CP013724_3 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder 2024289-2024325 37 JN700520 Staphylococcus phage StB12, complete genome 6832-6868 6 0.838
NZ_CP013724_3 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT 2024289-2024324 36 MW084976 Bacillus phage Kirov, complete genome 27565-27600 8 0.778
NZ_CP013724_3 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder 2024289-2024325 37 MW084976 Bacillus phage Kirov, complete genome 27565-27601 9 0.757
NZ_CP013724_3 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT 2024354-2024388 35 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 130632-130666 11 0.686
NZ_CP013724_3 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT 2024354-2024388 35 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 17622-17656 11 0.686
NZ_CP013724_3 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT 2024354-2024388 35 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 31860-31894 11 0.686
NZ_CP013724_3 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT 2024354-2024388 35 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 338888-338922 11 0.686

1. spacer 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

2. spacer 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

3. spacer 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

4. spacer 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

5. spacer 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

6. spacer 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

7. spacer 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

8. spacer 3.3|2024098|35|NZ_CP013724|PILER-CR,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

9. spacer 3.5|2024225|35|NZ_CP013724|PILER-CR,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

10. spacer 3.5|2024225|35|NZ_CP013724|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

11. spacer 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

12. spacer 3.8|2023969|36|NZ_CP013724|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

13. spacer 3.8|2023969|36|NZ_CP013724|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

14. spacer 3.8|2023969|36|NZ_CP013724|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

15. spacer 3.10|2024098|36|NZ_CP013724|CRISPRCasFinder matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.972

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaag	Protospacer
*****************.******************

16. spacer 3.12|2024225|36|NZ_CP013724|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

17. spacer 3.12|2024225|36|NZ_CP013724|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

18. spacer 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

19. spacer 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

20. spacer 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

21. spacer 3.14|2024354|36|NZ_CP013724|CRISPRCasFinder matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.972

tttgttgaatcaacggatatagattttacaatttcg	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttct	Protospacer
*********************************** 

22. spacer 3.1|2023969|35|NZ_CP013724|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
gcagaacaaactccggaagggtgattgtaaatggc	Protospacer
.**** *****************************

23. spacer 3.3|2024098|35|NZ_CP013724|PILER-CR,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

24. spacer 3.5|2024225|35|NZ_CP013724|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

25. spacer 3.10|2024098|36|NZ_CP013724|CRISPRCasFinder matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.944

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaag	Protospacer
*****************.**.***************

26. spacer 3.12|2024225|36|NZ_CP013724|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.944

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctata	Protospacer
*****************.* ****************

27. spacer 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.946

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaaa	Protospacer
****************.*******************.

28. spacer 3.8|2023969|36|NZ_CP013724|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 3, identity: 0.917

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
gcagaacaaactccggaagggtgattgtaaatggct	Protospacer
.**** ***************************** 

29. spacer 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 5, identity: 0.861

aaaataggaggaaataaattatgact-atcaaattaa	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaacta-	Protospacer
 ************.***** ****** ******.** 

30. spacer 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 6, identity: 0.838

aaaataggaggaaataaattatgact-atcaaattaag	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaactat-	Protospacer
 ************.***** ****** ******.**  

31. spacer 3.6|2024289|36|NZ_CP013724|PILER-CR,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.778

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaa	Protospacer
  ***************** ***.*****. *  **

32. spacer 3.13|2024289|37|NZ_CP013724|CRISPRCasFinder matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.757

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaaa	Protospacer
  ***************** ***.*****. *  **.

33. spacer 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

34. spacer 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
aagaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

35. spacer 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

36. spacer 3.7|2024354|35|NZ_CP013724|PILER-CR,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 403653 : 411939 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 924530 : 964326 59 Listeria_phage(92.45%) holin,terminase,tail NA
DBSCAN-SWA_3 1105661 : 1113505 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_4 1394450 : 1404482 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_5 1626270 : 1632795 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_6 2611210 : 2620763 9 Hokovirus(28.57%) NA NA
DBSCAN-SWA_7 2716419 : 2823168 112 Listeria_phage(70.49%) integrase,protease,terminase,holin,portal,tRNA,capsid,tail attL 2728063:2728080|attR 2749966:2749983
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP013724.1|WP_003723550.1|2794315_2794510_-|hypothetical-protein 2794315_2794510_- 64 aa aa NA WHTH_GntR NA 2716419-2823168 yes