Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013201 Arthrobacter alpinus strain ERGS4:06 plasmid pRK01, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP013200 Arthrobacter alpinus strain ERGS4:06 chromosome, complete genome 8 crisprs csa3,PD-DExK,DEDDh,WYL,RT,DinG,cas3 0 1 2 0

Results visualization

1. NZ_CP013200
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013200_1 180432-180506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013200_2 1584370-1584464 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013200_3 1759881-1759970 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013200_4 1970348-1970438 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013200_5 2250230-2250307 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013200_6 2508206-2508330 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013200_7 2751723-2751800 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013200_8 3659524-3659613 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013200_4 4.1|1970376|35|NZ_CP013200|CRISPRCasFinder 1970376-1970410 35 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 583161-583195 10 0.714
NZ_CP013200_4 4.1|1970376|35|NZ_CP013200|CRISPRCasFinder 1970376-1970410 35 NZ_CP046100 Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence 121885-121919 11 0.686

1. spacer 4.1|1970376|35|NZ_CP013200|CRISPRCasFinder matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 10, identity: 0.714

ggtagccggggccgcatcagggttcgggagatcag	CRISPR spacer
gaaggccgggcccgcatccgggttcgggaactgga	Protospacer
*. .****** ******* **********. * ..

2. spacer 4.1|1970376|35|NZ_CP013200|CRISPRCasFinder matches to NZ_CP046100 (Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

ggtagccggggccgcatcagggttcgggagatcag	CRISPR spacer
caaggccgggcccgcatccgggttcgggaactgga	Protospacer
 . .****** ******* **********. * ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1266660 : 1275567 8 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 2112780 : 2141855 25 Arthrobacter_phage(40.0%) integrase,transposase attL 2129659:2129673|attR 2145826:2145840
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage