Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP006370 Aureimonas sp. AU20 plasmid pAU20c, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 1 crisprs csa3,DEDDh 0 3 0 0
NZ_CP006373 Aureimonas sp. AU20 plasmid pAU20f, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP006372 Aureimonas sp. AU20 plasmid pAU20e, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP006375 Aureimonas sp. AU20 plasmid pAU20rrn, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP006374 Aureimonas sp. AU20 plasmid pAU20g, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP006371 Aureimonas sp. AU20 plasmid pAU20d, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP006367 Aureimonas sp. AU20 chromosome, complete genome 0 crisprs DEDDh,csa3,WYL,cas3 0 0 4 0

Results visualization

1. NZ_CP006369
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006369_1 28579-28723 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006369_1 1.1|28598|23|NZ_CP006369|CRT 28598-28620 23 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 28598-28620 0 1.0
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 28640-28662 0 1.0
NZ_CP006369_1 1.3|28682|23|NZ_CP006369|CRT 28682-28704 23 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 28682-28704 0 1.0
NZ_CP006369_1 1.1|28598|23|NZ_CP006369|CRT 28598-28620 23 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 436946-436968 2 0.913
NZ_CP006369_1 1.1|28598|23|NZ_CP006369|CRT 28598-28620 23 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 436946-436968 2 0.913
NZ_CP006369_1 1.1|28598|23|NZ_CP006369|CRT 28598-28620 23 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 435387-435409 2 0.913
NZ_CP006369_1 1.1|28598|23|NZ_CP006369|CRT 28598-28620 23 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 439634-439656 2 0.913
NZ_CP006369_1 1.1|28598|23|NZ_CP006369|CRT 28598-28620 23 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 433753-433775 2 0.913
NZ_CP006369_1 1.1|28598|23|NZ_CP006369|CRT 28598-28620 23 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 436946-436968 2 0.913
NZ_CP006369_1 1.3|28682|23|NZ_CP006369|CRT 28682-28704 23 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 1236-1258 2 0.913
NZ_CP006369_1 1.3|28682|23|NZ_CP006369|CRT 28682-28704 23 MF377442 Arthrobacter phage Franzy, complete genome 14610-14632 2 0.913
NZ_CP006369_1 1.3|28682|23|NZ_CP006369|CRT 28682-28704 23 NC_041930 Arthrobacter phage Brent, complete genome 14610-14632 2 0.913
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 665073-665095 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1332133-1332155 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 678934-678956 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 605218-605240 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 556651-556673 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1125771-1125793 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 1173556-1173578 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 1061413-1061435 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 250785-250807 3 0.87
NZ_CP006369_1 1.2|28640|23|NZ_CP006369|CRT 28640-28662 23 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1211966-1211988 3 0.87
NZ_CP006369_1 1.3|28682|23|NZ_CP006369|CRT 28682-28704 23 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3496854-3496876 3 0.87

1. spacer 1.1|28598|23|NZ_CP006369|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 0, identity: 1.0

agctggggcagggaacggtcgag	CRISPR spacer
agctggggcagggaacggtcgag	Protospacer
***********************

2. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgagccgcggcatttccgaa	Protospacer
***********************

3. spacer 1.3|28682|23|NZ_CP006369|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 0, identity: 1.0

ggctcagccagggcgccacggaa	CRISPR spacer
ggctcagccagggcgccacggaa	Protospacer
***********************

4. spacer 1.1|28598|23|NZ_CP006369|CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 2, identity: 0.913

agctggggcagggaacggtcgag	CRISPR spacer
agcttgggcagggaaaggtcgag	Protospacer
**** ********** *******

5. spacer 1.1|28598|23|NZ_CP006369|CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 2, identity: 0.913

agctggggcagggaacggtcgag	CRISPR spacer
agcttgggcagggaaaggtcgag	Protospacer
**** ********** *******

6. spacer 1.1|28598|23|NZ_CP006369|CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 2, identity: 0.913

agctggggcagggaacggtcgag	CRISPR spacer
agcttgggcagggaaaggtcgag	Protospacer
**** ********** *******

7. spacer 1.1|28598|23|NZ_CP006369|CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 2, identity: 0.913

agctggggcagggaacggtcgag	CRISPR spacer
agcttgggcagggaaaggtcgag	Protospacer
**** ********** *******

8. spacer 1.1|28598|23|NZ_CP006369|CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 2, identity: 0.913

agctggggcagggaacggtcgag	CRISPR spacer
agcttgggcagggaaaggtcgag	Protospacer
**** ********** *******

9. spacer 1.1|28598|23|NZ_CP006369|CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 2, identity: 0.913

agctggggcagggaacggtcgag	CRISPR spacer
agcttgggcagggaaaggtcgag	Protospacer
**** ********** *******

10. spacer 1.3|28682|23|NZ_CP006369|CRT matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.913

ggctcagccagggcgccacggaa	CRISPR spacer
ggctcggccagggcgccatggaa	Protospacer
*****.************.****

11. spacer 1.3|28682|23|NZ_CP006369|CRT matches to MF377442 (Arthrobacter phage Franzy, complete genome) position: , mismatch: 2, identity: 0.913

ggctcagccagggcgccacggaa	CRISPR spacer
ggctcggccatggcgccacggaa	Protospacer
*****.**** ************

12. spacer 1.3|28682|23|NZ_CP006369|CRT matches to NC_041930 (Arthrobacter phage Brent, complete genome) position: , mismatch: 2, identity: 0.913

ggctcagccagggcgccacggaa	CRISPR spacer
ggctcggccatggcgccacggaa	Protospacer
*****.**** ************

13. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgcgccgcggcatttccgct	Protospacer
***** ***************  

14. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgcgccgcggcatttccgct	Protospacer
***** ***************  

15. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgcgccgcggcatttccgct	Protospacer
***** ***************  

16. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgcgccgcggcatttccgct	Protospacer
***** ***************  

17. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgggccgcggcatttccgct	Protospacer
*****.***************  

18. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgggccgcggcatttccgct	Protospacer
*****.***************  

19. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgcgccgcggcatttccgct	Protospacer
***** ***************  

20. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgggccgcggcatttccgct	Protospacer
*****.***************  

21. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgcgccgcggcatttccgct	Protospacer
***** ***************  

22. spacer 1.2|28640|23|NZ_CP006369|CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 3, identity: 0.87

ttctgagccgcggcatttccgaa	CRISPR spacer
ttctgggccgcggcatttccgct	Protospacer
*****.***************  

23. spacer 1.3|28682|23|NZ_CP006369|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.87

ggctcagccagggcgccacggaa	CRISPR spacer
ggctcaggcagggcgccacggcc	Protospacer
******* *************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP006368
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006368_1 479230-479346 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006368_1 1.1|479263|51|NZ_CP006368|CRISPRCasFinder 479263-479313 51 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 479263-479313 0 1.0

1. spacer 1.1|479263|51|NZ_CP006368|CRISPRCasFinder matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgctggtctgctgcgccacctggtcgatctgcgcggccgactgcgtgac	CRISPR spacer
ggcgctggtctgctgcgccacctggtcgatctgcgcggccgactgcgtgac	Protospacer
***************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP006367
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2498000 : 2513083 13 uncultured_Mediterranean_phage(55.56%) tRNA NA
DBSCAN-SWA_2 2615126 : 2626458 11 uncultured_Mediterranean_phage(75.0%) tRNA NA
DBSCAN-SWA_3 2768126 : 2785002 19 Sinorhizobium_phage(20.0%) integrase,tail,protease,capsid,terminase,portal,head attL 2764205:2764218|attR 2771145:2771158
DBSCAN-SWA_4 3108997 : 3169387 57 Paracoccus_phage(16.67%) tRNA,tail,protease,capsid,portal,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP006371
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006371_1 2468-2583 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006371_1 1.1|2508|36|NZ_CP006371|CRISPRCasFinder 2508-2543 36 NZ_CP006371 Aureimonas sp. AU20 plasmid pAU20d, complete sequence 2508-2543 0 1.0

1. spacer 1.1|2508|36|NZ_CP006371|CRISPRCasFinder matches to NZ_CP006371 (Aureimonas sp. AU20 plasmid pAU20d, complete sequence) position: , mismatch: 0, identity: 1.0

gttggtctgagtgacacgcatgttcgggggcgctcg	CRISPR spacer
gttggtctgagtgacacgcatgttcgggggcgctcg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage