Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012924 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 chromosome, complete genome 3 crisprs WYL,DinG,cas3,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 39 9 0
NZ_CP012927 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP012925 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP012929 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence 0 crisprs DEDDh,cas14j 0 0 0 0
NZ_CP012928 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_62, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 1 crisprs NA 0 1 0 0

Results visualization

1. NZ_CP012924
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012924_1 2852099-2852208 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012924_2 3043221-3044883 TypeI-E I-E
26 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012924_3 3061141-3062267 TypeI-E I-E
18 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012924_2 2.8|3043677|28|NZ_CP012924|PILER-CR 3043677-3043704 28 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 337987-338014 5 0.821
NZ_CP012924_2 2.11|3043856|32|NZ_CP012924|PILER-CR 3043856-3043887 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
NZ_CP012924_2 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder 3043841-3043872 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
NZ_CP012924_2 2.7|3043616|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3043616-3043647 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
NZ_CP012924_2 2.7|3043616|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3043616-3043647 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
NZ_CP012924_2 2.7|3043616|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3043616-3043647 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
NZ_CP012924_2 2.11|3043856|32|NZ_CP012924|PILER-CR 3043856-3043887 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
NZ_CP012924_2 2.11|3043856|32|NZ_CP012924|PILER-CR 3043856-3043887 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
NZ_CP012924_2 2.11|3043856|32|NZ_CP012924|PILER-CR 3043856-3043887 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
NZ_CP012924_2 2.11|3043856|32|NZ_CP012924|PILER-CR 3043856-3043887 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
NZ_CP012924_2 2.14|3044039|32|NZ_CP012924|PILER-CR 3044039-3044070 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
NZ_CP012924_2 2.16|3044161|32|NZ_CP012924|PILER-CR 3044161-3044192 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
NZ_CP012924_2 2.16|3044161|32|NZ_CP012924|PILER-CR 3044161-3044192 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NZ_CP031397 Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence 50725-50756 7 0.781
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NZ_CP019854 Borreliella burgdorferi plasmid lp54, complete sequence 50437-50468 7 0.781
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NZ_CP019765 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence 50437-50468 7 0.781
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NC_011784 Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence 50424-50455 7 0.781
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NZ_CP017218 Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence 3204-3235 7 0.781
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NC_013130 Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence 50571-50602 7 0.781
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NC_013129 Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence 49716-49747 7 0.781
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NC_001857 Borreliella burgdorferi B31 plasmid lp54, complete sequence 50444-50475 7 0.781
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 MH509446 Gordonia phage DelRio, complete genome 6223-6260 7 0.816
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 325874-325911 7 0.816
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 248-285 7 0.816
NZ_CP012924_2 2.25|3044716|32|NZ_CP012924|PILER-CR 3044716-3044747 32 DQ838728 Lactococcus phage P335, complete genome 1117-1148 7 0.781
NZ_CP012924_2 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder 3043841-3043872 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
NZ_CP012924_2 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder 3043841-3043872 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
NZ_CP012924_2 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder 3043841-3043872 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
NZ_CP012924_2 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder 3043841-3043872 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
NZ_CP012924_2 2.33|3044024|32|NZ_CP012924|CRT,CRISPRCasFinder 3044024-3044055 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
NZ_CP012924_2 2.35|3044146|32|NZ_CP012924|CRT,CRISPRCasFinder 3044146-3044177 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
NZ_CP012924_2 2.35|3044146|32|NZ_CP012924|CRT,CRISPRCasFinder 3044146-3044177 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NZ_CP031397 Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence 50725-50756 7 0.781
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NZ_CP019854 Borreliella burgdorferi plasmid lp54, complete sequence 50437-50468 7 0.781
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NZ_CP019765 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence 50437-50468 7 0.781
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NC_011784 Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence 50424-50455 7 0.781
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NZ_CP017218 Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence 3204-3235 7 0.781
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NC_013130 Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence 50571-50602 7 0.781
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NC_013129 Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence 49716-49747 7 0.781
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NC_001857 Borreliella burgdorferi B31 plasmid lp54, complete sequence 50444-50475 7 0.781
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 MH509446 Gordonia phage DelRio, complete genome 6223-6260 7 0.816
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 325874-325911 7 0.816
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 248-285 7 0.816
NZ_CP012924_2 2.44|3044701|32|NZ_CP012924|CRT,CRISPRCasFinder 3044701-3044732 32 DQ838728 Lactococcus phage P335, complete genome 1117-1148 7 0.781
NZ_CP012924_3 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061902-3061933 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
NZ_CP012924_3 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061902-3061933 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
NZ_CP012924_3 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061902-3061933 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
NZ_CP012924_2 2.2|3043311|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3043311-3043342 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
NZ_CP012924_2 2.6|3043555|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3043555-3043586 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
NZ_CP012924_2 2.6|3043555|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3043555-3043586 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
NZ_CP012924_2 2.15|3044100|32|NZ_CP012924|PILER-CR 3044100-3044131 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
NZ_CP012924_2 2.19|3044344|32|NZ_CP012924|PILER-CR 3044344-3044375 32 AP013976 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS *** 6246-6277 8 0.75
NZ_CP012924_2 2.19|3044344|32|NZ_CP012924|PILER-CR 3044344-3044375 32 JX536274 Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence 3959-3990 8 0.75
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336385-336422 8 0.789
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619925-619962 8 0.789
NZ_CP012924_2 2.25|3044716|32|NZ_CP012924|PILER-CR 3044716-3044747 32 NC_014754 Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence 76425-76456 8 0.75
NZ_CP012924_2 2.34|3044085|32|NZ_CP012924|CRT,CRISPRCasFinder 3044085-3044116 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
NZ_CP012924_2 2.38|3044329|32|NZ_CP012924|CRT,CRISPRCasFinder 3044329-3044360 32 AP013976 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS *** 6246-6277 8 0.75
NZ_CP012924_2 2.38|3044329|32|NZ_CP012924|CRT,CRISPRCasFinder 3044329-3044360 32 JX536274 Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence 3959-3990 8 0.75
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336385-336422 8 0.789
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619925-619962 8 0.789
NZ_CP012924_2 2.44|3044701|32|NZ_CP012924|CRT,CRISPRCasFinder 3044701-3044732 32 NC_014754 Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence 76425-76456 8 0.75
NZ_CP012924_3 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061414-3061445 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
NZ_CP012924_3 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061414-3061445 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
NZ_CP012924_3 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061414-3061445 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
NZ_CP012924_3 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061414-3061445 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
NZ_CP012924_3 3.7|3061536|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061536-3061567 32 LQ277707 Sequence 2 from Patent WO2016071503 12422-12453 8 0.75
NZ_CP012924_3 3.7|3061536|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061536-3061567 32 LZ998055 JP 2017534684-A/2: Phage Therapy 12422-12453 8 0.75
NZ_CP012924_3 3.8|3061597|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061597-3061628 32 CP001770 Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence 145771-145802 8 0.75
NZ_CP012924_3 3.18|3062207|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3062207-3062238 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
NZ_CP012924_2 2.11|3043856|32|NZ_CP012924|PILER-CR 3043856-3043887 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
NZ_CP012924_2 2.18|3044283|32|NZ_CP012924|PILER-CR 3044283-3044314 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 24080-24111 9 0.719
NZ_CP012924_2 2.25|3044716|32|NZ_CP012924|PILER-CR 3044716-3044747 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 527800-527831 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP043846 Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence 16198-16229 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP034117 Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence 10125-10156 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP034114 Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence 2991-3022 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 177881-177912 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 183537-183568 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP026804 Shigella flexneri strain 89-141 plasmid unnamed1 244387-244418 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 180101-180132 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 161475-161506 9 0.719
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 182902-182933 9 0.719
NZ_CP012924_2 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder 3043841-3043872 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
NZ_CP012924_2 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder 3044268-3044299 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 24080-24111 9 0.719
NZ_CP012924_2 2.44|3044701|32|NZ_CP012924|CRT,CRISPRCasFinder 3044701-3044732 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 527800-527831 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP043846 Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence 16198-16229 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP034117 Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence 10125-10156 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP034114 Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence 2991-3022 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 177881-177912 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 183537-183568 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP026804 Shigella flexneri strain 89-141 plasmid unnamed1 244387-244418 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 180101-180132 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 161475-161506 9 0.719
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 182902-182933 9 0.719
NZ_CP012924_3 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061414-3061445 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
NZ_CP012924_3 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061414-3061445 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
NZ_CP012924_3 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061414-3061445 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
NZ_CP012924_3 3.10|3061719|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061719-3061750 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
NZ_CP012924_3 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061902-3061933 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
NZ_CP012924_3 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061902-3061933 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
NZ_CP012924_3 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061902-3061933 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
NZ_CP012924_3 3.14|3061963|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061963-3061994 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
NZ_CP012924_3 3.14|3061963|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061963-3061994 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
NZ_CP012924_3 3.17|3062146|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3062146-3062177 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
NZ_CP012924_3 3.17|3062146|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3062146-3062177 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
NZ_CP012924_3 3.17|3062146|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3062146-3062177 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
NZ_CP012924_2 2.1|3043250|32|NZ_CP012924|CRISPRCasFinder,CRT 3043250-3043281 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP012924_2 2.1|3043250|32|NZ_CP012924|CRISPRCasFinder,CRT 3043250-3043281 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP012924_2 2.13|3043978|32|NZ_CP012924|PILER-CR 3043978-3044009 32 NC_024995 Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119 5043-5074 10 0.688
NZ_CP012924_2 2.18|3044283|32|NZ_CP012924|PILER-CR 3044283-3044314 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
NZ_CP012924_2 2.18|3044283|32|NZ_CP012924|PILER-CR 3044283-3044314 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
NZ_CP012924_2 2.18|3044283|32|NZ_CP012924|PILER-CR 3044283-3044314 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
NZ_CP012924_2 2.18|3044283|32|NZ_CP012924|PILER-CR 3044283-3044314 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
NZ_CP012924_2 2.18|3044283|32|NZ_CP012924|PILER-CR 3044283-3044314 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
NZ_CP012924_2 2.19|3044344|32|NZ_CP012924|PILER-CR 3044344-3044375 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53286 10 0.688
NZ_CP012924_2 2.20|3044405|32|NZ_CP012924|PILER-CR 3044405-3044436 32 NZ_CP012188 Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence 53401-53432 10 0.688
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 45638-45675 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 47029-47066 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 MN539017 Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence 71631-71668 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 MN539018 Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence 121312-121349 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 MT077888 Escherichia coli plasmid p65, complete sequence 47123-47160 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 46527-46564 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP044306 Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence 130757-130794 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 69614-69651 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 195971-196008 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 41259-41296 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 45070-45107 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 239704-239741 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 45070-45107 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 43320-43357 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 47029-47066 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 5920-5957 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 240141-240178 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 73185-73222 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_KY689633 Escherichia coli strain 100R plasmid p100R, complete sequence 90192-90229 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_KY689632 Escherichia coli strain 19-M12 plasmid p19M12, complete sequence 93444-93481 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 47435-47472 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_KU743384 Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence 181822-181859 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_KU254578 Escherichia coli strain YD786 plasmid pYD786-1, complete sequence 164955-164992 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_KX129782 Escherichia coli strain S38 plasmid pS38, complete sequence 46423-46460 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP015833 Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence 45075-45112 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 LT221036 Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence 41890-41927 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 98508-98545 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 47434-47471 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 MN732922 Escherichia coli strain 49K plasmid unnamed, complete sequence 70876-70913 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP020493 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence 47990-48027 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 60929-60966 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 CP042895 Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence 106230-106267 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP022735 Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence 61639-61676 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 CP042898 Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence 125697-125734 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP022165 Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence 45073-45110 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 119613-119650 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP023143 Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence 136437-136474 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP026936 Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence 46422-46459 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP025402 Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence 182643-182680 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP026933 Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence 46272-46309 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_MH924589 Escherichia coli strain RDB9 plasmid pRDB9, complete sequence 197020-197057 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_MH208235 Escherichia coli strain APECA2 plasmid pJMA2, complete sequence 166860-166897 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_MK169211 Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence 46085-46122 10 0.737
NZ_CP012924_2 2.24|3044649|38|NZ_CP012924|PILER-CR 3044649-3044686 38 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 46814-46851 10 0.737
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP044540 Borrelia sp. CA690 plasmid lp17, complete sequence 10481-10512 10 0.688
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_LR215005 Mycoplasma conjunctivae strain NCTC10147 plasmid 9 126578-126609 10 0.688
NZ_CP012924_2 2.32|3043963|32|NZ_CP012924|CRT,CRISPRCasFinder 3043963-3043994 32 NC_024995 Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119 5043-5074 10 0.688
NZ_CP012924_2 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder 3044268-3044299 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
NZ_CP012924_2 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder 3044268-3044299 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
NZ_CP012924_2 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder 3044268-3044299 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
NZ_CP012924_2 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder 3044268-3044299 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
NZ_CP012924_2 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder 3044268-3044299 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
NZ_CP012924_2 2.38|3044329|32|NZ_CP012924|CRT,CRISPRCasFinder 3044329-3044360 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53286 10 0.688
NZ_CP012924_2 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder 3044390-3044421 32 NZ_CP012188 Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence 53401-53432 10 0.688
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 45638-45675 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 47029-47066 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 MN539017 Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence 71631-71668 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 MN539018 Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence 121312-121349 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 MT077888 Escherichia coli plasmid p65, complete sequence 47123-47160 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 46527-46564 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP044306 Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence 130757-130794 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 69614-69651 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 195971-196008 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 41259-41296 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 45070-45107 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 239704-239741 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 45070-45107 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 43320-43357 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 47029-47066 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 5920-5957 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 240141-240178 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 73185-73222 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_KY689633 Escherichia coli strain 100R plasmid p100R, complete sequence 90192-90229 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_KY689632 Escherichia coli strain 19-M12 plasmid p19M12, complete sequence 93444-93481 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 47435-47472 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_KU743384 Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence 181822-181859 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_KU254578 Escherichia coli strain YD786 plasmid pYD786-1, complete sequence 164955-164992 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_KX129782 Escherichia coli strain S38 plasmid pS38, complete sequence 46423-46460 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP015833 Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence 45075-45112 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 LT221036 Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence 41890-41927 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 98508-98545 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 47434-47471 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 MN732922 Escherichia coli strain 49K plasmid unnamed, complete sequence 70876-70913 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP020493 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence 47990-48027 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 60929-60966 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 CP042895 Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence 106230-106267 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP022735 Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence 61639-61676 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 CP042898 Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence 125697-125734 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP022165 Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence 45073-45110 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 119613-119650 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP023143 Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence 136437-136474 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP026936 Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence 46422-46459 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP025402 Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence 182643-182680 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP026933 Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence 46272-46309 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_MH924589 Escherichia coli strain RDB9 plasmid pRDB9, complete sequence 197020-197057 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_MH208235 Escherichia coli strain APECA2 plasmid pJMA2, complete sequence 166860-166897 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_MK169211 Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence 46085-46122 10 0.737
NZ_CP012924_2 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder 3044634-3044671 38 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 46814-46851 10 0.737
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP044540 Borrelia sp. CA690 plasmid lp17, complete sequence 10481-10512 10 0.688
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_LR215005 Mycoplasma conjunctivae strain NCTC10147 plasmid 9 126578-126609 10 0.688
NZ_CP012924_3 3.1|3061170|32|NZ_CP012924|CRISPRCasFinder,CRT 3061170-3061201 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
NZ_CP012924_3 3.4|3061353|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061353-3061384 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
NZ_CP012924_3 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061658-3061689 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
NZ_CP012924_3 3.16|3062085|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3062085-3062116 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
NZ_CP012924_2 2.27|3044838|32|NZ_CP012924|PILER-CR 3044838-3044869 32 NZ_CP041669 Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence 45678-45709 11 0.656
NZ_CP012924_2 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder 3044823-3044854 32 NZ_CP041669 Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence 45678-45709 11 0.656
NZ_CP012924_3 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061902-3061933 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
NZ_CP012924_3 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR 3061902-3061933 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656

1. spacer 2.8|3043677|28|NZ_CP012924|PILER-CR matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 5, identity: 0.821

gatcgagtaacgtgcgctggaacgcgtc	CRISPR spacer
gattgaggaacgtgcgctggaacgatta	Protospacer
***.*** ****************  * 

2. spacer 2.11|3043856|32|NZ_CP012924|PILER-CR matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  . 

3. spacer 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  . 

4. spacer 2.7|3043616|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

5. spacer 2.7|3043616|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

6. spacer 2.7|3043616|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

7. spacer 2.11|3043856|32|NZ_CP012924|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

8. spacer 2.11|3043856|32|NZ_CP012924|PILER-CR matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

9. spacer 2.11|3043856|32|NZ_CP012924|PILER-CR matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

10. spacer 2.11|3043856|32|NZ_CP012924|PILER-CR matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

11. spacer 2.14|3044039|32|NZ_CP012924|PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagcgggcgaggcaaacacattcggggcgt	CRISPR spacer
gccacggcgcgaggcaaacacattcaggtcgc	Protospacer
* **  * *****************.** **.

12. spacer 2.16|3044161|32|NZ_CP012924|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  * 

13. spacer 2.16|3044161|32|NZ_CP012924|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  * 

14. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NZ_CP031397 (Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

15. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NZ_CP019854 (Borreliella burgdorferi plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

16. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NZ_CP019765 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

17. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NC_011784 (Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

18. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NZ_CP017218 (Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

19. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NC_013130 (Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

20. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NC_013129 (Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

21. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NC_001857 (Borreliella burgdorferi B31 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

22. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtttcggtctcggtcgcggtctcggtgccctcg	Protospacer
*******.************ **********. .  **

23. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tcgcggtctcggtctcggtctcggtcttgtcggcggcg	Protospacer
** ************************.* ..*.*.**

24. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcg-gtagtgacg	CRISPR spacer
gctcggtctcagtctcggtctcagtctcgcgtgggggc-	Protospacer
 *********.***********.****** **.* *.* 

25. spacer 2.25|3044716|32|NZ_CP012924|PILER-CR matches to DQ838728 (Lactococcus phage P335, complete genome) position: , mismatch: 7, identity: 0.781

attttatttgacaaattggcggcatctcactg-	CRISPR spacer
ttgttatttcagaaattggcggcatc-cgctat	Protospacer
 * ****** * ************** *.**. 

26. spacer 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

27. spacer 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

28. spacer 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

29. spacer 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

30. spacer 2.33|3044024|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagcgggcgaggcaaacacattcggggcgt	CRISPR spacer
gccacggcgcgaggcaaacacattcaggtcgc	Protospacer
* **  * *****************.** **.

31. spacer 2.35|3044146|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  * 

32. spacer 2.35|3044146|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  * 

33. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP031397 (Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

34. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP019854 (Borreliella burgdorferi plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

35. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP019765 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

36. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_011784 (Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

37. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP017218 (Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

38. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_013130 (Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

39. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_013129 (Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

40. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_001857 (Borreliella burgdorferi B31 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

41. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtttcggtctcggtcgcggtctcggtgccctcg	Protospacer
*******.************ **********. .  **

42. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tcgcggtctcggtctcggtctcggtcttgtcggcggcg	Protospacer
** ************************.* ..*.*.**

43. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcg-gtagtgacg	CRISPR spacer
gctcggtctcagtctcggtctcagtctcgcgtgggggc-	Protospacer
 *********.***********.****** **.* *.* 

44. spacer 2.44|3044701|32|NZ_CP012924|CRT,CRISPRCasFinder matches to DQ838728 (Lactococcus phage P335, complete genome) position: , mismatch: 7, identity: 0.781

attttatttgacaaattggcggcatctcactg-	CRISPR spacer
ttgttatttcagaaattggcggcatc-cgctat	Protospacer
 * ****** * ************** *.**. 

45. spacer 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

---gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ttcgagc---atgaccggatcggcgctggtgccga	Protospacer
   *.**   **** *************.*****.

46. spacer 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ggcggcggtgaaaggatcggcggtgatgccgg	Protospacer
**  .* .**** ********* *********

47. spacer 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

---gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ttcgagc---atgaccggatcggcgctggtgccga	Protospacer
   *.**   **** *************.*****.

48. spacer 2.2|3043311|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75

gcgaaatagtggggaaaaacccctggttaacc	CRISPR spacer
tttcaatattggggaaaaacccctcgttacct	Protospacer
 .  **** *************** **** *.

49. spacer 2.6|3043555|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

50. spacer 2.6|3043555|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

51. spacer 2.15|3044100|32|NZ_CP012924|PILER-CR matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggtaatttctcatctaacagcct-----gtacgcctc	CRISPR spacer
ggtaatttcgcatcaaacagccttattagtat-----	Protospacer
********* **** ********     ***.     

52. spacer 2.19|3044344|32|NZ_CP012924|PILER-CR matches to AP013976 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    *** 

53. spacer 2.19|3044344|32|NZ_CP012924|PILER-CR matches to JX536274 (Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence) position: , mismatch: 8, identity: 0.75

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    *** 

54. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.789

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtctcggtctcggtctcggtctcgacgacgctt	Protospacer
*****************************.....* . 

55. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.789

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
cctcggtctcggcctcggcctcggtctcggcctcggcg	Protospacer
.***********.*****.***********.  .*.**

56. spacer 2.25|3044716|32|NZ_CP012924|PILER-CR matches to NC_014754 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence) position: , mismatch: 8, identity: 0.75

attttatttgacaaattggcggcatctcactg	CRISPR spacer
cctttttttgtcaaattggcggcatacggctg	Protospacer
 .*** **** ************** . .***

57. spacer 2.34|3044085|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggtaatttctcatctaacagcct-----gtacgcctc	CRISPR spacer
ggtaatttcgcatcaaacagccttattagtat-----	Protospacer
********* **** ********     ***.     

58. spacer 2.38|3044329|32|NZ_CP012924|CRT,CRISPRCasFinder matches to AP013976 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    *** 

59. spacer 2.38|3044329|32|NZ_CP012924|CRT,CRISPRCasFinder matches to JX536274 (Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence) position: , mismatch: 8, identity: 0.75

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    *** 

60. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.789

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtctcggtctcggtctcggtctcgacgacgctt	Protospacer
*****************************.....* . 

61. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.789

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
cctcggtctcggcctcggcctcggtctcggcctcggcg	Protospacer
.***********.*****.***********.  .*.**

62. spacer 2.44|3044701|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_014754 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence) position: , mismatch: 8, identity: 0.75

attttatttgacaaattggcggcatctcactg	CRISPR spacer
cctttttttgtcaaattggcggcatacggctg	Protospacer
 .*** **** ************** . .***

63. spacer 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

-gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
cagcggatcc-ttgccggtatagaccagcgtat	Protospacer
 . ** .*.* ********************  

64. spacer 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gaattttacgttgccggtgtagaccagtgtca	Protospacer
*   . * **********.********.****

65. spacer 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gaattttacgttgccggtgtagaccagtgtca	Protospacer
*   . * **********.********.****

66. spacer 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gatccggacgttgccggtattgaacagcgtcc	Protospacer
* . **  ************ ** ******* 

67. spacer 3.7|3061536|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to LQ277707 (Sequence 2 from Patent WO2016071503) position: , mismatch: 8, identity: 0.75

----gctcatgtcaaacgccatcagcgttccggcat	CRISPR spacer
aaaggct----gcaaacgccaatagcgttccggcaa	Protospacer
    ***     ********* .************ 

68. spacer 3.7|3061536|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to LZ998055 (JP 2017534684-A/2: Phage Therapy) position: , mismatch: 8, identity: 0.75

----gctcatgtcaaacgccatcagcgttccggcat	CRISPR spacer
aaaggct----gcaaacgccaatagcgttccggcaa	Protospacer
    ***     ********* .************ 

69. spacer 3.8|3061597|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 8, identity: 0.75

aatcgccagcctcggaaatattccatcctccg	CRISPR spacer
ggttgccagccccggaagtattccatctccca	Protospacer
..*.*******.*****.*********..**.

70. spacer 3.18|3062207|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

taatggccacagtaagtcaaacggttctggaa	CRISPR spacer
cggtggccacagtaaggcacacggttcggcag	Protospacer
...************* ** ******* * *.

71. spacer 2.11|3043856|32|NZ_CP012924|PILER-CR matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******   

72. spacer 2.18|3044283|32|NZ_CP012924|PILER-CR matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719

tcccattcaccaacaacaatatcgccctgcaa----	CRISPR spacer
ccccaatcaccaacaataatatcgt----cagtgtt	Protospacer
.**** **********.*******.    **.    

73. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.719

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
aaattggatcgtcaatgaatttattggcgctg	Protospacer
 .** ..*********.** **********  

74. spacer 2.25|3044716|32|NZ_CP012924|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

attttatttgacaaattggcggcatctcactg	CRISPR spacer
attctatttgacacattggcggcgccgagcca	Protospacer
***.********* *********..*  .*..

75. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP043846 (Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

76. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP034117 (Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

77. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP034114 (Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

78. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

79. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

80. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
tgtaataatcaataattttattgatttttcga	Protospacer
  *. * **** *.****************  

81. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

82. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

83. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

84. spacer 2.30|3043841|32|NZ_CP012924|CRT,CRISPRCasFinder matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******   

85. spacer 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719

tcccattcaccaacaacaatatcgccctgcaa----	CRISPR spacer
ccccaatcaccaacaataatatcgt----cagtgtt	Protospacer
.**** **********.*******.    **.    

86. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.719

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
aaattggatcgtcaatgaatttattggcgctg	Protospacer
 .** ..*********.** **********  

87. spacer 2.44|3044701|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

attttatttgacaaattggcggcatctcactg	CRISPR spacer
attctatttgacacattggcggcgccgagcca	Protospacer
***.********* *********..*  .*..

88. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP043846 (Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

89. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP034117 (Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

90. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP034114 (Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

91. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

92. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

93. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
tgtaataatcaataattttattgatttttcga	Protospacer
  *. * **** *.****************  

94. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

95. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

96. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

97. spacer 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaacttgacgttgccggtatagatcagcgtca	Protospacer
.   .   ***************.********

98. spacer 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaacttgacgttgccggtatagatcagcgtca	Protospacer
.   .   ***************.********

99. spacer 3.5|3061414|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaattttacgttgccggtgtagaccagtgtca	Protospacer
.   . * **********.********.****

100. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
tcctcctggacaggctgaccgttgacgatctg	Protospacer
     **..**** *********** ******

101. spacer 3.10|3061719|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719

accggacaaatcttttttttcctgttcctgtt	CRISPR spacer
gcatcattaatcctttttttcctgttactgta	Protospacer
.*   *. ****.************* **** 

102. spacer 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cagtttgctgaactgctcggcgctgatgccgg	Protospacer
 .*. .  ***** * ****************

103. spacer 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cctgacggtgaaccggtcggcgctgatgccgc	Protospacer
    ** .***** *.*************** 

104. spacer 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cagggcgtcgaactgatcggcgctcatgccgg	Protospacer
 .* .*  .**** ********** *******

105. spacer 3.14|3061963|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******... 

106. spacer 3.14|3061963|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******... 

107. spacer 3.17|3062146|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
gttcagtggacgaggagttcctcacccgcacc	Protospacer
 .   ************** **** ****  *

108. spacer 3.17|3062146|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

109. spacer 3.17|3062146|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

110. spacer 2.1|3043250|32|NZ_CP012924|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

111. spacer 2.1|3043250|32|NZ_CP012924|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

112. spacer 2.13|3043978|32|NZ_CP012924|PILER-CR matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688

accgttccggtatgatcgaagatacggcaaac	CRISPR spacer
tcccttccgatatgatcgaagatagtcctgtt	Protospacer
 ** *****.**************   * . .

113. spacer 2.18|3044283|32|NZ_CP012924|PILER-CR matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

114. spacer 2.18|3044283|32|NZ_CP012924|PILER-CR matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

115. spacer 2.18|3044283|32|NZ_CP012924|PILER-CR matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

116. spacer 2.18|3044283|32|NZ_CP012924|PILER-CR matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

117. spacer 2.18|3044283|32|NZ_CP012924|PILER-CR matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

118. spacer 2.19|3044344|32|NZ_CP012924|PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
tcaaacgccaggttgatcaagtgcgtcagatt	Protospacer
.   .**.********** **********   

119. spacer 2.20|3044405|32|NZ_CP012924|PILER-CR matches to NZ_CP012188 (Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
tgatgaaattgtcaaaaaaattaagcagcttc	Protospacer
*********.***** *******   .  . *

120. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

121. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

122. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

123. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

124. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

125. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

126. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

127. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

128. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

129. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

130. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

131. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

132. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

133. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

134. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

135. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

136. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

137. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

138. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

139. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

140. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

141. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

142. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

143. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

144. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

145. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

146. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

147. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

148. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

149. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

150. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

151. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

152. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

153. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

154. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

155. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

156. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

157. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

158. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

159. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

160. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

161. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

162. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

163. spacer 2.24|3044649|38|NZ_CP012924|PILER-CR matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

164. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP044540 (Borrelia sp. CA690 plasmid lp17, complete sequence) position: , mismatch: 10, identity: 0.688

actgcttatcattgattttattgatttttccc	CRISPR spacer
cattaaagtcatttattttattggtttttccg	Protospacer
  *    .***** *********.******* 

165. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 10, identity: 0.688

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttctttcatcattgattttcttgatttctcaa	Protospacer
 .. .*.************ *******.**  

166. spacer 2.32|3043963|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688

accgttccggtatgatcgaagatacggcaaac	CRISPR spacer
tcccttccgatatgatcgaagatagtcctgtt	Protospacer
 ** *****.**************   * . .

167. spacer 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

168. spacer 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

169. spacer 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

170. spacer 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

171. spacer 2.37|3044268|32|NZ_CP012924|CRT,CRISPRCasFinder matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

172. spacer 2.38|3044329|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
tcaaacgccaggttgatcaagtgcgtcagatt	Protospacer
.   .**.********** **********   

173. spacer 2.39|3044390|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP012188 (Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
tgatgaaattgtcaaaaaaattaagcagcttc	Protospacer
*********.***** *******   .  . *

174. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

175. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

176. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

177. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

178. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

179. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

180. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

181. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

182. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

183. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

184. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

185. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

186. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

187. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

188. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

189. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

190. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

191. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

192. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

193. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

194. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

195. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

196. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

197. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

198. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

199. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

200. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

201. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

202. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

203. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

204. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

205. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

206. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

207. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

208. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

209. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

210. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

211. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

212. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

213. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

214. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

215. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

216. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

217. spacer 2.43|3044634|38|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

218. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP044540 (Borrelia sp. CA690 plasmid lp17, complete sequence) position: , mismatch: 10, identity: 0.688

actgcttatcattgattttattgatttttccc	CRISPR spacer
cattaaagtcatttattttattggtttttccg	Protospacer
  *    .***** *********.******* 

219. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 10, identity: 0.688

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttctttcatcattgattttcttgatttctcaa	Protospacer
 .. .*.************ *******.**  

220. spacer 3.1|3061170|32|NZ_CP012924|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

atcttcatattgcgtgacgctgccgatgaacg	CRISPR spacer
tgccggatatggcgtgacgatgccgatgatgt	Protospacer
  *.  **** ******** *********   

221. spacer 3.4|3061353|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgcccgttctgcctcttcgcactctcgatcaa	CRISPR spacer
tgcccgttctgtctcttggcactgccaccttc	Protospacer
***********.***** ***** .*. ..  

222. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

223. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

224. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

225. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

226. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

227. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

228. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

229. spacer 3.9|3061658|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

230. spacer 3.16|3062085|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688

gtggtggcctcaaataaattcgagcgctggag	CRISPR spacer
aaacttgcctcaaataaattcgcgcggtgttc	Protospacer
. . * **************** *** **   

231. spacer 2.27|3044838|32|NZ_CP012924|PILER-CR matches to NZ_CP041669 (Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttgatttattattgattttattcattttatta	Protospacer
 . ..****.************ ***** .. 

232. spacer 2.46|3044823|32|NZ_CP012924|CRT,CRISPRCasFinder matches to NZ_CP041669 (Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttgatttattattgattttattcattttatta	Protospacer
 . ..****.************ ***** .. 

233. spacer 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
atagactaggagcggatcggcgctgatcggaa	Protospacer
. . **** **.***************   ..

234. spacer 3.13|3061902|32|NZ_CP012924|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
atagactaggagcggatcggcgctgatcggaa	Protospacer
. . **** **.***************   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 371624 : 415220 64 Enterobacteria_phage(44.44%) coat,terminase,lysis,portal,protease,integrase attL 375471:375516|attR 414736:414781
DBSCAN-SWA_2 1019447 : 1027470 8 Dickeya_phage(14.29%) protease,transposase NA
DBSCAN-SWA_3 1078079 : 1176038 104 Salmonella_phage(44.83%) tRNA,terminase,lysis,transposase,portal,protease,tail NA
DBSCAN-SWA_4 2075262 : 2082514 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_5 2171858 : 2182364 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_6 2250640 : 2259811 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_7 2279218 : 2345612 60 Salmonella_phage(28.57%) holin,lysis,tail NA
DBSCAN-SWA_8 2608914 : 2674599 71 Salmonella_phage(87.27%) tRNA,capsid,holin,terminase,head,protease,integrase,tail attL 2645731:2645748|attR 2690003:2690020
DBSCAN-SWA_9 4372851 : 4393748 26 Burkholderia_phage(45.0%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP012926
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012926_1 37326-37445 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 0 1.0
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 1 0.971
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP022061 Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence 1711-1744 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 CP048927 Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence 45611-45644 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 98434-98467 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP028313 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence 41569-41602 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP018662 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence 41992-42025 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 CP049987 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence 41386-41419 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 CP049982 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence 42740-42773 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NC_010421 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence 27662-27695 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_MK625201 Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence 41824-41857 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP023476 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence 33473-33506 2 0.941
NZ_CP012926_1 1.1|37369|34|NZ_CP012926|CRISPRCasFinder 37369-37402 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 4 0.882

1. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

2. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

3. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

4. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

5. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

6. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

7. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

8. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

9. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

10. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

11. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

12. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

13. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

14. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

15. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

16. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

17. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

18. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

19. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

20. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

21. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

22. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

23. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

24. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

25. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

26. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

27. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

28. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

29. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

30. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

31. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

32. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

33. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

34. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

35. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

36. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

37. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

38. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

39. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

40. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

41. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

42. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

43. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

44. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

45. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

46. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

47. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

48. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

49. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

50. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

51. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

52. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

53. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

54. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

55. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

56. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

57. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

58. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

59. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

60. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

61. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

62. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

63. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

64. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

65. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

66. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

67. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

68. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

69. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

70. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

71. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

72. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

73. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

74. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

75. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

76. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

77. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

78. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

79. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

80. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

81. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

82. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

83. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

84. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

85. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

86. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

87. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

88. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

89. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

90. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

91. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

92. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

93. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

94. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

95. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

96. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

97. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

98. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

99. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

100. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

101. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

102. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

103. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

104. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

105. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

106. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

107. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

108. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

109. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

110. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

111. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

112. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

113. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

114. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

115. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

116. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

117. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

118. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

119. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

120. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

121. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

122. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

123. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

124. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

125. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

126. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

127. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

128. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

129. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

130. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

131. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

132. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

133. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

134. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

135. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

136. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

137. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

138. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

139. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

140. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

141. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

142. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

143. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

144. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

145. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

146. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

147. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

148. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

149. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

150. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

151. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

152. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

153. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

154. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

155. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

156. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

157. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

158. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

159. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

160. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

161. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

162. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

163. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

164. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

165. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

166. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

167. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

168. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

169. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

170. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP022061 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

171. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to CP048927 (Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

172. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

173. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP028313 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

174. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP018662 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

175. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to CP049987 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

176. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to CP049982 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

177. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NC_010421 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

178. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_MK625201 (Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

179. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP023476 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

180. spacer 1.1|37369|34|NZ_CP012926|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 4, identity: 0.882

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgttcga	Protospacer
*****************************. *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage