Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012906 Helicobacter pylori strain 7C plasmid unnamed, complete sequence 0 crisprs cas14j 0 0 0 0
NZ_CP012905 Helicobacter pylori strain 7C chromosome, complete genome 2 crisprs csx1,RT 0 1 0 0

Results visualization

1. NZ_CP012905
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012905_1 906541-906729 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012905_2 1113819-1113904 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012905_1 1.3|906676|36|NZ_CP012905|CRT 906676-906711 36 NC_007110 Rickettsia felis URRWXCal2 plasmid pRF, complete sequence 6949-6984 10 0.722
NZ_CP012905_1 1.3|906676|36|NZ_CP012905|CRT 906676-906711 36 NC_007111 Rickettsia felis URRWXCal2 plasmid pRFdelta, complete sequence 6949-6984 10 0.722
NZ_CP012905_1 1.3|906676|36|NZ_CP012905|CRT 906676-906711 36 NC_019229 Rickettsia felis plasmid pRF, complete sequence 6949-6984 10 0.722

1. spacer 1.3|906676|36|NZ_CP012905|CRT matches to NC_007110 (Rickettsia felis URRWXCal2 plasmid pRF, complete sequence) position: , mismatch: 10, identity: 0.722

gattttagtaacaataccagctttaataacgacacc	CRISPR spacer
ctctttagtaacaaaaccatctttaataacatctat	Protospacer
  .*********** **** **********. *  .

2. spacer 1.3|906676|36|NZ_CP012905|CRT matches to NC_007111 (Rickettsia felis URRWXCal2 plasmid pRFdelta, complete sequence) position: , mismatch: 10, identity: 0.722

gattttagtaacaataccagctttaataacgacacc	CRISPR spacer
ctctttagtaacaaaaccatctttaataacatctat	Protospacer
  .*********** **** **********. *  .

3. spacer 1.3|906676|36|NZ_CP012905|CRT matches to NC_019229 (Rickettsia felis plasmid pRF, complete sequence) position: , mismatch: 10, identity: 0.722

gattttagtaacaataccagctttaataacgacacc	CRISPR spacer
ctctttagtaacaaaaccatctttaataacatctat	Protospacer
  .*********** **** **********. *  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage