Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 6 crisprs csa3,cas3HD,cas3,cas8e,cse2gr11,cas7,cas1 3 152 0 0
NZ_CP009804 Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009802 Streptomyces sp. FR-008 chromosome, complete genome 33 crisprs csa3,DEDDh,Cas14u_CAS-V,DinG,cas3,cas4,WYL,Cas9_archaeal 5 34 2 0

Results visualization

1. NZ_CP009803
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009803_1 65371-65706 Unclear NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009803_2 66308-67069 Unclear NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009803_3 67621-69604 TypeI-E NA
32 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009803_4 69852-70001 TypeI-E NA
2 spacers
cas3HD,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009803_5 73657-75459 TypeI-E NA
29 spacers
cas3HD,cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009803_6 79849-82614 TypeI-E NA
45 spacers
cas3HD,cas3,cas8e,cse2gr11,cas7,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP009802.1 5361129-5361161 0 1.0
NZ_CP009803_3 3.31|69482|33|NZ_CP009803|CRT,CRISPRCasFinder 69482-69514 33 NZ_CP009802.1 5356300-5356332 1 0.97
NZ_CP009803_3 3.56|69489|33|NZ_CP009803|PILER-CR 69489-69521 33 NZ_CP009802.1 5356300-5356332 1 0.97

1. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to position: 5361129-5361161, mismatch: 0, identity: 1.0

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
cgtgctcacgcggcaccgccgagggtgtcgcgg	Protospacer
*********************************

2. spacer 3.31|69482|33|NZ_CP009803|CRT,CRISPRCasFinder matches to position: 5356300-5356332, mismatch: 1, identity: 0.97

ggcgagaccgagggcatggacctgtccaagatg	CRISPR spacer
ggtgagaccgagggcatggacctgtccaagatg	Protospacer
**.******************************

3. spacer 3.56|69489|33|NZ_CP009803|PILER-CR matches to position: 5356300-5356332, mismatch: 1, identity: 0.97

ggcgagaccgagggcatggacctgtccaagatg	CRISPR spacer
ggtgagaccgagggcatggacctgtccaagatg	Protospacer
**.******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009803_1 1.1|65399|35|NZ_CP009803|CRISPRCasFinder,CRT 65399-65433 35 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 65399-65433 0 1.0
NZ_CP009803_1 1.2|65462|33|NZ_CP009803|CRISPRCasFinder,CRT 65462-65494 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 65462-65494 0 1.0
NZ_CP009803_1 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT 65523-65555 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 65523-65555 0 1.0
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 65584-65616 0 1.0
NZ_CP009803_1 1.5|65645|33|NZ_CP009803|CRISPRCasFinder,CRT 65645-65677 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 65645-65677 0 1.0
NZ_CP009803_2 2.1|66336|33|NZ_CP009803|CRISPRCasFinder,CRT 66336-66368 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66336-66368 0 1.0
NZ_CP009803_2 2.2|66397|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66397-66429 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66397-66429 0 1.0
NZ_CP009803_2 2.3|66458|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66458-66490 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 104130-104162 0 1.0
NZ_CP009803_2 2.3|66458|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66458-66490 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66458-66490 0 1.0
NZ_CP009803_2 2.4|66519|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66519-66551 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66519-66551 0 1.0
NZ_CP009803_2 2.5|66580|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66580-66612 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66580-66612 0 1.0
NZ_CP009803_2 2.6|66641|34|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66641-66674 34 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66641-66674 0 1.0
NZ_CP009803_2 2.7|66703|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66703-66735 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66703-66735 0 1.0
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 105052-105084 0 1.0
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66764-66796 0 1.0
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 82545-82577 0 1.0
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 108969-109001 0 1.0
NZ_CP009803_2 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66825-66857 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66825-66857 0 1.0
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66886-66918 0 1.0
NZ_CP009803_2 2.11|66947|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66947-66979 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 66947-66979 0 1.0
NZ_CP009803_2 2.12|67008|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 67008-67040 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67008-67040 0 1.0
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67649-67681 0 1.0
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 87516-87548 0 1.0
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104185-104217 0 1.0
NZ_CP009803_3 3.2|67710|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67710-67742 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67710-67742 0 1.0
NZ_CP009803_3 3.2|67710|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67710-67742 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 87577-87609 0 1.0
NZ_CP009803_3 3.2|67710|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67710-67742 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104124-104156 0 1.0
NZ_CP009803_3 3.3|67771|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67771-67803 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104063-104095 0 1.0
NZ_CP009803_3 3.3|67771|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67771-67803 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67771-67803 0 1.0
NZ_CP009803_3 3.4|67832|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67832-67864 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 26681-26713 0 1.0
NZ_CP009803_3 3.4|67832|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67832-67864 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67832-67864 0 1.0
NZ_CP009803_3 3.5|67893|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67893-67925 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67893-67925 0 1.0
NZ_CP009803_3 3.6|67954|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67954-67986 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 106956-106988 0 1.0
NZ_CP009803_3 3.6|67954|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67954-67986 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67954-67986 0 1.0
NZ_CP009803_3 3.6|67954|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67954-67986 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84678-84710 0 1.0
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68015-68047 0 1.0
NZ_CP009803_3 3.8|68076|35|NZ_CP009803|CRT,CRISPRCasFinder 68076-68110 35 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68076-68110 0 1.0
NZ_CP009803_3 3.9|68139|33|NZ_CP009803|CRT,CRISPRCasFinder 68139-68171 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68139-68171 0 1.0
NZ_CP009803_3 3.10|68200|33|NZ_CP009803|CRT,CRISPRCasFinder 68200-68232 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68200-68232 0 1.0
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68261-68293 0 1.0
NZ_CP009803_3 3.12|68322|33|NZ_CP009803|CRT,CRISPRCasFinder 68322-68354 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68322-68354 0 1.0
NZ_CP009803_3 3.12|68322|33|NZ_CP009803|CRT,CRISPRCasFinder 68322-68354 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 101215-101247 0 1.0
NZ_CP009803_3 3.12|68322|33|NZ_CP009803|CRT,CRISPRCasFinder 68322-68354 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 101276-101308 0 1.0
NZ_CP009803_3 3.13|68383|33|NZ_CP009803|CRT,CRISPRCasFinder 68383-68415 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68383-68415 0 1.0
NZ_CP009803_3 3.13|68383|33|NZ_CP009803|CRT,CRISPRCasFinder 68383-68415 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 101154-101186 0 1.0
NZ_CP009803_3 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder 68444-68476 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68444-68476 0 1.0
NZ_CP009803_3 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder 68444-68476 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 101093-101125 0 1.0
NZ_CP009803_3 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder 68505-68537 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68505-68537 0 1.0
NZ_CP009803_3 3.16|68566|33|NZ_CP009803|CRT,CRISPRCasFinder 68566-68598 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68566-68598 0 1.0
NZ_CP009803_3 3.17|68627|33|NZ_CP009803|CRT,CRISPRCasFinder 68627-68659 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68627-68659 0 1.0
NZ_CP009803_3 3.17|68627|33|NZ_CP009803|CRT,CRISPRCasFinder 68627-68659 33 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 12435-12467 0 1.0
NZ_CP009803_3 3.17|68627|33|NZ_CP009803|CRT,CRISPRCasFinder 68627-68659 33 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 27129-27161 0 1.0
NZ_CP009803_3 3.18|68688|33|NZ_CP009803|CRT,CRISPRCasFinder 68688-68720 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68688-68720 0 1.0
NZ_CP009803_3 3.19|68749|33|NZ_CP009803|CRT,CRISPRCasFinder 68749-68781 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68749-68781 0 1.0
NZ_CP009803_3 3.20|68810|33|NZ_CP009803|CRT,CRISPRCasFinder 68810-68842 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68810-68842 0 1.0
NZ_CP009803_3 3.20|68810|33|NZ_CP009803|CRT,CRISPRCasFinder 68810-68842 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68871-68903 0 1.0
NZ_CP009803_3 3.21|68871|33|NZ_CP009803|CRT,CRISPRCasFinder 68871-68903 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68810-68842 0 1.0
NZ_CP009803_3 3.21|68871|33|NZ_CP009803|CRT,CRISPRCasFinder 68871-68903 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68871-68903 0 1.0
NZ_CP009803_3 3.22|68932|34|NZ_CP009803|CRT,CRISPRCasFinder 68932-68965 34 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68932-68965 0 1.0
NZ_CP009803_3 3.23|68994|33|NZ_CP009803|CRT,CRISPRCasFinder 68994-69026 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68994-69026 0 1.0
NZ_CP009803_3 3.24|69055|33|NZ_CP009803|CRT,CRISPRCasFinder 69055-69087 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69055-69087 0 1.0
NZ_CP009803_3 3.25|69116|33|NZ_CP009803|CRT,CRISPRCasFinder 69116-69148 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69116-69148 0 1.0
NZ_CP009803_3 3.26|69177|33|NZ_CP009803|CRT,CRISPRCasFinder 69177-69209 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69177-69209 0 1.0
NZ_CP009803_3 3.27|69238|33|NZ_CP009803|CRT,CRISPRCasFinder 69238-69270 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69238-69270 0 1.0
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69299-69331 0 1.0
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 85050-85082 0 1.0
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 6406-6438 0 1.0
NZ_CP009803_3 3.29|69360|33|NZ_CP009803|CRT,CRISPRCasFinder 69360-69392 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69360-69392 0 1.0
NZ_CP009803_3 3.30|69421|33|NZ_CP009803|CRT,CRISPRCasFinder 69421-69453 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69421-69453 0 1.0
NZ_CP009803_3 3.31|69482|33|NZ_CP009803|CRT,CRISPRCasFinder 69482-69514 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69482-69514 0 1.0
NZ_CP009803_3 3.32|69543|33|NZ_CP009803|CRT,CRISPRCasFinder 69543-69575 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69543-69575 0 1.0
NZ_CP009803_3 3.33|68076|42|NZ_CP009803|PILER-CR 68076-68117 42 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68076-68117 0 1.0
NZ_CP009803_3 3.34|68146|33|NZ_CP009803|PILER-CR 68146-68178 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68139-68171 0 1.0
NZ_CP009803_3 3.35|68207|33|NZ_CP009803|PILER-CR 68207-68239 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68200-68232 0 1.0
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68261-68293 0 1.0
NZ_CP009803_3 3.37|68329|33|NZ_CP009803|PILER-CR 68329-68361 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68322-68354 0 1.0
NZ_CP009803_3 3.37|68329|33|NZ_CP009803|PILER-CR 68329-68361 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 101215-101247 0 1.0
NZ_CP009803_3 3.37|68329|33|NZ_CP009803|PILER-CR 68329-68361 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 101276-101308 0 1.0
NZ_CP009803_3 3.38|68390|33|NZ_CP009803|PILER-CR 68390-68422 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68383-68415 0 1.0
NZ_CP009803_3 3.38|68390|33|NZ_CP009803|PILER-CR 68390-68422 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 101154-101186 0 1.0
NZ_CP009803_3 3.39|68451|33|NZ_CP009803|PILER-CR 68451-68483 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68444-68476 0 1.0
NZ_CP009803_3 3.39|68451|33|NZ_CP009803|PILER-CR 68451-68483 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 101093-101125 0 1.0
NZ_CP009803_3 3.40|68512|33|NZ_CP009803|PILER-CR 68512-68544 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68505-68537 0 1.0
NZ_CP009803_3 3.41|68573|33|NZ_CP009803|PILER-CR 68573-68605 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68566-68598 0 1.0
NZ_CP009803_3 3.42|68634|33|NZ_CP009803|PILER-CR 68634-68666 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68627-68659 0 1.0
NZ_CP009803_3 3.42|68634|33|NZ_CP009803|PILER-CR 68634-68666 33 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 12435-12467 0 1.0
NZ_CP009803_3 3.42|68634|33|NZ_CP009803|PILER-CR 68634-68666 33 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 27129-27161 0 1.0
NZ_CP009803_3 3.43|68695|33|NZ_CP009803|PILER-CR 68695-68727 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68688-68720 0 1.0
NZ_CP009803_3 3.44|68756|33|NZ_CP009803|PILER-CR 68756-68788 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68749-68781 0 1.0
NZ_CP009803_3 3.45|68817|33|NZ_CP009803|PILER-CR 68817-68849 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68810-68842 0 1.0
NZ_CP009803_3 3.45|68817|33|NZ_CP009803|PILER-CR 68817-68849 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68871-68903 0 1.0
NZ_CP009803_3 3.46|68878|33|NZ_CP009803|PILER-CR 68878-68910 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68810-68842 0 1.0
NZ_CP009803_3 3.46|68878|33|NZ_CP009803|PILER-CR 68878-68910 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68871-68903 0 1.0
NZ_CP009803_3 3.47|68939|34|NZ_CP009803|PILER-CR 68939-68972 34 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68932-68965 0 1.0
NZ_CP009803_3 3.48|69001|33|NZ_CP009803|PILER-CR 69001-69033 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 68994-69026 0 1.0
NZ_CP009803_3 3.49|69062|33|NZ_CP009803|PILER-CR 69062-69094 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69055-69087 0 1.0
NZ_CP009803_3 3.50|69123|33|NZ_CP009803|PILER-CR 69123-69155 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69116-69148 0 1.0
NZ_CP009803_3 3.51|69184|33|NZ_CP009803|PILER-CR 69184-69216 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69177-69209 0 1.0
NZ_CP009803_3 3.52|69245|33|NZ_CP009803|PILER-CR 69245-69277 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69238-69270 0 1.0
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69299-69331 0 1.0
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 85050-85082 0 1.0
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 6406-6438 0 1.0
NZ_CP009803_3 3.54|69367|33|NZ_CP009803|PILER-CR 69367-69399 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69360-69392 0 1.0
NZ_CP009803_3 3.55|69428|33|NZ_CP009803|PILER-CR 69428-69460 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69421-69453 0 1.0
NZ_CP009803_3 3.56|69489|33|NZ_CP009803|PILER-CR 69489-69521 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69482-69514 0 1.0
NZ_CP009803_3 3.57|69550|33|NZ_CP009803|PILER-CR 69550-69582 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69543-69575 0 1.0
NZ_CP009803_4 4.1|69880|33|NZ_CP009803|CRISPRCasFinder 69880-69912 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69880-69912 0 1.0
NZ_CP009803_4 4.2|69941|33|NZ_CP009803|CRISPRCasFinder 69941-69973 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69941-69973 0 1.0
NZ_CP009803_4 4.2|69941|33|NZ_CP009803|CRISPRCasFinder 69941-69973 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 90369-90401 0 1.0
NZ_CP009803_5 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT 73685-73717 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 88547-88579 0 1.0
NZ_CP009803_5 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT 73685-73717 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 73685-73717 0 1.0
NZ_CP009803_5 5.2|73746|33|NZ_CP009803|CRISPRCasFinder,CRT 73746-73778 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 73746-73778 0 1.0
NZ_CP009803_5 5.2|73746|33|NZ_CP009803|CRISPRCasFinder,CRT 73746-73778 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 88486-88518 0 1.0
NZ_CP009803_5 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT 73807-73839 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 88303-88335 0 1.0
NZ_CP009803_5 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT 73807-73839 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 103031-103063 0 1.0
NZ_CP009803_5 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT 73807-73839 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 73807-73839 0 1.0
NZ_CP009803_5 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT 73868-73900 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 73868-73900 0 1.0
NZ_CP009803_5 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT 73868-73900 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 83891-83923 0 1.0
NZ_CP009803_5 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT 73868-73900 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 88242-88274 0 1.0
NZ_CP009803_5 5.5|73929|33|NZ_CP009803|CRISPRCasFinder,CRT 73929-73961 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 73929-73961 0 1.0
NZ_CP009803_5 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT 73990-74022 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 73990-74022 0 1.0
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74051-74079 0 1.0
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74108-74140 0 1.0
NZ_CP009803_5 5.9|74169|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74169-74201 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74169-74201 0 1.0
NZ_CP009803_5 5.10|74230|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74230-74262 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74230-74262 0 1.0
NZ_CP009803_5 5.11|74291|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74291-74323 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74291-74323 0 1.0
NZ_CP009803_5 5.12|74352|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74352-74384 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74352-74384 0 1.0
NZ_CP009803_5 5.13|74413|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74413-74445 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74413-74445 0 1.0
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74474-74506 0 1.0
NZ_CP009803_5 5.15|74535|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74535-74567 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74535-74567 0 1.0
NZ_CP009803_5 5.16|74596|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74596-74628 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74596-74628 0 1.0
NZ_CP009803_5 5.17|74657|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74657-74689 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74657-74689 0 1.0
NZ_CP009803_5 5.18|74718|43|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74718-74760 43 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74718-74760 0 1.0
NZ_CP009803_5 5.19|74789|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74789-74821 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74789-74821 0 1.0
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74850-74882 0 1.0
NZ_CP009803_5 5.21|74911|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74911-74943 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74911-74943 0 1.0
NZ_CP009803_5 5.22|74972|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74972-75004 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 74972-75004 0 1.0
NZ_CP009803_5 5.23|75033|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75033-75065 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 75033-75065 0 1.0
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 75094-75126 0 1.0
NZ_CP009803_5 5.25|75155|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75155-75187 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 75155-75187 0 1.0
NZ_CP009803_5 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75216-75248 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 75216-75248 0 1.0
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 75277-75309 0 1.0
NZ_CP009803_5 5.28|75338|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75338-75370 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 75338-75370 0 1.0
NZ_CP009803_5 5.29|75399|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75399-75431 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 75399-75431 0 1.0
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 84640-84667 0 1.0
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 79877-79904 0 1.0
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 97970-97997 0 1.0
NZ_CP009803_6 6.2|79933|33|NZ_CP009803|CRT 79933-79965 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 79933-79965 0 1.0
NZ_CP009803_6 6.2|79933|33|NZ_CP009803|CRT 79933-79965 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98026-98058 0 1.0
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 84519-84550 0 1.0
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 79994-80025 0 1.0
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98087-98118 0 1.0
NZ_CP009803_6 6.4|80054|33|NZ_CP009803|CRT,CRISPRCasFinder 80054-80086 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80054-80086 0 1.0
NZ_CP009803_6 6.4|80054|33|NZ_CP009803|CRT,CRISPRCasFinder 80054-80086 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 84458-84490 0 1.0
NZ_CP009803_6 6.5|80115|33|NZ_CP009803|CRT,CRISPRCasFinder 80115-80147 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80115-80147 0 1.0
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80176-80207 0 1.0
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 29792-29824 0 1.0
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80236-80268 0 1.0
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 42666-42698 0 1.0
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80297-80329 0 1.0
NZ_CP009803_6 6.9|80358|33|NZ_CP009803|CRT,CRISPRCasFinder 80358-80390 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80358-80390 0 1.0
NZ_CP009803_6 6.10|80419|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80419-80451 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80419-80451 0 1.0
NZ_CP009803_6 6.11|80480|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80480-80512 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80480-80512 0 1.0
NZ_CP009803_6 6.12|80541|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80541-80573 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80541-80573 0 1.0
NZ_CP009803_6 6.13|80602|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80602-80634 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80602-80634 0 1.0
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80663-80695 0 1.0
NZ_CP009803_6 6.15|80724|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80724-80756 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80724-80756 0 1.0
NZ_CP009803_6 6.16|80785|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80785-80817 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80785-80817 0 1.0
NZ_CP009803_6 6.17|80846|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80846-80878 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80846-80878 0 1.0
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80907-80939 0 1.0
NZ_CP009803_6 6.19|80968|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80968-81000 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80968-81000 0 1.0
NZ_CP009803_6 6.20|81029|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81029-81061 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81029-81061 0 1.0
NZ_CP009803_6 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81090-81122 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81090-81122 0 1.0
NZ_CP009803_6 6.22|81151|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81151-81183 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81151-81183 0 1.0
NZ_CP009803_6 6.23|81212|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81212-81244 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81212-81244 0 1.0
NZ_CP009803_6 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81273-81305 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81273-81305 0 1.0
NZ_CP009803_6 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81334-81366 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81334-81366 0 1.0
NZ_CP009803_6 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81395-81427 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81395-81427 0 1.0
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81456-81488 0 1.0
NZ_CP009803_6 6.28|81517|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81517-81549 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81517-81549 0 1.0
NZ_CP009803_6 6.29|81578|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81578-81610 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81578-81610 0 1.0
NZ_CP009803_6 6.29|81578|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81578-81610 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110202-110234 0 1.0
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81639-81671 0 1.0
NZ_CP009803_6 6.31|81700|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81700-81732 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81700-81732 0 1.0
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81761-81793 0 1.0
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 79774-79806 0 1.0
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 111740-111772 0 1.0
NZ_CP009803_6 6.33|81822|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81822-81854 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81822-81854 0 1.0
NZ_CP009803_6 6.34|81883|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81883-81915 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81883-81915 0 1.0
NZ_CP009803_6 6.35|81944|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81944-81976 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81944-81976 0 1.0
NZ_CP009803_6 6.36|82005|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82005-82037 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82005-82037 0 1.0
NZ_CP009803_6 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82066-82098 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82066-82098 0 1.0
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82127-82159 0 1.0
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82188-82220 0 1.0
NZ_CP009803_6 6.40|82249|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82249-82281 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82249-82281 0 1.0
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82310-82342 0 1.0
NZ_CP009803_6 6.42|82371|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82371-82403 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82371-82403 0 1.0
NZ_CP009803_6 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82432-82464 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82432-82464 0 1.0
NZ_CP009803_6 6.44|82493|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82493-82525 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82493-82525 0 1.0
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 82554-82586 0 1.0
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80177-80206 0 1.0
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 29793-29823 0 1.0
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80237-80267 0 1.0
NZ_CP009803_1 1.1|65399|35|NZ_CP009803|CRISPRCasFinder,CRT 65399-65433 35 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 103267-103301 1 0.971
NZ_CP009803_1 1.5|65645|33|NZ_CP009803|CRISPRCasFinder,CRT 65645-65677 33 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 6700-6732 1 0.97
NZ_CP009803_1 1.5|65645|33|NZ_CP009803|CRISPRCasFinder,CRT 65645-65677 33 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 21394-21426 1 0.97
NZ_CP009803_2 2.1|66336|33|NZ_CP009803|CRISPRCasFinder,CRT 66336-66368 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 151507-151539 1 0.97
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 143271-143303 1 0.97
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 136086-136118 1 0.97
NZ_CP009803_4 4.1|69880|33|NZ_CP009803|CRISPRCasFinder 69880-69912 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 90308-90340 1 0.97
NZ_CP009803_5 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT 73990-74022 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 84237-84269 1 0.97
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 36525-36557 1 0.97
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 125797-125824 1 0.964
NZ_CP009803_6 6.2|79933|33|NZ_CP009803|CRT 79933-79965 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 84579-84611 1 0.97
NZ_CP009803_6 6.2|79933|33|NZ_CP009803|CRT 79933-79965 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 125736-125768 1 0.97
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 47382-47414 1 0.97
NZ_CP009803_1 1.1|65399|35|NZ_CP009803|CRISPRCasFinder,CRT 65399-65433 35 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 136146-136180 2 0.943
NZ_CP009803_1 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT 65523-65555 33 NZ_CP026653 Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence 62625-62657 2 0.939
NZ_CP009803_3 3.5|67893|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67893-67925 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84617-84649 2 0.939
NZ_CP009803_3 3.5|67893|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67893-67925 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107017-107049 2 0.939
NZ_CP009803_3 3.24|69055|33|NZ_CP009803|CRT,CRISPRCasFinder 69055-69087 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 45628-45660 2 0.939
NZ_CP009803_3 3.49|69062|33|NZ_CP009803|PILER-CR 69062-69094 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 45628-45660 2 0.939
NZ_CP009803_5 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT 73990-74022 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 77424-77456 2 0.939
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 63153-63181 2 0.931
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NC_013417 Streptomyces sp. x3 plasmid pTSC2, complete sequence 2946-2978 2 0.939
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 70415-70446 2 0.938
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 78281-78312 2 0.938
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP047145 Streptomyces sp. HF10 plasmid plas1, complete sequence 51480-51512 2 0.939
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 70416-70445 2 0.933
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 78282-78311 2 0.933
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 418498-418530 3 0.909
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 537715-537747 3 0.909
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 680111-680143 3 0.909
NZ_CP009803_5 5.17|74657|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74657-74689 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 104337-104369 3 0.909
NZ_CP009803_5 5.19|74789|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74789-74821 33 NZ_CP033585 Streptomyces sp. ADI95-16 plasmid pADI95-16d, complete sequence 1490-1522 3 0.909
NZ_CP009803_6 6.13|80602|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80602-80634 33 NC_023068 Streptomyces sp. F11 plasmid pFP12, complete sequence 18526-18558 3 0.909
NZ_CP009803_6 6.34|81883|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81883-81915 33 NZ_CP026654 Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence 49408-49440 3 0.909
NZ_CP009803_1 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT 65523-65555 33 NZ_CP030863 Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence 61252-61284 4 0.879
NZ_CP009803_1 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT 65523-65555 33 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 220675-220707 4 0.879
NZ_CP009803_2 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66825-66857 33 NC_023068 Streptomyces sp. F11 plasmid pFP12, complete sequence 14067-14099 5 0.848
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 204357-204389 5 0.848
NZ_CP009803_5 5.11|74291|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74291-74323 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1575183-1575215 5 0.848
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 768992-769024 5 0.848
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 63263-63290 5 0.821
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 91675-91702 5 0.821
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 113692-113719 5 0.821
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 5056-5083 5 0.821
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 84115-84142 5 0.821
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP043960 Streptomyces tendae strain 139 plasmid unnamed1, complete sequence 14763-14790 5 0.821
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 MN204493 Streptomyces phage Zuko, complete genome 63051-63078 5 0.821
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 AP014350 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C22, *** SEQUENCING IN PROGRESS *** 4072-4104 5 0.848
NZ_CP009803_6 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81395-81427 33 NZ_CP041019 Sphingobium fuliginis ATCC 27551 plasmid pSF2, complete sequence 52023-52055 5 0.848
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 145787-145819 5 0.848
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 MH651171 Mycobacterium phage Collard, complete genome 37781-37813 6 0.818
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NC_028947 Mycobacterium phage Kratio, complete genome 37373-37405 6 0.818
NZ_CP009803_2 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66825-66857 33 NZ_CP007575 Streptomyces albulus strain NK660 plasmid pNKL, complete sequence 3348-3380 6 0.818
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP020556 Streptomyces sp. Sge12 plasmid pSGE, complete sequence 66226-66258 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN703405 Mycobacterium phage Aneem, complete genome 20911-20943 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH338237 Mycobacterium phage Joselito, complete genome 20911-20943 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK524507 Mycobacterium phage Orange, complete genome 20911-20943 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK524514 Mycobacterium phage Bud, complete genome 20917-20949 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN310547 Mycobacterium phage Hutc2, complete genome 20908-20940 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_031257 Mycobacterium phage Mulciber, complete genome 20905-20937 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH338236 Mycobacterium phage Ebony, complete genome 20954-20986 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK494130 Mycobacterium phage Fibonacci, complete genome 20908-20940 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK524511 Mycobacterium phage Bowtie, complete genome 20911-20943 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK524519 Mycobacterium phage Salz, complete genome 20902-20934 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN586006 Mycobacterium phage Bachome, complete genome 20902-20934 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK524513 Mycobacterium phage Munch, complete genome 20911-20943 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF140410 Mycobacterium phage Et2Brutus, complete genome 20914-20946 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 Z18946 Mycobacterium phage L5 complete genome 19496-19528 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH536828 Mycobacterium phage Snape, complete genome 20908-20940 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_017973 Mycobacterium phage SWU1, complete genome 19451-19483 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KY471460 Mycobacterium phage Jabith, complete genome 20963-20995 6 0.818
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN892487 Mycobacterium phage Mabel, complete genome 20963-20995 6 0.818
NZ_CP009803_3 3.2|67710|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 67710-67742 33 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 90198-90230 6 0.818
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP049734 Rhizobium leguminosarum strain A1 plasmid unnamed1, complete sequence 213311-213343 6 0.818
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 CP049734 Rhizobium leguminosarum strain A1 plasmid pRLa11, complete sequence 2043-2075 6 0.818
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP030762 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence 243486-243518 6 0.818
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP022670 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR5, complete sequence 81345-81377 6 0.818
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP054035 Rhizobium sp. JKLM13E plasmid pPR13E04, complete sequence 167904-167936 6 0.818
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP054024 Rhizobium sp. JKLM12A2 plasmid pPR12A203, complete sequence 9109-9141 6 0.818
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 18336-18368 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1023779-1023811 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 171123-171155 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 418471-418503 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1023764-1023796 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 771627-771659 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1122807-1122839 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1023786-1023818 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1275015-1275047 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1274959-1274991 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 952648-952680 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 763371-763403 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP024583 Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence 224723-224755 6 0.818
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP046475 Janibacter melonis strain M714 plasmid unnamed, complete sequence 21139-21171 6 0.818
NZ_CP009803_3 3.32|69543|33|NZ_CP009803|CRT,CRISPRCasFinder 69543-69575 33 NZ_CP030371 Salinibacter ruber strain RM158 plasmid pSR60, complete sequence 35141-35173 6 0.818
NZ_CP009803_3 3.32|69543|33|NZ_CP009803|CRT,CRISPRCasFinder 69543-69575 33 NZ_CP030363 Salinibacter ruber strain SP73 plasmid pSR118, complete sequence 86448-86480 6 0.818
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 18336-18368 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1023779-1023811 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 171123-171155 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 418471-418503 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1023764-1023796 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 771627-771659 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1122807-1122839 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1023786-1023818 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1275015-1275047 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1274959-1274991 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 952648-952680 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 763371-763403 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP024583 Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence 224723-224755 6 0.818
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP046475 Janibacter melonis strain M714 plasmid unnamed, complete sequence 21139-21171 6 0.818
NZ_CP009803_3 3.57|69550|33|NZ_CP009803|PILER-CR 69550-69582 33 NZ_CP030371 Salinibacter ruber strain RM158 plasmid pSR60, complete sequence 35141-35173 6 0.818
NZ_CP009803_3 3.57|69550|33|NZ_CP009803|PILER-CR 69550-69582 33 NZ_CP030363 Salinibacter ruber strain SP73 plasmid pSR118, complete sequence 86448-86480 6 0.818
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP020385 Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence 176467-176499 6 0.818
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NC_020303 Corynebacterium halotolerans YIM 70093 = DSM 44683 plasmid pCha1, complete sequence 47812-47844 6 0.818
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 1112415-1112447 6 0.818
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5309685-5309712 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 11450-11477 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP014169 Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence 92017-92044 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1457668-1457695 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP020698 Sulfitobacter sp. D7 plasmid p4SUD7, complete sequence 73716-73743 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 298904-298931 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP020447 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence 56213-56240 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 141806-141833 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 MH371110 Mycobacterium phage Magnar, complete genome 47713-47740 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 MK061415 Mycobacterium phage Rhynn, complete genome 48697-48724 6 0.786
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 KP027205 Mycobacterium phage Alvin, complete genome 47382-47409 6 0.786
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 AF447491 Bacteriophage phiE125, complete genome 16243-16274 6 0.812
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NC_003309 Burkholderia phage phiE125, complete genome 16243-16274 6 0.812
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 76649-76681 6 0.818
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 298905-298937 6 0.818
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 311669-311701 6 0.818
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 298846-298878 6 0.818
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 318301-318333 6 0.818
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 313266-313298 6 0.818
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 311669-311701 6 0.818
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 318301-318333 6 0.818
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 298846-298878 6 0.818
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 CP047034 Rhodobacter sphaeroides strain DSM 158 plasmid pB, complete sequence 8368-8400 6 0.818
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP015291 Rhodobacter sphaeroides strain MBTLJ-20 plasmid c, complete sequence 22722-22754 6 0.818
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP047040 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pB, complete sequence 8359-8391 6 0.818
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NC_011962 Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence 49900-49932 6 0.818
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP051471 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10B, complete sequence 83345-83377 6 0.818
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP030274 Rhodobacter sphaeroides 2.4.1 plasmid pB, complete sequence 104815-104847 6 0.818
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP015215 Rhodobacter sphaeroides strain MBTLJ-13 plasmid d, complete sequence 68628-68660 6 0.818
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 147086-147118 6 0.818
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 27814-27846 6 0.818
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 214483-214515 6 0.818
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP047145 Streptomyces sp. HF10 plasmid plas1, complete sequence 54452-54484 6 0.818
NZ_CP009803_6 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82432-82464 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1135974-1136006 6 0.818
NZ_CP009803_6 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82432-82464 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1950610-1950642 6 0.818
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP045376 Sulfitobacter sp. THAF37 plasmid pTHAF37_d, complete sequence 87457-87489 6 0.818
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 235157-235186 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 36792-36821 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 79356-79385 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP052873 Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence 45846-45875 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 190915-190944 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP041248 Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence 103513-103542 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 120336-120365 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP023418 Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence 35756-35785 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 69857-69886 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 51921-51950 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NC_006143 Aeromonas caviae plasmid pFBAOT6, complete sequence 69316-69345 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP026234 Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence 239350-239379 6 0.8
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NZ_CP026717 Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence 20693-20722 6 0.8
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 2150-2180 6 0.806
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 MT776811 Arthrobacter phage King2, complete genome 7268-7300 7 0.788
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NC_041931 Arthrobacter phage Jawnski, complete genome 7263-7295 7 0.788
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NC_042014 Arthrobacter phage Piccoletto, complete genome 7269-7301 7 0.788
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 MF377442 Arthrobacter phage Franzy, complete genome 7266-7298 7 0.788
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NC_041930 Arthrobacter phage Brent, complete genome 7266-7298 7 0.788
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 MF324907 Arthrobacter phage Beans, complete genome 7268-7300 7 0.788
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 157436-157468 7 0.788
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 381321-381353 7 0.788
NZ_CP009803_2 2.1|66336|33|NZ_CP009803|CRISPRCasFinder,CRT 66336-66368 33 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 227992-228024 7 0.788
NZ_CP009803_2 2.7|66703|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66703-66735 33 NC_017833 Streptomyces sp. FR1 plasmid pFP4, complete sequence 19462-19494 7 0.788
NZ_CP009803_2 2.7|66703|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66703-66735 33 NZ_CP013298 Arthrobacter sp. YC-RL1 plasmid unnamed 1, complete sequence 53222-53254 7 0.788
NZ_CP009803_2 2.7|66703|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66703-66735 33 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 379247-379279 7 0.788
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 436993-437025 7 0.788
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NZ_CP041605 Streptomyces sp. S1D4-14 plasmid pS1D4-14.1, complete sequence 37596-37628 7 0.788
NZ_CP009803_2 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66825-66857 33 NC_016972 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence 39809-39841 7 0.788
NZ_CP009803_2 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66825-66857 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 133113-133145 7 0.788
NZ_CP009803_2 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66825-66857 33 NZ_CP048398 Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence 4291-4323 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK967395 Mycobacterium phage WideWale, complete genome 20812-20844 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF919500 Mycobacterium phage Dalmatian, complete genome 20421-20453 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK494087 Mycobacterium phage DBQu4n, complete genome 20205-20237 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MT522004 Mycobacterium phage Gail, complete genome 19561-19593 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KX683875 Mycobacterium phage Baehexic, complete genome 20831-20863 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF919536 Mycobacterium phage TipsytheTRex, complete genome 19462-19494 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_008203 Mycobacterium phage Che12, complete genome 19244-19276 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MG099947 Mycobacterium phage Ph8s, complete genome 19075-19107 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN585989 Mycobacterium phage Superchunk, complete genome 18991-19023 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN585983 Mycobacterium phage Retro23, complete genome 20422-20454 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KX758539 Mycobacterium phage Jaan, complete genome 22292-22324 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KY965065 Mycobacterium phage Heffalump, complete genome 22194-22226 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN585968 Mycobacterium phage Leogania, complete genome 22486-22518 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK279857 Mycobacterium phage IronMan, complete genome 21903-21935 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KU297783 Mycobacterium phage NaSiaTalie, complete genome 20367-20399 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KY798216 Mycobacterium phage Journey13, complete genome 19480-19512 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_022058 Mycobacterium phage Adzzy, complete genome 19075-19107 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF919538 Mycobacterium phage Updawg, complete genome 20812-20844 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MT639645 Mycobacterium phage PainterBoy, complete genome 21031-21063 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH825701 Mycobacterium phage Flare16, complete genome 20370-20402 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK061408 Mycobacterium phage Centaur, complete genome 20809-20841 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF919490 Mycobacterium phage Anselm, complete genome 20449-20481 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH509441 Mycobacterium phage Acolyte, complete genome 20897-20929 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KF017927 Mycobacterium phage Odin, complete genome 19117-19149 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 EU744250 Mycobacterium virus Pukovnik, complete genome 21846-21878 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF472893 Mycobacterium phage MissWhite, complete genome 19434-19466 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 DQ398043 Mycobacterium virus Che12, complete genome 19244-19276 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KM197169 Mycobacterium phage Piro94, complete genome 20828-20860 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN703408 Mycobacterium phage Phaded, complete genome 22291-22323 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK814748 Mycobacterium phage XianYue, complete genome 20292-20324 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN096376 Mycobacterium phage Lucyedi, complete genome 21031-21063 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KX576639 Mycobacterium phage DudeLittle, complete genome 20423-20455 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_031279 Mycobacterium phage Bactobuster, complete genome 21940-21972 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN310541 Mycobacterium phage Jeeves, complete genome 19583-19615 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KT381276 Mycobacterium phage Serenity, complete genome 19297-19329 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_023564 Mycobacterium phage EagleEye, complete genome 21094-21126 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KX758538 Mycobacterium phage Kerberos, complete genome 20205-20237 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN585981 Mycobacterium phage QueenB2, complete genome 20392-20424 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF668269 Mycobacterium phage Drake55, complete genome 20826-20858 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK284522 Mycobacterium phage Malec, complete genome 20629-20661 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN062708 Mycobacteriumphage NothingSpecial, complete genome 22365-22397 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH051252 Mycobacterium phage Fameo, complete genome 20392-20424 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MT310858 Mycobacterium phage Iwokeuplikedis, complete genome 20091-20123 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_028849 Mycobacterium phage Luchador, complete genome 20778-20810 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KM677210 Mycobacterium phage Larenn, complete genome 20624-20656 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN586002 Mycobacterium phage BiancaTri92, complete genome 22129-22161 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KX574455 Mycobacterium phage Pomar16, complete genome 20246-20278 7 0.788
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KJ959632 Mycobacterium phage Equemioh13, complete genome 20812-20844 7 0.788
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP053444 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eB, complete sequence 2043-2075 7 0.788
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP050096 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence 82852-82884 7 0.788
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP050102 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b2, complete sequence 82857-82889 7 0.788
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP050107 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence 82834-82866 7 0.788
NZ_CP009803_3 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 68015-68047 33 NZ_CP050112 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence 82833-82865 7 0.788
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP025615 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence 94820-94852 7 0.788
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 146582-146614 7 0.788
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 452392-452424 7 0.788
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 276227-276259 7 0.788
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 772382-772414 7 0.788
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 284837-284869 7 0.788
NZ_CP009803_3 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder 68505-68537 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 293439-293471 7 0.788
NZ_CP009803_3 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder 68505-68537 33 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 333876-333908 7 0.788
NZ_CP009803_3 3.16|68566|33|NZ_CP009803|CRT,CRISPRCasFinder 68566-68598 33 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 770579-770611 7 0.788
NZ_CP009803_3 3.16|68566|33|NZ_CP009803|CRT,CRISPRCasFinder 68566-68598 33 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 616181-616213 7 0.788
NZ_CP009803_3 3.16|68566|33|NZ_CP009803|CRT,CRISPRCasFinder 68566-68598 33 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 505210-505242 7 0.788
NZ_CP009803_3 3.19|68749|33|NZ_CP009803|CRT,CRISPRCasFinder 68749-68781 33 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 349485-349517 7 0.788
NZ_CP009803_3 3.25|69116|33|NZ_CP009803|CRT,CRISPRCasFinder 69116-69148 33 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 340058-340090 7 0.788
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP021409 Celeribacter manganoxidans strain DY25 plasmid pDY25-E, complete sequence 6208-6240 7 0.788
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP020716 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence 119387-119419 7 0.788
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP025615 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence 94820-94852 7 0.788
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 146582-146614 7 0.788
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 452392-452424 7 0.788
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 276227-276259 7 0.788
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 772382-772414 7 0.788
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 284837-284869 7 0.788
NZ_CP009803_3 3.40|68512|33|NZ_CP009803|PILER-CR 68512-68544 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 293439-293471 7 0.788
NZ_CP009803_3 3.40|68512|33|NZ_CP009803|PILER-CR 68512-68544 33 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 333876-333908 7 0.788
NZ_CP009803_3 3.41|68573|33|NZ_CP009803|PILER-CR 68573-68605 33 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 770579-770611 7 0.788
NZ_CP009803_3 3.41|68573|33|NZ_CP009803|PILER-CR 68573-68605 33 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 616181-616213 7 0.788
NZ_CP009803_3 3.41|68573|33|NZ_CP009803|PILER-CR 68573-68605 33 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 505210-505242 7 0.788
NZ_CP009803_3 3.44|68756|33|NZ_CP009803|PILER-CR 68756-68788 33 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 349485-349517 7 0.788
NZ_CP009803_3 3.50|69123|33|NZ_CP009803|PILER-CR 69123-69155 33 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 340058-340090 7 0.788
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP021409 Celeribacter manganoxidans strain DY25 plasmid pDY25-E, complete sequence 6208-6240 7 0.788
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP020716 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence 119387-119419 7 0.788
NZ_CP009803_5 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT 73685-73717 33 AP013476 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-U-MedDCM-OCT-S44-C63 32594-32626 7 0.788
NZ_CP009803_5 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT 73990-74022 33 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 158343-158375 7 0.788
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NC_005918 Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence 32926-32954 7 0.759
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP047262 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence 32775-32803 7 0.759
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP026560 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence 16777-16805 7 0.759
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_LT963406 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence 53014-53042 7 0.759
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP017294 Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence 113001-113029 7 0.759
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP026565 Pseudomonas avellanae strain R2leaf plasmid p3_tig6, complete sequence 49865-49893 7 0.759
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 900589-900621 7 0.788
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 266585-266617 7 0.788
NZ_CP009803_5 5.16|74596|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74596-74628 33 MT657339 Gordonia phage SpeedDemon, complete genome 39520-39552 7 0.788
NZ_CP009803_5 5.16|74596|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74596-74628 33 NC_031074 Gordonia phage Bantam, complete genome 37818-37850 7 0.788
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 256185-256217 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2286107-2286139 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 438694-438726 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 880163-880195 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1633124-1633156 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1584944-1584976 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 880227-880259 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1584961-1584993 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1584942-1584974 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1229065-1229097 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 880003-880035 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1564931-1564963 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1491425-1491457 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1435370-1435402 7 0.788
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 903307-903339 7 0.788
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 160173-160200 7 0.75
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 235156-235187 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 36791-36822 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP023418 Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence 35755-35786 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 69856-69887 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 51920-51951 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NC_006143 Aeromonas caviae plasmid pFBAOT6, complete sequence 69315-69346 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 79355-79386 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP052873 Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence 45845-45876 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 190914-190945 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP041248 Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence 103512-103543 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 120335-120366 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP026234 Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence 239349-239380 7 0.781
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NZ_CP026717 Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence 20692-20723 7 0.781
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 219315-219347 7 0.788
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 2149-2181 7 0.788
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 187424-187456 7 0.788
NZ_CP009803_6 6.9|80358|33|NZ_CP009803|CRT,CRISPRCasFinder 80358-80390 33 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 168359-168391 7 0.788
NZ_CP009803_6 6.13|80602|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80602-80634 33 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 126657-126689 7 0.788
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 489291-489323 7 0.788
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 1023515-1023547 7 0.788
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 KJ433975 Mycobacterium phage 40BC, complete genome 33569-33601 7 0.788
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 KJ433973 Mycobacterium phage 39HC, complete genome 33569-33601 7 0.788
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_024145 Mycobacterium phage Hosp, complete genome 31762-31794 7 0.788
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP012258 Cronobacter universalis NCTC 9529 plasmid pCUNV1, complete sequence 37593-37625 7 0.788
NZ_CP009803_6 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81090-81122 33 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 210314-210346 7 0.788
NZ_CP009803_6 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81273-81305 33 MH509447 Microbacterium phage Eden, complete genome 24276-24308 7 0.788
NZ_CP009803_6 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81395-81427 33 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 260408-260440 7 0.788
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 18383-18415 7 0.788
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 503147-503179 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1314074-1314106 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1080225-1080257 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1698355-1698387 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1006599-1006631 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1150256-1150288 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1165183-1165215 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1337669-1337701 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1473516-1473548 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1082700-1082732 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1387450-1387482 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1158007-1158039 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1266969-1267001 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 872862-872894 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1085904-1085936 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1082607-1082639 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1053446-1053478 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1157996-1158028 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1140625-1140657 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1168249-1168281 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1165193-1165225 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1062159-1062191 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1140625-1140657 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1168249-1168281 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1140625-1140657 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1062182-1062214 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1140629-1140661 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1168249-1168281 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1168249-1168281 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1168249-1168281 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1062182-1062214 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1080799-1080831 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1061468-1061500 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1109132-1109164 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1155576-1155608 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1062182-1062214 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1140624-1140656 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1062182-1062214 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1062182-1062214 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1168250-1168282 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1548212-1548244 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 973491-973523 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 731327-731359 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1568980-1569012 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1093251-1093283 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 906784-906816 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1093218-1093250 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1093219-1093251 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1093232-1093264 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1093232-1093264 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 885985-886017 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1093221-1093253 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1016910-1016942 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1093221-1093253 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1093217-1093249 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1093232-1093264 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 876750-876782 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1093243-1093275 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1093221-1093253 7 0.788
NZ_CP009803_6 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81761-81793 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 876750-876782 7 0.788
NZ_CP009803_6 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82066-82098 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 172316-172348 7 0.788
NZ_CP009803_6 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82066-82098 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1640800-1640832 7 0.788
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 109953-109985 7 0.788
NZ_CP009803_6 6.42|82371|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82371-82403 33 NZ_LR594692 Variovorax sp. WDL1 plasmid 4 188354-188386 7 0.788
NZ_CP009803_6 6.42|82371|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82371-82403 33 NZ_CP048419 Sphingomonas insulae strain KCTC 12872 plasmid unnamed1, complete sequence 44386-44418 7 0.788
NZ_CP009803_6 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82432-82464 33 NZ_CP035509 Haematobacter massiliensis strain OT1 plasmid pOT1-9, complete sequence 18568-18600 7 0.788
NZ_CP009803_6 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82432-82464 33 NZ_CP035509 Haematobacter massiliensis strain OT1 plasmid pOT1-9, complete sequence 22456-22488 7 0.788
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 CP003958 Rhodococcus opacus PD630 plasmid 9, complete sequence 13903-13935 7 0.788
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 CP003952 Rhodococcus opacus PD630 plasmid 3, complete sequence 54722-54754 7 0.788
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 19884-19916 7 0.788
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 21084-21116 7 0.788
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 194995-195027 7 0.788
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 CP021131 Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence 10116-10148 7 0.788
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 199407-199439 7 0.788
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 181667-181699 7 0.788
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 219316-219346 7 0.774
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 306662-306692 7 0.774
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 46442-46472 7 0.774
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 46448-46478 7 0.774
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 46443-46473 7 0.774
NZ_CP009803_1 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT 65523-65555 33 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 322082-322114 8 0.758
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 564162-564194 8 0.758
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 60932-60964 8 0.758
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 179109-179141 8 0.758
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 1043761-1043793 8 0.758
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 MN284895 Mycobacterium phage Marshawn, complete genome 60025-60057 8 0.758
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 41841-41873 8 0.758
NZ_CP009803_2 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66825-66857 33 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 3569-3601 8 0.758
NZ_CP009803_2 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66825-66857 33 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 18264-18296 8 0.758
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 142309-142341 8 0.758
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 690119-690151 8 0.758
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 309248-309280 8 0.758
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 527242-527274 8 0.758
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 527375-527407 8 0.758
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 273129-273161 8 0.758
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP031599 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence 87244-87276 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NZ_CP032678 Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence 79206-79238 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH338234 Mycobacterium phage Crucio, complete genome 20274-20306 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH697591 Mycobacterium phage QueenBeesly, complete genome 20274-20306 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MT498060 Mycobacterium Phage FiringLine, complete genome 20274-20306 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KM463009 Mycobacterium phage Power, complete genome 20274-20306 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK524491 Mycobacterium phage Whabigail7, complete genome 20839-20871 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MT498066 Mycobacterium phage Georgie2, complete genome 20265-20297 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MT498041 Mycobacterium phage KingCyrus, complete genome 20756-20788 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK919472 Mycobacterium phage Benvolio, complete genome 20448-20480 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KF981601 Mycobacterium phage Echild, complete genome 20448-20480 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KX619650 Mycobacterium phage Jerm, complete genome 20789-20821 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN585998 Mycobacterium phage Bugsy, complete genome 20852-20884 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 JN408460 Mycobacterium phage Turbido, complete genome 20851-20883 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH077576 Mycobacterium phage AbbyPaige, complete genome 20853-20885 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KU985095 Mycobacterium phage ChipMunk, complete genome 20756-20788 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN234203 Mycobacterium phage SemperFi, complete genome 20691-20723 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF919531 Mycobacterium phage SnapTap, complete genome 20274-20306 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF472896 Mycobacterium phage JoshKayV, complete genome 20759-20791 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_029043 Mycobacterium phage SweetiePie, complete genome 20274-20306 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH825704 Mycobacterium phage LilTurb, complete genome 20848-20880 8 0.758
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KU985093 Mycobacterium phage EvilGenius, complete genome 20765-20797 8 0.758
NZ_CP009803_3 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder 68261-68293 33 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 752490-752522 8 0.758
NZ_CP009803_3 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder 68505-68537 33 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 239087-239119 8 0.758
NZ_CP009803_3 3.18|68688|33|NZ_CP009803|CRT,CRISPRCasFinder 68688-68720 33 NZ_CP013125 Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence 89250-89282 8 0.758
NZ_CP009803_3 3.27|69238|33|NZ_CP009803|CRT,CRISPRCasFinder 69238-69270 33 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 534389-534421 8 0.758
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 499247-499279 8 0.758
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP043850 Micrococcus luteus strain NCCP 15687 plasmid unnamed, complete sequence 48298-48330 8 0.758
NZ_CP009803_3 3.31|69482|33|NZ_CP009803|CRT,CRISPRCasFinder 69482-69514 33 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 15395-15427 8 0.758
NZ_CP009803_3 3.31|69482|33|NZ_CP009803|CRT,CRISPRCasFinder 69482-69514 33 NZ_CP031753 Rhodobacter sphaeroides strain EBL0706 plasmid p.B, complete sequence 64530-64562 8 0.758
NZ_CP009803_3 3.32|69543|33|NZ_CP009803|CRT,CRISPRCasFinder 69543-69575 33 MH015258 Ruegeria phage vB_RpoS-V16, complete genome 30867-30899 8 0.758
NZ_CP009803_3 3.36|68268|33|NZ_CP009803|PILER-CR 68268-68300 33 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 752490-752522 8 0.758
NZ_CP009803_3 3.40|68512|33|NZ_CP009803|PILER-CR 68512-68544 33 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 239087-239119 8 0.758
NZ_CP009803_3 3.43|68695|33|NZ_CP009803|PILER-CR 68695-68727 33 NZ_CP013125 Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence 89250-89282 8 0.758
NZ_CP009803_3 3.52|69245|33|NZ_CP009803|PILER-CR 69245-69277 33 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 534389-534421 8 0.758
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 499247-499279 8 0.758
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP043850 Micrococcus luteus strain NCCP 15687 plasmid unnamed, complete sequence 48298-48330 8 0.758
NZ_CP009803_3 3.56|69489|33|NZ_CP009803|PILER-CR 69489-69521 33 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 15395-15427 8 0.758
NZ_CP009803_3 3.56|69489|33|NZ_CP009803|PILER-CR 69489-69521 33 NZ_CP031753 Rhodobacter sphaeroides strain EBL0706 plasmid p.B, complete sequence 64530-64562 8 0.758
NZ_CP009803_3 3.57|69550|33|NZ_CP009803|PILER-CR 69550-69582 33 MH015258 Ruegeria phage vB_RpoS-V16, complete genome 30867-30899 8 0.758
NZ_CP009803_5 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT 73807-73839 33 NZ_CP032314 Pannonibacter phragmitetus BB plasmid p.BB_2, complete sequence 85507-85539 8 0.758
NZ_CP009803_5 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT 73868-73900 33 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 4575-4607 8 0.758
NZ_CP009803_5 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT 73868-73900 33 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 43882-43914 8 0.758
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 297106-297134 8 0.724
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 22397-22425 8 0.724
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 187990-188018 8 0.724
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 226446-226474 8 0.724
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 6601-6629 8 0.724
NZ_CP009803_5 5.7|74051|29|NZ_CP009803|CRT 74051-74079 29 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 33556-33584 8 0.724
NZ_CP009803_5 5.13|74413|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74413-74445 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4532680-4532712 8 0.758
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 452142-452174 8 0.758
NZ_CP009803_5 5.15|74535|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74535-74567 33 NC_022001 Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence 57899-57931 8 0.758
NZ_CP009803_5 5.15|74535|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74535-74567 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 113370-113402 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 255570-255602 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 275954-275986 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 258685-258717 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 320053-320085 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 412121-412153 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1986521-1986553 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 259630-259662 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 870767-870799 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1248707-1248739 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 259944-259976 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 266979-267011 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 256727-256759 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 148461-148493 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 255810-255842 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 253008-253040 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 256975-257007 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 259961-259993 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 274419-274451 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 258712-258744 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 272752-272784 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 320122-320154 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 251579-251611 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 274419-274451 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 258712-258744 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 274419-274451 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 251582-251614 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 274419-274451 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 258712-258744 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 258712-258744 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 258712-258744 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 251582-251614 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 266962-266994 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 266933-266965 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 263564-263596 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 261691-261723 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 257223-257255 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 251582-251614 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 274419-274451 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 272747-272779 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 251582-251614 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 251582-251614 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 258712-258744 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 272753-272785 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 370397-370429 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1816674-1816706 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 375693-375725 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1681953-1681985 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 659826-659858 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 157169-157201 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 53618-53650 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 131770-131802 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 824194-824226 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1837919-1837951 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 401302-401334 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1819967-1819999 8 0.758
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1819967-1819999 8 0.758
NZ_CP009803_5 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75094-75126 33 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 195465-195497 8 0.758
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 198015-198047 8 0.758
NZ_CP009803_6 6.1|79877|28|NZ_CP009803|CRT 79877-79904 28 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 582357-582384 8 0.714
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 196008-196039 8 0.75
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 78046-78077 8 0.75
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 244633-244664 8 0.75
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 136260-136291 8 0.75
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 306661-306693 8 0.758
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 46441-46473 8 0.758
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 46447-46479 8 0.758
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 46442-46474 8 0.758
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1049196-1049228 8 0.758
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_LT559121 Nonomuraea gerenzanensis isolate nono1 plasmid II, complete sequence 34329-34361 8 0.758
NZ_CP009803_6 6.10|80419|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80419-80451 33 NZ_CP041223 Porphyrobacter sp. YT40 plasmid pYT40, complete sequence 69347-69379 8 0.758
NZ_CP009803_6 6.12|80541|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80541-80573 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 852188-852220 8 0.758
NZ_CP009803_6 6.13|80602|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80602-80634 33 KT001914 Caulobacter phage Seuss, complete genome 73472-73504 8 0.758
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 67818-67850 8 0.758
NZ_CP009803_6 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80663-80695 33 KU204984 Pseudomonas phage AAT-1, complete genome 47181-47213 8 0.758
NZ_CP009803_6 6.15|80724|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80724-80756 33 NZ_CP045374 Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence 18210-18242 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 687197-687229 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 113372-113404 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1254456-1254488 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 559077-559109 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 168666-168698 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 328393-328425 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 CP054921 Streptomyces sp. NA03103 plasmid unnamed1, complete sequence 5370-5402 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP047174 Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence 54683-54715 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 MK977696 Gordonia phage SCentae, complete genome 68628-68660 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 MK977695 Gordonia phage Pupper, complete genome 68479-68511 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP033508 Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence 66581-66613 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP033369 Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence 66581-66613 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 181993-182025 8 0.758
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 290665-290697 8 0.758
NZ_CP009803_6 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81090-81122 33 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 330930-330962 8 0.758
NZ_CP009803_6 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81273-81305 33 NZ_CP020883 Xanthomonas citri pv. citri strain TX160042 plasmid unnamed1, complete sequence 99003-99035 8 0.758
NZ_CP009803_6 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81273-81305 33 NZ_CP020886 Xanthomonas citri pv. citri strain TX160149 plasmid unnamed1, complete sequence 62676-62708 8 0.758
NZ_CP009803_6 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81273-81305 33 NZ_CP020890 Xanthomonas citri pv. citri strain TX160197 plasmid unnamed1, complete sequence 27496-27528 8 0.758
NZ_CP009803_6 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81395-81427 33 NC_010333 Caulobacter sp. K31 plasmid pCAUL02, complete sequence 109253-109285 8 0.758
NZ_CP009803_6 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81395-81427 33 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 151130-151162 8 0.758
NZ_CP009803_6 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81395-81427 33 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 151131-151163 8 0.758
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 74792-74824 8 0.758
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 243045-243077 8 0.758
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 240219-240251 8 0.758
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 433513-433545 8 0.758
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 NZ_CP041158 Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence 36476-36508 8 0.758
NZ_CP009803_6 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82066-82098 33 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 912809-912841 8 0.758
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP044976 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence 249708-249740 8 0.758
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 JN106175 Uncultured bacterium plasmid pAKD34, complete sequence 77826-77858 8 0.758
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 KX241618 Xanthomonas phage Xoo-sp2, complete genome 53762-53794 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 426603-426635 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1047282-1047314 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1083593-1083625 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 787985-788017 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 1120646-1120678 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 488380-488412 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 240897-240929 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1252173-1252205 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP029050 Miniimonas sp. S16 plasmid pS16-1, complete sequence 39559-39591 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 788056-788088 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 355847-355879 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 443756-443788 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1083181-1083213 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1569117-1569149 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 813827-813859 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 70188-70220 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 717737-717769 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 787833-787865 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1453338-1453370 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 717737-717769 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 717738-717770 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 787811-787843 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 717740-717772 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 717740-717772 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 378658-378690 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 717740-717772 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 717740-717772 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 717734-717766 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 717740-717772 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 369582-369614 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 717740-717772 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 717740-717772 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 369582-369614 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1557693-1557725 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1721969-1722001 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1585388-1585420 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1639984-1640016 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1634860-1634892 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1475973-1476005 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 163267-163299 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1655172-1655204 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1661700-1661732 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1691890-1691922 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1640023-1640055 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1828758-1828790 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1400473-1400505 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1639982-1640014 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1958627-1958659 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1583630-1583662 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1662633-1662665 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1547830-1547862 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1372272-1372304 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1592526-1592558 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1622803-1622835 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1474995-1475027 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1545264-1545296 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1545265-1545297 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1587344-1587376 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1475965-1475997 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1475318-1475350 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1475955-1475987 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1542579-1542611 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1586826-1586858 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1674113-1674145 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1570308-1570340 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1545561-1545593 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1386038-1386070 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1488761-1488793 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1557858-1557890 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1570954-1570986 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1570330-1570362 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1580214-1580246 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1557839-1557871 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1560861-1560893 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1614678-1614710 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1653010-1653042 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1570330-1570362 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1689040-1689072 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1570330-1570362 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1570330-1570362 8 0.758
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1557820-1557852 8 0.758
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 7650-7682 8 0.758
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 30197-30229 8 0.758
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 63666-63698 8 0.758
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 68952-68984 8 0.758
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 122669-122701 8 0.758
NZ_CP009803_6 6.46|80177|30|NZ_CP009803|PILER-CR 80177-80206 30 NC_011273 Mycobacterium phage Myrna, complete genome 115796-115825 8 0.733
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 372447-372477 8 0.742
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 187425-187455 8 0.742
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1798750-1798780 8 0.742
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 775738-775768 8 0.742
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP048637 Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence 15129-15159 8 0.742
NZ_CP009803_1 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT 65523-65555 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1126492-1126524 9 0.727
NZ_CP009803_1 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT 65523-65555 33 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 230280-230312 9 0.727
NZ_CP009803_1 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT 65584-65616 33 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 102600-102632 9 0.727
NZ_CP009803_2 2.6|66641|34|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66641-66674 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1124066-1124099 9 0.735
NZ_CP009803_2 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66764-66796 33 NZ_CP032230 Streptomyces seoulensis strain KCTC 9819 plasmid unnamed 14491-14523 9 0.727
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 121732-121764 9 0.727
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 609455-609487 9 0.727
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081083-1081115 9 0.727
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 61758-61790 9 0.727
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP026518 Deinococcus sp. NW-56 plasmid unnamed2, complete sequence 173350-173382 9 0.727
NZ_CP009803_2 2.12|67008|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 67008-67040 33 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 1160097-1160129 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 64411-64443 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 AP018479 Mycobacterium phage GS4E DNA, complete sequence 20359-20391 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_023606 Mycobacterium phage CRB1, complete genome 20339-20371 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MN369748 Mycobacterium phage Miko, complete genome 21963-21995 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_022087 Mycobacterium phage AnnaL29, complete genome 22177-22209 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF185727 Mycobacterium phage BobSwaget, complete genome 21974-22006 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MK801735 Mycobacterium Phage Rachaly, complete genome 21990-22022 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_023597 Mycobacterium phage 20ES, complete genome 20382-20414 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH825709 Mycobacterium phage NicoleTera, complete genome 22168-22200 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF140403 Mycobacterium phage Changeling, complete genome 22176-22208 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KU761558 Mycobacterium phage Loser, complete genome 22098-22130 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 GU339467 Mycobacterium phage RedRock, complete genome 22256-22288 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 JN408461 Mycobacterium phage Trixie, complete genome 22011-22043 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KT588442 Mycobacterium phage LadyBird, complete genome 20327-20359 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 NC_023607 Mycobacterium phage 40AC, complete genome 22575-22607 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MF324899 Mycobacterium phage Lokk, complete genome 21993-22025 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 JX899358 Mycobacterium phage First, complete genome 20382-20414 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KU761559 Mycobacterium phage ArcherNM, complete genome 22122-22154 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 KX641263 Mycobacterium phage Kalpine, complete genome 22142-22174 9 0.727
NZ_CP009803_3 3.1|67649|33|NZ_CP009803|CRT 67649-67681 33 MH513984 Mycobacterium phage Steamy, complete genome 21395-21427 9 0.727
NZ_CP009803_3 3.12|68322|33|NZ_CP009803|CRT,CRISPRCasFinder 68322-68354 33 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 21307-21339 9 0.727
NZ_CP009803_3 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder 68444-68476 33 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1638793-1638825 9 0.727
NZ_CP009803_3 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder 68444-68476 33 NC_004574 Ruegeria sp. PR1b plasmid pSD25, complete sequence 129063-129095 9 0.727
NZ_CP009803_3 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder 68444-68476 33 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 5724-5756 9 0.727
NZ_CP009803_3 3.23|68994|33|NZ_CP009803|CRT,CRISPRCasFinder 68994-69026 33 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 14802-14834 9 0.727
NZ_CP009803_3 3.26|69177|33|NZ_CP009803|CRT,CRISPRCasFinder 69177-69209 33 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 615801-615833 9 0.727
NZ_CP009803_3 3.37|68329|33|NZ_CP009803|PILER-CR 68329-68361 33 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 21307-21339 9 0.727
NZ_CP009803_3 3.39|68451|33|NZ_CP009803|PILER-CR 68451-68483 33 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1638793-1638825 9 0.727
NZ_CP009803_3 3.39|68451|33|NZ_CP009803|PILER-CR 68451-68483 33 NC_004574 Ruegeria sp. PR1b plasmid pSD25, complete sequence 129063-129095 9 0.727
NZ_CP009803_3 3.39|68451|33|NZ_CP009803|PILER-CR 68451-68483 33 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 5724-5756 9 0.727
NZ_CP009803_3 3.48|69001|33|NZ_CP009803|PILER-CR 69001-69033 33 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 14802-14834 9 0.727
NZ_CP009803_3 3.51|69184|33|NZ_CP009803|PILER-CR 69184-69216 33 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 615801-615833 9 0.727
NZ_CP009803_4 4.1|69880|33|NZ_CP009803|CRISPRCasFinder 69880-69912 33 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 370199-370231 9 0.727
NZ_CP009803_5 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT 73685-73717 33 KJ194581 Mycobacterium phage Audrey, complete genome 13287-13319 9 0.727
NZ_CP009803_5 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT 73685-73717 33 MT310871 Mycobacterium phage Jackstina, complete genome 13213-13245 9 0.727
NZ_CP009803_5 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT 73685-73717 33 EU816589 Mycobacterium phage Phaedrus, complete genome 13204-13236 9 0.727
NZ_CP009803_5 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT 73685-73717 33 NC_041965 Mycobacterium phage Athena, complete genome 14050-14082 9 0.727
NZ_CP009803_5 5.2|73746|33|NZ_CP009803|CRISPRCasFinder,CRT 73746-73778 33 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 92108-92140 9 0.727
NZ_CP009803_5 5.2|73746|33|NZ_CP009803|CRISPRCasFinder,CRT 73746-73778 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1430745-1430777 9 0.727
NZ_CP009803_5 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT 73807-73839 33 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 189714-189746 9 0.727
NZ_CP009803_5 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT 73868-73900 33 NZ_CP035505 Kocuria indica strain CE7 plasmid pCE7, complete sequence 19981-20013 9 0.727
NZ_CP009803_5 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT 73990-74022 33 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 29071-29103 9 0.727
NZ_CP009803_5 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT 73990-74022 33 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 621106-621138 9 0.727
NZ_CP009803_5 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT 73990-74022 33 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 800699-800731 9 0.727
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 131823-131855 9 0.727
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 123181-123213 9 0.727
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 132007-132039 9 0.727
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 585670-585702 9 0.727
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 12489-12521 9 0.727
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 575923-575955 9 0.727
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 257651-257683 9 0.727
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 95705-95737 9 0.727
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 123150-123182 9 0.727
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1437411-1437443 9 0.727
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1551924-1551956 9 0.727
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1726705-1726737 9 0.727
NZ_CP009803_5 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74474-74506 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 580440-580472 9 0.727
NZ_CP009803_5 5.15|74535|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74535-74567 33 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 79623-79655 9 0.727
NZ_CP009803_5 5.16|74596|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74596-74628 33 NC_049850 Burkholderia phage BcepSaruman, complete genome 202213-202245 9 0.727
NZ_CP009803_5 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74850-74882 33 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 125628-125660 9 0.727
NZ_CP009803_5 5.21|74911|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 74911-74943 33 NZ_CP019309 Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-2, complete sequence 16990-17022 9 0.727
NZ_CP009803_5 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75216-75248 33 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 295578-295610 9 0.727
NZ_CP009803_5 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75216-75248 33 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1057960-1057992 9 0.727
NZ_CP009803_5 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75216-75248 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 756071-756103 9 0.727
NZ_CP009803_5 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75216-75248 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 655319-655351 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1166548-1166580 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1196557-1196589 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1466873-1466905 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 353416-353448 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1539697-1539729 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1545341-1545373 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1718866-1718898 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1285047-1285079 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1464364-1464396 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 542164-542196 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1984544-1984576 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1547148-1547180 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 923733-923765 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1256805-1256837 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1473172-1473204 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1503932-1503964 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1469902-1469934 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1648156-1648188 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1569922-1569954 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1432704-1432736 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1469431-1469463 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1558628-1558660 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1648123-1648155 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1524116-1524148 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1557335-1557367 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1646917-1646949 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1545343-1545375 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1460402-1460434 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1524428-1524460 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1557335-1557367 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1646953-1646985 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1524116-1524148 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1461048-1461080 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1523319-1523351 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1557335-1557367 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1557335-1557367 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1557335-1557367 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1646953-1646985 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 494125-494157 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1646942-1646974 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1460424-1460456 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1464747-1464779 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1445398-1445430 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1498344-1498376 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1537534-1537566 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1554650-1554682 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1646942-1646974 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1460424-1460456 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1524427-1524459 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1561140-1561172 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1647943-1647975 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1460424-1460456 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1460424-1460456 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1646953-1646985 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1557338-1557370 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 487011-487043 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1646964-1646996 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1646765-1646797 9 0.727
NZ_CP009803_5 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75277-75309 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 487011-487043 9 0.727
NZ_CP009803_5 5.29|75399|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder 75399-75431 33 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 734391-734423 9 0.727
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 51705-51736 9 0.719
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 758-789 9 0.719
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 458049-458080 9 0.719
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 225215-225246 9 0.719
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 372446-372478 9 0.727
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1798749-1798781 9 0.727
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP048816 Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed 93218-93250 9 0.727
NZ_CP009803_6 6.9|80358|33|NZ_CP009803|CRT,CRISPRCasFinder 80358-80390 33 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1607189-1607221 9 0.727
NZ_CP009803_6 6.12|80541|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80541-80573 33 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 47444-47476 9 0.727
NZ_CP009803_6 6.12|80541|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80541-80573 33 MN908685 Microbacterium phage PauloDiaboli, complete genome 114512-114544 9 0.727
NZ_CP009803_6 6.15|80724|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80724-80756 33 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 171620-171652 9 0.727
NZ_CP009803_6 6.15|80724|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80724-80756 33 MF140398 Mycobacterium phage Amohnition, complete genome 24698-24730 9 0.727
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1715757-1715789 9 0.727
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1627948-1627980 9 0.727
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1627949-1627981 9 0.727
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP043960 Streptomyces tendae strain 139 plasmid unnamed1, complete sequence 117590-117622 9 0.727
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_047992 Microbacterium phage Zeta1847, complete genome 26430-26462 9 0.727
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 JN698995 Mycobacterium phage Dori, complete genome 19689-19721 9 0.727
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 274719-274751 9 0.727
NZ_CP009803_6 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81334-81366 33 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 194519-194551 9 0.727
NZ_CP009803_6 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81395-81427 33 NZ_CP026517 Deinococcus sp. NW-56 plasmid unnamed1, complete sequence 95652-95684 9 0.727
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 553729-553761 9 0.727
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 8805-8837 9 0.727
NZ_CP009803_6 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81456-81488 33 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 174462-174494 9 0.727
NZ_CP009803_6 6.29|81578|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81578-81610 33 NZ_CP029360 Azospirillum sp. CFH 70021 plasmid unnamed5 33814-33846 9 0.727
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 NZ_LR594661 Variovorax sp. PBL-H6 plasmid 3 30911-30943 9 0.727
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 NZ_CP044974 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B4) plasmid pPBL-H3_B4-2, complete sequence 103228-103260 9 0.727
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 AP018707 Uncultured bacterium plasmid pSN1104-11 DNA, complete sequence 39454-39486 9 0.727
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 AP018708 Uncultured bacterium plasmid pSN1104-34 DNA, complete sequence 39538-39570 9 0.727
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 NZ_CP044977 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence 105779-105811 9 0.727
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 MN536506 Uncultured bacterium plasmid pEN1, complete sequence 57614-57646 9 0.727
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 NZ_CP044551 Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence 105299-105331 9 0.727
NZ_CP009803_6 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81639-81671 33 NZ_LR594677 Variovorax sp. PBS-H4 plasmid 3 48879-48911 9 0.727
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 184837-184869 9 0.727
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 618726-618758 9 0.727
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 18788-18820 9 0.727
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 MN369764 Mycobacterium phage Rahalelujah, complete genome 18323-18355 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP018473 Xanthomonas perforans strain LH3 plasmid pLH3.4, complete sequence 7233-7265 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP018473 Xanthomonas perforans strain LH3 plasmid pLH3.4, complete sequence 26607-26639 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_KX169264 Pseudomonas aeruginosa strain D5170990 plasmid pD5170990, complete sequence 20405-20437 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_KP975076 Pseudomonas aeruginosa strain MRSN17623 plasmid pMRVIM0713, complete sequence 34760-34792 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 MN336501 Pseudomonas aeruginosa strain 164130 plasmid p4130-KPC, complete sequence 55043-55075 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP014066 Achromobacter xylosoxidans strain FDAARGOS_162 plasmid unnamed, complete sequence 11281-11313 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP014059 Achromobacter xylosoxidans strain FDAARGOS_147 plasmid, complete sequence 3368-3400 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP021651 Acidovorax sp. T1 plasmid p3-T1, complete sequence 22423-22455 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NC_009739 Pseudomonas aeruginosa plasmid pMATVIM-7, complete sequence 21120-21152 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_MK423762 Achromobacter ruhlandii strain 138R plasmid p138R, complete sequence 17852-17884 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP033834 Pseudomonas aeruginosa strain FDAARGOS_570 plasmid unnamed, complete sequence 506-538 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_AP013064 Serratia marcescens SM39 plasmid pSMC1, complete sequence 13077-13109 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NC_042132 Gordonia phage Sour, complete genome 439-471 9 0.727
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NC_009472 Acidiphilium cryptum JF-5 plasmid pACRY06, complete sequence 3204-3236 9 0.727
NZ_CP009803_6 6.40|82249|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82249-82281 33 MN940411 Staphylococcus phage f2b1, partial genome 49000-49032 9 0.727
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 487807-487839 9 0.727
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP036456 Streptomonospora sp. M2 plasmid phiM2, complete sequence 28675-28707 9 0.727
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 292061-292093 9 0.727
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP049319 Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence 309648-309678 9 0.71
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2690058-2690088 9 0.71
NZ_CP009803_6 6.47|80237|31|NZ_CP009803|PILER-CR 80237-80267 31 NZ_CP049159 Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence 131366-131396 9 0.71
NZ_CP009803_2 2.3|66458|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66458-66490 33 MN855882 Bacteriophage sp. isolate 347, complete genome 3845-3877 10 0.697
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 430155-430187 10 0.697
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 215975-216007 10 0.697
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 167705-167737 10 0.697
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 421636-421668 10 0.697
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 22399-22431 10 0.697
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 306559-306591 10 0.697
NZ_CP009803_3 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder 68505-68537 33 NZ_CP022304 Thalassococcus sp. S3 plasmid pS3A, complete sequence 23920-23952 10 0.697
NZ_CP009803_3 3.26|69177|33|NZ_CP009803|CRT,CRISPRCasFinder 69177-69209 33 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 328079-328111 10 0.697
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 188592-188624 10 0.697
NZ_CP009803_3 3.40|68512|33|NZ_CP009803|PILER-CR 68512-68544 33 NZ_CP022304 Thalassococcus sp. S3 plasmid pS3A, complete sequence 23920-23952 10 0.697
NZ_CP009803_3 3.51|69184|33|NZ_CP009803|PILER-CR 69184-69216 33 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 328079-328111 10 0.697
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 188592-188624 10 0.697
NZ_CP009803_4 4.1|69880|33|NZ_CP009803|CRISPRCasFinder 69880-69912 33 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 206127-206159 10 0.697
NZ_CP009803_4 4.1|69880|33|NZ_CP009803|CRISPRCasFinder 69880-69912 33 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 206093-206125 10 0.697
NZ_CP009803_4 4.1|69880|33|NZ_CP009803|CRISPRCasFinder 69880-69912 33 NC_017959 Tistrella mobilis KA081020-065 plasmid pTM4, complete sequence 43510-43542 10 0.697
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 85244-85276 10 0.697
NZ_CP009803_5 5.8|74108|33|NZ_CP009803|CRT 74108-74140 33 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1134640-1134672 10 0.697
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 266208-266239 10 0.688
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 MH976515 Gordonia phage Octobien14, complete genome 41624-41655 10 0.688
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 MN096358 Microbacterium phage LeeroyJenkins, complete genome 14658-14689 10 0.688
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 MN096357 Microbacterium phage WaterT, complete genome 14471-14502 10 0.688
NZ_CP009803_6 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder 80176-80207 32 NC_011273 Mycobacterium phage Myrna, complete genome 115795-115826 10 0.688
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP049319 Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence 309647-309679 10 0.697
NZ_CP009803_6 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder 80236-80268 33 NZ_CP049159 Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence 131365-131397 10 0.697
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1085023-1085055 10 0.697
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 728101-728133 10 0.697
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 128273-128305 10 0.697
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP026306 Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence 23570-23602 10 0.697
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 824466-824498 10 0.697
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 1049735-1049767 10 0.697
NZ_CP009803_6 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81090-81122 33 KT221034 Streptomyces phage SF3, complete genome 35533-35565 10 0.697
NZ_CP009803_6 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81334-81366 33 MK372342 Enterobacteria phage vB_EcoS_IME542, complete genome 27051-27083 10 0.697
NZ_CP009803_6 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81334-81366 33 HM486077 Tsukamurella phage TPA2, complete sequence 15208-15240 10 0.697
NZ_CP009803_6 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81334-81366 33 NC_015210 Tsukamurella phage TPA2, complete genome 15208-15240 10 0.697
NZ_CP009803_6 6.40|82249|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82249-82281 33 MK894437 Microbacterium phage MonChoix, complete genome 19167-19199 10 0.697
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 MK937594 Gordonia phage Galadriel, complete genome 13402-13434 10 0.697
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 MT723934 Gordonia phage Love, complete genome 13713-13745 10 0.697
NZ_CP009803_6 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82310-82342 33 MK977702 Gordonia terrae phage McKinley, complete genome 14172-14204 10 0.697
NZ_CP009803_6 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82554-82586 33 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1371420-1371452 10 0.697
NZ_CP009803_2 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR 66886-66918 33 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 364757-364789 11 0.667
NZ_CP009803_3 3.24|69055|33|NZ_CP009803|CRT,CRISPRCasFinder 69055-69087 33 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 700483-700515 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP029453 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence 240858-240890 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP029453 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence 376093-376125 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP023069 Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence 254248-254280 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP023069 Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence 384882-384914 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 405998-406030 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 441358-441390 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 411195-411227 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 107880-107912 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 139758-139790 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP029233 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence 256502-256534 11 0.667
NZ_CP009803_3 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder 69299-69331 33 NZ_CP029233 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence 392599-392631 11 0.667
NZ_CP009803_3 3.49|69062|33|NZ_CP009803|PILER-CR 69062-69094 33 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 700483-700515 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP029453 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence 240858-240890 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP029453 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence 376093-376125 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP023069 Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence 254248-254280 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP023069 Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence 384882-384914 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 405998-406030 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 441358-441390 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 411195-411227 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 107880-107912 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 139758-139790 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP029233 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence 256502-256534 11 0.667
NZ_CP009803_3 3.53|69306|33|NZ_CP009803|PILER-CR 69306-69338 33 NZ_CP029233 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence 392599-392631 11 0.667
NZ_CP009803_6 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder 79994-80025 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 745988-746019 11 0.656
NZ_CP009803_6 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder 80297-80329 33 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 100832-100864 11 0.667
NZ_CP009803_6 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 80907-80939 33 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 263644-263676 11 0.667
NZ_CP009803_6 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 81090-81122 33 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 415960-415992 11 0.667
NZ_CP009803_6 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82066-82098 33 NZ_CP009882 Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence 27190-27222 11 0.667
NZ_CP009803_6 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82066-82098 33 NZ_CP045723 Pantoea eucalypti strain LMG 24197 plasmid unnamed3, complete sequence 58615-58647 11 0.667
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1662610-1662642 11 0.667
NZ_CP009803_6 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82127-82159 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1639073-1639105 11 0.667
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP033327 Xanthomonas cucurbitae strain ATCC 23378 plasmid unnamed, complete sequence 3648-3680 11 0.667
NZ_CP009803_6 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR 82188-82220 33 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 518719-518751 11 0.667

1. spacer 1.1|65399|35|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cctccggatcgagtcgccatcgagcggcgacgtcg	CRISPR spacer
cctccggatcgagtcgccatcgagcggcgacgtcg	Protospacer
***********************************

2. spacer 1.2|65462|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtacttgcggcggatcaggacgtagccctcg	CRISPR spacer
ccgtacttgcggcggatcaggacgtagccctcg	Protospacer
*********************************

3. spacer 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tctcctcctacaccgcgctggagaccaaggcac	CRISPR spacer
tctcctcctacaccgcgctggagaccaaggcac	Protospacer
*********************************

4. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
ggcatgaccggcaacgcgctgctgaaggcgcag	Protospacer
*********************************

5. spacer 1.5|65645|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gaggcggtctgcgctcgagggggtcaccgggtc	CRISPR spacer
gaggcggtctgcgctcgagggggtcaccgggtc	Protospacer
*********************************

6. spacer 2.1|66336|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaggacgaccgcgatctgctcgttgctgagc	CRISPR spacer
cgcaggacgaccgcgatctgctcgttgctgagc	Protospacer
*********************************

7. spacer 2.2|66397|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccaacacaccgaccgtgttctctgcgtacacc	CRISPR spacer
gccaacacaccgaccgtgttctctgcgtacacc	Protospacer
*********************************

8. spacer 2.3|66458|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

tggagggtgagggtcgcggtgtctgcgtcgtac	CRISPR spacer
tggagggtgagggtcgcggtgtctgcgtcgtac	Protospacer
*********************************

9. spacer 2.3|66458|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggagggtgagggtcgcggtgtctgcgtcgtac	CRISPR spacer
tggagggtgagggtcgcggtgtctgcgtcgtac	Protospacer
*********************************

10. spacer 2.4|66519|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggggtcgatgtgcgcccccctggcggcccg	CRISPR spacer
gctggggtcgatgtgcgcccccctggcggcccg	Protospacer
*********************************

11. spacer 2.5|66580|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atcgctgacacctacaacgagtactcgaccatc	CRISPR spacer
atcgctgacacctacaacgagtactcgaccatc	Protospacer
*********************************

12. spacer 2.6|66641|34|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tcatcgagggaatcgacaaggcgcagccggagct	CRISPR spacer
tcatcgagggaatcgacaaggcgcagccggagct	Protospacer
**********************************

13. spacer 2.7|66703|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcacgggcgcccgtgatcagccgctggttgtc	CRISPR spacer
ggcacgggcgcccgtgatcagccgctggttgtc	Protospacer
*********************************

14. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ggcggccgggtcggtcaccagggcctcgccgcc	Protospacer
*********************************

15. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ggcggccgggtcggtcaccagggcctcgccgcc	Protospacer
*********************************

16. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ggcggccgggtcggtcaccagggcctcgccgcc	Protospacer
*********************************

17. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ggcggccgggtcggtcaccagggcctcgccgcc	Protospacer
*********************************

18. spacer 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtccttcgggtcgtgatgcataggtgtggcga	CRISPR spacer
tgtccttcgggtcgtgatgcataggtgtggcga	Protospacer
*********************************

19. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ctgctcctcggcgcgttgctgggcggcgcgggc	Protospacer
*********************************

20. spacer 2.11|66947|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcagtccggccagaacggcaggcagtcgcac	CRISPR spacer
gggcagtccggccagaacggcaggcagtcgcac	Protospacer
*********************************

21. spacer 2.12|67008|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggctctccgcctgcctgcggccctcctcggcc	CRISPR spacer
cggctctccgcctgcctgcggccctcctcggcc	Protospacer
*********************************

22. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
accgactgggagttcaccgagaacgactactgg	Protospacer
*********************************

23. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
accgactgggagttcaccgagaacgactactgg	Protospacer
*********************************

24. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
accgactgggagttcaccgagaacgactactgg	Protospacer
*********************************

25. spacer 3.2|67710|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggc	Protospacer
*********************************

26. spacer 3.2|67710|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggc	Protospacer
*********************************

27. spacer 3.2|67710|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggc	Protospacer
*********************************

28. spacer 3.3|67771|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgagcatggtggaaatggcagagcacctgaagg	CRISPR spacer
tgagcatggtggaaatggcagagcacctgaagg	Protospacer
*********************************

29. spacer 3.3|67771|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgagcatggtggaaatggcagagcacctgaagg	CRISPR spacer
tgagcatggtggaaatggcagagcacctgaagg	Protospacer
*********************************

30. spacer 3.4|67832|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 0, identity: 1.0

gtccttgtggccaggatgcggcgccactcggtc	CRISPR spacer
gtccttgtggccaggatgcggcgccactcggtc	Protospacer
*********************************

31. spacer 3.4|67832|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccttgtggccaggatgcggcgccactcggtc	CRISPR spacer
gtccttgtggccaggatgcggcgccactcggtc	Protospacer
*********************************

32. spacer 3.5|67893|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtcctcttggggcggcatgcgccgcgagcac	CRISPR spacer
ccgtcctcttggggcggcatgcgccgcgagcac	Protospacer
*********************************

33. spacer 3.6|67954|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtccaggtcgccggggcgtagtgccggtagacc	CRISPR spacer
gtccaggtcgccggggcgtagtgccggtagacc	Protospacer
*********************************

34. spacer 3.6|67954|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccaggtcgccggggcgtagtgccggtagacc	CRISPR spacer
gtccaggtcgccggggcgtagtgccggtagacc	Protospacer
*********************************

35. spacer 3.6|67954|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtccaggtcgccggggcgtagtgccggtagacc	CRISPR spacer
gtccaggtcgccggggcgtagtgccggtagacc	Protospacer
*********************************

36. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tggcaggagatccggtagaccgcgcccggctcg	Protospacer
*********************************

37. spacer 3.8|68076|35|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cccgtgttggtctacctaccggtaccgcacaaggg	CRISPR spacer
cccgtgttggtctacctaccggtaccgcacaaggg	Protospacer
***********************************

38. spacer 3.9|68139|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgcggcccaccgagtcggcccggatgtgcag	CRISPR spacer
gacgcggcccaccgagtcggcccggatgtgcag	Protospacer
*********************************

39. spacer 3.10|68200|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgtccaggtctacgagaccactcgtagccacg	CRISPR spacer
ttgtccaggtctacgagaccactcgtagccacg	Protospacer
*********************************

40. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gccctgaacgcgctgcgcggcgagaccgtctgg	Protospacer
*********************************

41. spacer 3.12|68322|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

accggcttgttgtaggccacgtcccggccggcc	CRISPR spacer
accggcttgttgtaggccacgtcccggccggcc	Protospacer
*********************************

42. spacer 3.12|68322|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accggcttgttgtaggccacgtcccggccggcc	CRISPR spacer
accggcttgttgtaggccacgtcccggccggcc	Protospacer
*********************************

43. spacer 3.12|68322|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accggcttgttgtaggccacgtcccggccggcc	CRISPR spacer
accggcttgttgtaggccacgtcccggccggcc	Protospacer
*********************************

44. spacer 3.13|68383|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtccggtgcttcggtggtgttcggggtcaggg	CRISPR spacer
tgtccggtgcttcggtggtgttcggggtcaggg	Protospacer
*********************************

45. spacer 3.13|68383|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtccggtgcttcggtggtgttcggggtcaggg	CRISPR spacer
tgtccggtgcttcggtggtgttcggggtcaggg	Protospacer
*********************************

46. spacer 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
ccgtactcccggggcggcatgcgccgcgagcac	Protospacer
*********************************

47. spacer 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
ccgtactcccggggcggcatgcgccgcgagcac	Protospacer
*********************************

48. spacer 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcgcgtggcgggggtgccggggctggtgtgac	CRISPR spacer
cgcgcgtggcgggggtgccggggctggtgtgac	Protospacer
*********************************

49. spacer 3.16|68566|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgtggcgcctggcggcctgcaccgaaggcgac	CRISPR spacer
gtgtggcgcctggcggcctgcaccgaaggcgac	Protospacer
*********************************

50. spacer 3.17|68627|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggacggagaagaggatggcaccggccgtgatgg	CRISPR spacer
ggacggagaagaggatggcaccggccgtgatgg	Protospacer
*********************************

51. spacer 3.17|68627|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 0, identity: 1.0

ggacggagaagaggatggcaccggccgtgatgg	CRISPR spacer
ggacggagaagaggatggcaccggccgtgatgg	Protospacer
*********************************

52. spacer 3.17|68627|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 0, identity: 1.0

ggacggagaagaggatggcaccggccgtgatgg	CRISPR spacer
ggacggagaagaggatggcaccggccgtgatgg	Protospacer
*********************************

53. spacer 3.18|68688|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atgaggatgggctgccagtagcggtagtcccac	CRISPR spacer
atgaggatgggctgccagtagcggtagtcccac	Protospacer
*********************************

54. spacer 3.19|68749|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggctgatccgcagcttgtaggggtagagcgtc	CRISPR spacer
aggctgatccgcagcttgtaggggtagagcgtc	Protospacer
*********************************

55. spacer 3.20|68810|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgatggcggggcgcagtcatgaccgaccag	CRISPR spacer
cggcgatggcggggcgcagtcatgaccgaccag	Protospacer
*********************************

56. spacer 3.20|68810|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgatggcggggcgcagtcatgaccgaccag	CRISPR spacer
cggcgatggcggggcgcagtcatgaccgaccag	Protospacer
*********************************

57. spacer 3.21|68871|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgatggcggggcgcagtcatgaccgaccag	CRISPR spacer
cggcgatggcggggcgcagtcatgaccgaccag	Protospacer
*********************************

58. spacer 3.21|68871|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgatggcggggcgcagtcatgaccgaccag	CRISPR spacer
cggcgatggcggggcgcagtcatgaccgaccag	Protospacer
*********************************

59. spacer 3.22|68932|34|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccatccactcccactcaatccgtcatgtcact	CRISPR spacer
tgccatccactcccactcaatccgtcatgtcact	Protospacer
**********************************

60. spacer 3.23|68994|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcaaaaaggggaagctcgggagcctcacgccc	CRISPR spacer
ctcaaaaaggggaagctcgggagcctcacgccc	Protospacer
*********************************

61. spacer 3.24|69055|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcacggtcggtaggtccgatcgtcggggagacg	CRISPR spacer
gcacggtcggtaggtccgatcgtcggggagacg	Protospacer
*********************************

62. spacer 3.25|69116|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccaggccatgagtccgatcacgggcccgctgc	CRISPR spacer
gccaggccatgagtccgatcacgggcccgctgc	Protospacer
*********************************

63. spacer 3.26|69177|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tacgcccgcatcacgctgcggctgcccgacacc	CRISPR spacer
tacgcccgcatcacgctgcggctgcccgacacc	Protospacer
*********************************

64. spacer 3.27|69238|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgtccgagacaacctcgaagccggtgtctgc	CRISPR spacer
gccgtccgagacaacctcgaagccggtgtctgc	Protospacer
*********************************

65. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
atcgtcggcaacaccggcgtcgccacccggcac	Protospacer
*********************************

66. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 0, identity: 1.0

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
atcgtcggcaacaccggcgtcgccacccggcac	Protospacer
*********************************

67. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 0, identity: 1.0

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
atcgtcggcaacaccggcgtcgccacccggcac	Protospacer
*********************************

68. spacer 3.29|69360|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgcagaccaggggagacagcgtgaacgag	CRISPR spacer
gcttcgcagaccaggggagacagcgtgaacgag	Protospacer
*********************************

69. spacer 3.30|69421|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccctagacgcccccctgagcgcctgtcaggcag	CRISPR spacer
ccctagacgcccccctgagcgcctgtcaggcag	Protospacer
*********************************

70. spacer 3.31|69482|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgagaccgagggcatggacctgtccaagatg	CRISPR spacer
ggcgagaccgagggcatggacctgtccaagatg	Protospacer
*********************************

71. spacer 3.32|69543|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgtagacgtcgcggaaccggcggcggcgc	CRISPR spacer
cgggcgtagacgtcgcggaaccggcggcggcgc	Protospacer
*********************************

72. spacer 3.33|68076|42|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cccgtgttggtctacctaccggtaccgcacaaggggagcatc	CRISPR spacer
cccgtgttggtctacctaccggtaccgcacaaggggagcatc	Protospacer
******************************************

73. spacer 3.34|68146|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgcggcccaccgagtcggcccggatgtgcag	CRISPR spacer
gacgcggcccaccgagtcggcccggatgtgcag	Protospacer
*********************************

74. spacer 3.35|68207|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgtccaggtctacgagaccactcgtagccacg	CRISPR spacer
ttgtccaggtctacgagaccactcgtagccacg	Protospacer
*********************************

75. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gccctgaacgcgctgcgcggcgagaccgtctgg	Protospacer
*********************************

76. spacer 3.37|68329|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

accggcttgttgtaggccacgtcccggccggcc	CRISPR spacer
accggcttgttgtaggccacgtcccggccggcc	Protospacer
*********************************

77. spacer 3.37|68329|33|NZ_CP009803|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accggcttgttgtaggccacgtcccggccggcc	CRISPR spacer
accggcttgttgtaggccacgtcccggccggcc	Protospacer
*********************************

78. spacer 3.37|68329|33|NZ_CP009803|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accggcttgttgtaggccacgtcccggccggcc	CRISPR spacer
accggcttgttgtaggccacgtcccggccggcc	Protospacer
*********************************

79. spacer 3.38|68390|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtccggtgcttcggtggtgttcggggtcaggg	CRISPR spacer
tgtccggtgcttcggtggtgttcggggtcaggg	Protospacer
*********************************

80. spacer 3.38|68390|33|NZ_CP009803|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtccggtgcttcggtggtgttcggggtcaggg	CRISPR spacer
tgtccggtgcttcggtggtgttcggggtcaggg	Protospacer
*********************************

81. spacer 3.39|68451|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
ccgtactcccggggcggcatgcgccgcgagcac	Protospacer
*********************************

82. spacer 3.39|68451|33|NZ_CP009803|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
ccgtactcccggggcggcatgcgccgcgagcac	Protospacer
*********************************

83. spacer 3.40|68512|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcgcgtggcgggggtgccggggctggtgtgac	CRISPR spacer
cgcgcgtggcgggggtgccggggctggtgtgac	Protospacer
*********************************

84. spacer 3.41|68573|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgtggcgcctggcggcctgcaccgaaggcgac	CRISPR spacer
gtgtggcgcctggcggcctgcaccgaaggcgac	Protospacer
*********************************

85. spacer 3.42|68634|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggacggagaagaggatggcaccggccgtgatgg	CRISPR spacer
ggacggagaagaggatggcaccggccgtgatgg	Protospacer
*********************************

86. spacer 3.42|68634|33|NZ_CP009803|PILER-CR matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 0, identity: 1.0

ggacggagaagaggatggcaccggccgtgatgg	CRISPR spacer
ggacggagaagaggatggcaccggccgtgatgg	Protospacer
*********************************

87. spacer 3.42|68634|33|NZ_CP009803|PILER-CR matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 0, identity: 1.0

ggacggagaagaggatggcaccggccgtgatgg	CRISPR spacer
ggacggagaagaggatggcaccggccgtgatgg	Protospacer
*********************************

88. spacer 3.43|68695|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atgaggatgggctgccagtagcggtagtcccac	CRISPR spacer
atgaggatgggctgccagtagcggtagtcccac	Protospacer
*********************************

89. spacer 3.44|68756|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggctgatccgcagcttgtaggggtagagcgtc	CRISPR spacer
aggctgatccgcagcttgtaggggtagagcgtc	Protospacer
*********************************

90. spacer 3.45|68817|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgatggcggggcgcagtcatgaccgaccag	CRISPR spacer
cggcgatggcggggcgcagtcatgaccgaccag	Protospacer
*********************************

91. spacer 3.45|68817|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgatggcggggcgcagtcatgaccgaccag	CRISPR spacer
cggcgatggcggggcgcagtcatgaccgaccag	Protospacer
*********************************

92. spacer 3.46|68878|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgatggcggggcgcagtcatgaccgaccag	CRISPR spacer
cggcgatggcggggcgcagtcatgaccgaccag	Protospacer
*********************************

93. spacer 3.46|68878|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgatggcggggcgcagtcatgaccgaccag	CRISPR spacer
cggcgatggcggggcgcagtcatgaccgaccag	Protospacer
*********************************

94. spacer 3.47|68939|34|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccatccactcccactcaatccgtcatgtcact	CRISPR spacer
tgccatccactcccactcaatccgtcatgtcact	Protospacer
**********************************

95. spacer 3.48|69001|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcaaaaaggggaagctcgggagcctcacgccc	CRISPR spacer
ctcaaaaaggggaagctcgggagcctcacgccc	Protospacer
*********************************

96. spacer 3.49|69062|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcacggtcggtaggtccgatcgtcggggagacg	CRISPR spacer
gcacggtcggtaggtccgatcgtcggggagacg	Protospacer
*********************************

97. spacer 3.50|69123|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccaggccatgagtccgatcacgggcccgctgc	CRISPR spacer
gccaggccatgagtccgatcacgggcccgctgc	Protospacer
*********************************

98. spacer 3.51|69184|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tacgcccgcatcacgctgcggctgcccgacacc	CRISPR spacer
tacgcccgcatcacgctgcggctgcccgacacc	Protospacer
*********************************

99. spacer 3.52|69245|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgtccgagacaacctcgaagccggtgtctgc	CRISPR spacer
gccgtccgagacaacctcgaagccggtgtctgc	Protospacer
*********************************

100. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
atcgtcggcaacaccggcgtcgccacccggcac	Protospacer
*********************************

101. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 0, identity: 1.0

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
atcgtcggcaacaccggcgtcgccacccggcac	Protospacer
*********************************

102. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 0, identity: 1.0

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
atcgtcggcaacaccggcgtcgccacccggcac	Protospacer
*********************************

103. spacer 3.54|69367|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgcagaccaggggagacagcgtgaacgag	CRISPR spacer
gcttcgcagaccaggggagacagcgtgaacgag	Protospacer
*********************************

104. spacer 3.55|69428|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccctagacgcccccctgagcgcctgtcaggcag	CRISPR spacer
ccctagacgcccccctgagcgcctgtcaggcag	Protospacer
*********************************

105. spacer 3.56|69489|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgagaccgagggcatggacctgtccaagatg	CRISPR spacer
ggcgagaccgagggcatggacctgtccaagatg	Protospacer
*********************************

106. spacer 3.57|69550|33|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgtagacgtcgcggaaccggcggcggcgc	CRISPR spacer
cgggcgtagacgtcgcggaaccggcggcggcgc	Protospacer
*********************************

107. spacer 4.1|69880|33|NZ_CP009803|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atggcgtcgaggcggatgaagatggtgccgccc	CRISPR spacer
atggcgtcgaggcggatgaagatggtgccgccc	Protospacer
*********************************

108. spacer 4.2|69941|33|NZ_CP009803|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcccatcaaagacgagactcatgagggggtca	CRISPR spacer
agcccatcaaagacgagactcatgagggggtca	Protospacer
*********************************

109. spacer 4.2|69941|33|NZ_CP009803|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

agcccatcaaagacgagactcatgagggggtca	CRISPR spacer
agcccatcaaagacgagactcatgagggggtca	Protospacer
*********************************

110. spacer 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

gcctggggcgacgagtggctcggcgtctggaag	CRISPR spacer
gcctggggcgacgagtggctcggcgtctggaag	Protospacer
*********************************

111. spacer 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcctggggcgacgagtggctcggcgtctggaag	CRISPR spacer
gcctggggcgacgagtggctcggcgtctggaag	Protospacer
*********************************

112. spacer 5.2|73746|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgagcagcccttgaagggcgtccatcagctc	CRISPR spacer
ggcgagcagcccttgaagggcgtccatcagctc	Protospacer
*********************************

113. spacer 5.2|73746|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgagcagcccttgaagggcgtccatcagctc	CRISPR spacer
ggcgagcagcccttgaagggcgtccatcagctc	Protospacer
*********************************

114. spacer 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

gactcctggaccggccgccggaacaccagcctc	CRISPR spacer
gactcctggaccggccgccggaacaccagcctc	Protospacer
*********************************

115. spacer 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

gactcctggaccggccgccggaacaccagcctc	CRISPR spacer
gactcctggaccggccgccggaacaccagcctc	Protospacer
*********************************

116. spacer 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gactcctggaccggccgccggaacaccagcctc	CRISPR spacer
gactcctggaccggccgccggaacaccagcctc	Protospacer
*********************************

117. spacer 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
gggtccgaccgcggcgacgccacgacgacggca	Protospacer
*********************************

118. spacer 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
gggtccgaccgcggcgacgccacgacgacggca	Protospacer
*********************************

119. spacer 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
gggtccgaccgcggcgacgccacgacgacggca	Protospacer
*********************************

120. spacer 5.5|73929|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggatcgcgatcacgactaccgcgatgttc	CRISPR spacer
ttccggatcgcgatcacgactaccgcgatgttc	Protospacer
*********************************

121. spacer 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcagcgccggcgagttcggcggaccacacggg	CRISPR spacer
gtcagcgccggcgagttcggcggaccacacggg	Protospacer
*********************************

122. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atgctcttcgccataatccagggcggcgt	CRISPR spacer
atgctcttcgccataatccagggcggcgt	Protospacer
*****************************

123. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
tactgggcggcgttgacgcgacgctcggtccgc	Protospacer
*********************************

124. spacer 5.9|74169|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggccgttcctcgtggtcgtgggagacgcgcccc	CRISPR spacer
ggccgttcctcgtggtcgtgggagacgcgcccc	Protospacer
*********************************

125. spacer 5.10|74230|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcgatgacgcttcccgacctggggattccgg	CRISPR spacer
gcgcgatgacgcttcccgacctggggattccgg	Protospacer
*********************************

126. spacer 5.11|74291|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcggggcgactcggcggcgggagcgggtgag	CRISPR spacer
gggcggggcgactcggcggcgggagcgggtgag	Protospacer
*********************************

127. spacer 5.12|74352|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atatgatcaccgctatggcaggcgtacgaggtc	CRISPR spacer
atatgatcaccgctatggcaggcgtacgaggtc	Protospacer
*********************************

128. spacer 5.13|74413|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcggtggcatgggccccagccgccgagcacag	CRISPR spacer
ctcggtggcatgggccccagccgccgagcacag	Protospacer
*********************************

129. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
gtccgccgggctgatcgcgctgaacgccggcgc	Protospacer
*********************************

130. spacer 5.15|74535|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atgacgtcctgccaggtgcggccgccggagccg	CRISPR spacer
atgacgtcctgccaggtgcggccgccggagccg	Protospacer
*********************************

131. spacer 5.16|74596|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atgcggcccaggcccacggcggaggtgaccgcg	CRISPR spacer
atgcggcccaggcccacggcggaggtgaccgcg	Protospacer
*********************************

132. spacer 5.17|74657|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcggcggcgaggactggtggcgccctgctgc	CRISPR spacer
cggcggcggcgaggactggtggcgccctgctgc	Protospacer
*********************************

133. spacer 5.18|74718|43|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ggaccctgcaccggtcggccgtcgaccgactcgaccgcgccct	CRISPR spacer
ggaccctgcaccggtcggccgtcgaccgactcgaccgcgccct	Protospacer
*******************************************

134. spacer 5.19|74789|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgccagtgggcgtggcccgcgaccctggacctg	CRISPR spacer
cgccagtgggcgtggcccgcgaccctggacctg	Protospacer
*********************************

135. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgacccgggcggccccgcctcctcgacc	Protospacer
*********************************

136. spacer 5.21|74911|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtaggcgctgatgatctcgcgtgccgggttc	CRISPR spacer
gcgtaggcgctgatgatctcgcgtgccgggttc	Protospacer
*********************************

137. spacer 5.22|74972|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgatccgggccctgctcggtgcgcggaccgcg	CRISPR spacer
tcgatccgggccctgctcggtgcgcggaccgcg	Protospacer
*********************************

138. spacer 5.23|75033|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgaggagcaagttgggcgggacggggagc	CRISPR spacer
ccgccgaggagcaagttgggcgggacggggagc	Protospacer
*********************************

139. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
gtcgccaaccggtccggccgctggctggcgcgc	Protospacer
*********************************

140. spacer 5.25|75155|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

accttgatcgcggtcatgggtggggctccttac	CRISPR spacer
accttgatcgcggtcatgggtggggctccttac	Protospacer
*********************************

141. spacer 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcggcgccgatgatcacgcggtgcgcgatgtt	CRISPR spacer
gtcggcgccgatgatcacgcggtgcgcgatgtt	Protospacer
*********************************

142. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
cgtgctcacgcggcaccgccgagggtgtcgcgg	Protospacer
*********************************

143. spacer 5.28|75338|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gttctgcatgactgcattgactgcgagaagccg	CRISPR spacer
gttctgcatgactgcattgactgcgagaagccg	Protospacer
*********************************

144. spacer 5.29|75399|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgcccgggggcgttgcctgacgcgccgtcag	CRISPR spacer
ctcgcccgggggcgttgcctgacgcgccgtcag	Protospacer
*********************************

145. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcgggcacggcatcaac	Protospacer
****************************

146. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcgggcacggcatcaac	Protospacer
****************************

147. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcgggcacggcatcaac	Protospacer
****************************

148. spacer 6.2|79933|33|NZ_CP009803|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtcgtggcccgcgagcctcgccgcaggtagc	CRISPR spacer
acgtcgtggcccgcgagcctcgccgcaggtagc	Protospacer
*********************************

149. spacer 6.2|79933|33|NZ_CP009803|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtcgtggcccgcgagcctcgccgcaggtagc	CRISPR spacer
acgtcgtggcccgcgagcctcgccgcaggtagc	Protospacer
*********************************

150. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
ttcacgctgagcgcggcgtcccgctcggacag	Protospacer
********************************

151. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
ttcacgctgagcgcggcgtcccgctcggacag	Protospacer
********************************

152. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
ttcacgctgagcgcggcgtcccgctcggacag	Protospacer
********************************

153. spacer 6.4|80054|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacgaagaagaggcgctgcggtttcaggtac	CRISPR spacer
ccgacgaagaagaggcgctgcggtttcaggtac	Protospacer
*********************************

154. spacer 6.4|80054|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacgaagaagaggcgctgcggtttcaggtac	CRISPR spacer
ccgacgaagaagaggcgctgcggtttcaggtac	Protospacer
*********************************

155. spacer 6.5|80115|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccatcgagcacgcggaacgtgaacgacgagccc	CRISPR spacer
ccatcgagcacgcggaacgtgaacgacgagccc	Protospacer
*********************************

156. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
tgtcgttgatggtggcctgcccagcgtggtcg	Protospacer
********************************

157. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 0, identity: 1.0

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
tcggcgcggacgggcatgtcgaggcccatgagc	Protospacer
*********************************

158. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
tcggcgcggacgggcatgtcgaggcccatgagc	Protospacer
*********************************

159. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 0, identity: 1.0

cacgatccggccggggcgatctgcgcgacgtgg	CRISPR spacer
cacgatccggccggggcgatctgcgcgacgtgg	Protospacer
*********************************

160. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cacgatccggccggggcgatctgcgcgacgtgg	CRISPR spacer
cacgatccggccggggcgatctgcgcgacgtgg	Protospacer
*********************************

161. spacer 6.9|80358|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtcgacggtcagccaggacagccccagctcc	CRISPR spacer
ctgtcgacggtcagccaggacagccccagctcc	Protospacer
*********************************

162. spacer 6.10|80419|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gacacgatgcacgaatcgactgaggccgtacag	CRISPR spacer
gacacgatgcacgaatcgactgaggccgtacag	Protospacer
*********************************

163. spacer 6.11|80480|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcccctccctgctgaaaagcgggtcagagctgg	CRISPR spacer
gcccctccctgctgaaaagcgggtcagagctgg	Protospacer
*********************************

164. spacer 6.12|80541|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgaccggcggggacagccgtcagcgggcggac	CRISPR spacer
gcgaccggcggggacagccgtcagcgggcggac	Protospacer
*********************************

165. spacer 6.13|80602|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcctcgtggcagtcgaggaacaggccgtcgcgg	CRISPR spacer
gcctcgtggcagtcgaggaacaggccgtcgcgg	Protospacer
*********************************

166. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
atgccgcgcagctcgggcagccgggtgaggagc	Protospacer
*********************************

167. spacer 6.15|80724|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggtccgtgcaggtcggcgtgctcggcaagcc	CRISPR spacer
ccggtccgtgcaggtcggcgtgctcggcaagcc	Protospacer
*********************************

168. spacer 6.16|80785|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

accatcgccccgaatcgggcagacttggtgatg	CRISPR spacer
accatcgccccgaatcgggcagacttggtgatg	Protospacer
*********************************

169. spacer 6.17|80846|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gaggagcgcgagacccggaagcgtcgcggtctc	CRISPR spacer
gaggagcgcgagacccggaagcgtcgcggtctc	Protospacer
*********************************

170. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ctcaccgccgcgctcaccggcggcgcgctgaag	Protospacer
*********************************

171. spacer 6.19|80968|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcagctcaatgcgcccgccaggcgcggggacc	CRISPR spacer
tgcagctcaatgcgcccgccaggcgcggggacc	Protospacer
*********************************

172. spacer 6.20|81029|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

caaacgccaaacactcggctctcgcggtcaggg	CRISPR spacer
caaacgccaaacactcggctctcgcggtcaggg	Protospacer
*********************************

173. spacer 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccctcgactacctcgccgacgactgcggggtg	CRISPR spacer
gccctcgactacctcgccgacgactgcggggtg	Protospacer
*********************************

174. spacer 6.22|81151|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggctctggagaacacctctgcggatcatccc	CRISPR spacer
ccggctctggagaacacctctgcggatcatccc	Protospacer
*********************************

175. spacer 6.23|81212|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggttcgagcggccctgatcccccttcaggatc	CRISPR spacer
cggttcgagcggccctgatcccccttcaggatc	Protospacer
*********************************

176. spacer 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcgggcggtgaggtcgaccatggaggccagc	CRISPR spacer
tcgcgggcggtgaggtcgaccatggaggccagc	Protospacer
*********************************

177. spacer 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccatcgacaatctcaccgccgccctgcggaagc	CRISPR spacer
ccatcgacaatctcaccgccgccctgcggaagc	Protospacer
*********************************

178. spacer 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgccgtgccggtcatggtcaccaccgtcgcg	CRISPR spacer
gccgccgtgccggtcatggtcaccaccgtcgcg	Protospacer
*********************************

179. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
ccgctggtggtcgacctggcgttcgtcggcgcg	Protospacer
*********************************

180. spacer 6.28|81517|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacacgtccttccgctccatctgccgccac	CRISPR spacer
agcaacacgtccttccgctccatctgccgccac	Protospacer
*********************************

181. spacer 6.29|81578|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtcaacggcgccgtcgtgactggtgggcagc	CRISPR spacer
aggtcaacggcgccgtcgtgactggtgggcagc	Protospacer
*********************************

182. spacer 6.29|81578|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

aggtcaacggcgccgtcgtgactggtgggcagc	CRISPR spacer
aggtcaacggcgccgtcgtgactggtgggcagc	Protospacer
*********************************

183. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cgggggatttcggccggctgggggtcggtgggg	Protospacer
*********************************

184. spacer 6.31|81700|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atgtacgggctctgggccgacaccccctccggg	CRISPR spacer
atgtacgggctctgggccgacaccccctccggg	Protospacer
*********************************

185. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgagctctcgcccgaacgccaaggccggctgc	CRISPR spacer
ctgagctctcgcccgaacgccaaggccggctgc	Protospacer
*********************************

186. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgagctctcgcccgaacgccaaggccggctgc	CRISPR spacer
ctgagctctcgcccgaacgccaaggccggctgc	Protospacer
*********************************

187. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgagctctcgcccgaacgccaaggccggctgc	CRISPR spacer
ctgagctctcgcccgaacgccaaggccggctgc	Protospacer
*********************************

188. spacer 6.33|81822|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

atcgtgcagatcgcacaggtcatcacgcaggtg	CRISPR spacer
atcgtgcagatcgcacaggtcatcacgcaggtg	Protospacer
*********************************

189. spacer 6.34|81883|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

accgcccggagcagtgacctgcacgaaccgcag	CRISPR spacer
accgcccggagcagtgacctgcacgaaccgcag	Protospacer
*********************************

190. spacer 6.35|81944|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcggcgtccagcacgatgcgtggatcaccgcg	CRISPR spacer
gtcggcgtccagcacgatgcgtggatcaccgcg	Protospacer
*********************************

191. spacer 6.36|82005|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

actacgaggcccgccgggcgtggctcaaggacg	CRISPR spacer
actacgaggcccgccgggcgtggctcaaggacg	Protospacer
*********************************

192. spacer 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtagggcgcccagcgcatgccgtccgggttc	CRISPR spacer
ccgtagggcgcccagcgcatgccgtccgggttc	Protospacer
*********************************

193. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcgttgaggttctcggtggcgccggtccggga	CRISPR spacer
ttcgttgaggttctcggtggcgccggtccggga	Protospacer
*********************************

194. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
tccctcggcggccgggtcatcgaggccggccac	Protospacer
*********************************

195. spacer 6.40|82249|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagagcaggcgcagcaggagacccaggccaac	CRISPR spacer
gcagagcaggcgcagcaggagacccaggccaac	Protospacer
*********************************

196. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gggctggtgccgacggggccggcggtctccacc	Protospacer
*********************************

197. spacer 6.42|82371|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggctacgtccgcatcgacacgctgcggctg	CRISPR spacer
ttcggctacgtccgcatcgacacgctgcggctg	Protospacer
*********************************

198. spacer 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

tccagcgcacggcccccgacggacccgacgcgg	CRISPR spacer
tccagcgcacggcccccgacggacccgacgcgg	Protospacer
*********************************

199. spacer 6.44|82493|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

agggccgtcacagcgcgcgcaaccgaccccggg	CRISPR spacer
agggccgtcacagcgcgcgcaaccgaccccggg	Protospacer
*********************************

200. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
ccggcggcggagtcgaccagccggtagagggcg	Protospacer
*********************************

201. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtggcctgcccagcgtggtc	Protospacer
******************************

202. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
cggcgcggacgggcatgtcgaggcccatgag	Protospacer
*******************************

203. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
cggcgcggacgggcatgtcgaggcccatgag	Protospacer
*******************************

204. spacer 1.1|65399|35|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 1, identity: 0.971

cctccggatcgagtcgccatcgagcggcgacgtcg	CRISPR spacer
cctccggatcgagtcgccatcgagcggcgacatcg	Protospacer
*******************************.***

205. spacer 1.5|65645|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 1, identity: 0.97

gaggcggtctgcgctcgagggggtcaccgggtc	CRISPR spacer
gaggcgggctgcgctcgagggggtcaccgggtc	Protospacer
******* *************************

206. spacer 1.5|65645|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 1, identity: 0.97

gaggcggtctgcgctcgagggggtcaccgggtc	CRISPR spacer
gaggcgggctgcgctcgagggggtcaccgggtc	Protospacer
******* *************************

207. spacer 2.1|66336|33|NZ_CP009803|CRISPRCasFinder,CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97

cgcaggacgaccgcgatctgctcgttgctgagc	CRISPR spacer
cgcaggacgaccgcgatctgctcgttgctgatc	Protospacer
******************************* *

208. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ggcggctgggtcggtcaccagggcctcgccgcc	Protospacer
******.**************************

209. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
gggcaggagatccggtagaccgcgcccggctcg	Protospacer
 ********************************

210. spacer 4.1|69880|33|NZ_CP009803|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 1, identity: 0.97

atggcgtcgaggcggatgaagatggtgccgccc	CRISPR spacer
atggcgtcgaggcggatggagatggtgccgccc	Protospacer
******************.**************

211. spacer 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 1, identity: 0.97

gtcagcgccggcgagttcggcggaccacacggg	CRISPR spacer
gtcagcgccggccagttcggcggaccacacggg	Protospacer
************ ********************

212. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 1, identity: 0.97

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
tactgggcggcgttgacgcggcgctcggtccgc	Protospacer
********************.************

213. spacer 6.1|79877|28|NZ_CP009803|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.964

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
catcgtcgtcctcgggcacggcatcaac	Protospacer
*.**************************

214. spacer 6.2|79933|33|NZ_CP009803|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 1, identity: 0.97

acgtcgtggcccgcgagcctcgccgcaggtagc	CRISPR spacer
acgtcgtggcccgcgagcctcgccgcaggtggc	Protospacer
******************************.**

215. spacer 6.2|79933|33|NZ_CP009803|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97

acgtcgtggcccgcgagcctcgccgcaggtagc	CRISPR spacer
acgtcgtggcccgcgagccccgccgcaggtagc	Protospacer
*******************.*************

216. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 1, identity: 0.97

cacgatccggccggggcgatctgcgcgacgtgg	CRISPR spacer
cacgacccggccggggcgatctgcgcgacgtgg	Protospacer
*****.***************************

217. spacer 1.1|65399|35|NZ_CP009803|CRISPRCasFinder,CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.943

cctccggatcgagtcgccatcgagcggcgacgtcg	CRISPR spacer
cctccggatggtgtcgccatcgagcggcgacgtcg	Protospacer
********* * ***********************

218. spacer 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tctcctcctacaccgcgctggagaccaaggcac	CRISPR spacer
tctcctcctacaccgcgctggagaccaaggcgg	Protospacer
*******************************. 

219. spacer 3.5|67893|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 2, identity: 0.939

ccgtcctcttggggcggcatgcgccgcgagcac	CRISPR spacer
ccgtcctcctggggcggcatgcgtcgcgagcac	Protospacer
********.**************.*********

220. spacer 3.5|67893|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.939

ccgtcctcttggggcggcatgcgccgcgagcac	CRISPR spacer
ccgtcctcctggggcggcatgcgtcgcgagcac	Protospacer
********.**************.*********

221. spacer 3.24|69055|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 2, identity: 0.939

gcacggtcggtaggtccgatcgtcggggagacg	CRISPR spacer
gctcggtcggtgggtccgatcgtcggggagacg	Protospacer
** ********.*********************

222. spacer 3.49|69062|33|NZ_CP009803|PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 2, identity: 0.939

gcacggtcggtaggtccgatcgtcggggagacg	CRISPR spacer
gctcggtcggtgggtccgatcgtcggggagacg	Protospacer
** ********.*********************

223. spacer 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 2, identity: 0.939

gtcagcgccggcgagttcggcggaccacacggg	CRISPR spacer
gtcagcgccggccagctcggcggaccacacggg	Protospacer
************ **.*****************

224. spacer 5.7|74051|29|NZ_CP009803|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.931

atgctcttcgccataatccagggcggcgt	CRISPR spacer
atgctcttcgcgatcatccagggcggcgt	Protospacer
*********** ** **************

225. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_013417 (Streptomyces sp. x3 plasmid pTSC2, complete sequence) position: , mismatch: 2, identity: 0.939

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
gtcggccgcgctgatcgcgctgaacgccggcgc	Protospacer
*** **** ************************

226. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 2, identity: 0.938

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
tgtcgttgatggtggactgcccggcgtggtcg	Protospacer
*************** ******.*********

227. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 2, identity: 0.938

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
tgtcggtgatggtggcctgcccggcgtggtcg	Protospacer
***** ****************.*********

228. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 2, identity: 0.939

ttcgttga-ggttctcggtggcgccggtccggga	CRISPR spacer
-tcgttgagggttctcggtggtgccggtccggga	Protospacer
 ******* ************.************

229. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 2, identity: 0.933

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtggactgcccggcgtggtc	Protospacer
************** ******.********

230. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 2, identity: 0.933

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcggtgatggtggcctgcccggcgtggtc	Protospacer
**** ****************.********

231. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 3, identity: 0.909

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
gtccgccgggctgatcgcgctgaccggcggccc	Protospacer
*********************** ** **** *

232. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.909

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
gtccgccgggctgatcgcgctgaccggcggccc	Protospacer
*********************** ** **** *

233. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.909

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
gtccgccgggctgatcgcgctgaccggcggccc	Protospacer
*********************** ** **** *

234. spacer 5.17|74657|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 3, identity: 0.909

cggcggcggcgaggactggtggcgccctgctgc	CRISPR spacer
tggcggcgccgagggctggtggcgccctgctgc	Protospacer
.******* *****.******************

235. spacer 5.19|74789|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033585 (Streptomyces sp. ADI95-16 plasmid pADI95-16d, complete sequence) position: , mismatch: 3, identity: 0.909

cgccagtgggcgtggcccgcgaccctggacctg	CRISPR spacer
cgccagtgggcgtggcccgcgaccctggacgcc	Protospacer
****************************** . 

236. spacer 6.13|80602|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_023068 (Streptomyces sp. F11 plasmid pFP12, complete sequence) position: , mismatch: 3, identity: 0.909

gcctcgtggcagtcgaggaacaggccgtcgcgg	CRISPR spacer
ccctcgtggcagtccaggaacaggccgtcccgg	Protospacer
 ************* ************** ***

237. spacer 6.34|81883|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.909

accgcccggagcagtgacctgcacgaaccgcag	CRISPR spacer
accgccccgggcagtgacctgcacgaaccgctg	Protospacer
******* *.********************* *

238. spacer 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.879

tctcctcctacaccgcgctggagaccaaggcac	CRISPR spacer
tctcctcctacaccgcgctggatgccaaggccg	Protospacer
********************** .*******  

239. spacer 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 4, identity: 0.879

tctcctcctacaccgcgctggagaccaaggcac	CRISPR spacer
tctcctcctacaccgccctggaggccaaggccg	Protospacer
**************** ******.*******  

240. spacer 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NC_023068 (Streptomyces sp. F11 plasmid pFP12, complete sequence) position: , mismatch: 5, identity: 0.848

tgtccttcgggtcgtgatgcataggtgtg-gcga	CRISPR spacer
cggccgtcgggccgtgatgcataggtgtgcgcg-	Protospacer
.* ** *****.***************** *** 

241. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.848

ctgctcc-tcggcgcgttgctgggcggcgcgggc	CRISPR spacer
-agctccatcggcgcggtgctcggcggcgcggac	Protospacer
  ***** ******** **** **********.*

242. spacer 5.11|74291|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.848

gggcggggcgactcggcggcgggagcgggtgag-	CRISPR spacer
gggcggggcggctcggcggcgggaac-cgtgacc	Protospacer
**********.*************.*  ****  

243. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.848

gtccgccg-ggctgatcgcgctgaacgccggcgc	CRISPR spacer
-gccgctgctgctgatcgcgctgaacgccgccgc	Protospacer
  ****.*  ******************** ***

244. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcctcctcgggcccggcacccgc	Protospacer
******* ********* *****.* .*

245. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcctcctcgggcccggcacccgc	Protospacer
******* ********* *****.* .*

246. spacer 6.1|79877|28|NZ_CP009803|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcctcctcgggcccggcacccgc	Protospacer
******* ********* *****.* .*

247. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgccgacgtcctcgggcacggcatgacg	Protospacer
**.** ****************** *  

248. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcctcctcgggcccggcacccgc	Protospacer
******* ********* *****.* .*

249. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcggtcacggagtcggc	Protospacer
*************** ***** .**..*

250. spacer 6.1|79877|28|NZ_CP009803|CRT matches to MN204493 (Streptomyces phage Zuko, complete genome) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcggggacggtgtcgtc	Protospacer
**************** ****..**. *

251. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to AP014350 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C22, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.848

atgccg--cgcagctcgggcagccgggtgaggagc	CRISPR spacer
--gccaatcgcagctcaggcagccaggtgaggagc	Protospacer
  ***.  ********.*******.**********

252. spacer 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041019 (Sphingobium fuliginis ATCC 27551 plasmid pSF2, complete sequence) position: , mismatch: 5, identity: 0.848

gccgccgtgccggtcatggtcaccaccgtcgcg	CRISPR spacer
gccgccgtgccggtcatggtctccacggcaacg	Protospacer
********************* **** *. .**

253. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.848

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
accctcggccaccgggtcatcgaggccggcagc	Protospacer
 ******** .******************* .*

254. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to MH651171 (Mycobacterium phage Collard, complete genome) position: , mismatch: 6, identity: 0.818

-ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
aggctcga-cggcaaggcgctgcggaaggcgcac	Protospacer
 *** .** ****** ******* ********* 

255. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_028947 (Mycobacterium phage Kratio, complete genome) position: , mismatch: 6, identity: 0.818

-ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
aggctcga-cggcaaggcgctgcggaaggcgcac	Protospacer
 *** .** ****** ******* ********* 

256. spacer 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007575 (Streptomyces albulus strain NK660 plasmid pNKL, complete sequence) position: , mismatch: 6, identity: 0.818

tgtccttcgggtcgtgatgcataggtgtggcga	CRISPR spacer
gcaccaccgggtcgtgatgcataggtgtggcgg	Protospacer
   ** .*************************.

257. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 6, identity: 0.818

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
gtccgcttcggcgcggagctgggcggcgcgggc	Protospacer
 * * *.********  ****************

258. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN703405 (Mycobacterium phage Aneem, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

259. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH338237 (Mycobacterium phage Joselito, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

260. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK524507 (Mycobacterium phage Orange, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

261. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK524514 (Mycobacterium phage Bud, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

262. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN310547 (Mycobacterium phage Hutc2, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

263. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_031257 (Mycobacterium phage Mulciber, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

264. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH338236 (Mycobacterium phage Ebony, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

265. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK494130 (Mycobacterium phage Fibonacci, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

266. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK524511 (Mycobacterium phage Bowtie, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

267. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK524519 (Mycobacterium phage Salz, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

268. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN586006 (Mycobacterium phage Bachome, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-aaccggc	Protospacer
*.*** **********.*********  **.** 

269. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK524513 (Mycobacterium phage Munch, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

270. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF140410 (Mycobacterium phage Et2Brutus, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

271. spacer 3.1|67649|33|NZ_CP009803|CRT matches to Z18946 (Mycobacterium phage L5 complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gactggc	Protospacer
 .*** **********.*********  ***** 

272. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH536828 (Mycobacterium phage Snape, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

273. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_017973 (Mycobacterium phage SWU1, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gactggc	Protospacer
 .*** **********.*********  ***** 

274. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KY471460 (Mycobacterium phage Jabith, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

275. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN892487 (Mycobacterium phage Mabel, complete genome) position: , mismatch: 6, identity: 0.818

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
atcgagtgggagttcatcgagaacga-gaccggc	Protospacer
*.*** **********.*********  **.** 

276. spacer 3.2|67710|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 6, identity: 0.818

-cgtcactacgacccgaccggtgcccggtacggc	CRISPR spacer
acgat-ctacgaccccaccggtgcctggtacggg	Protospacer
 ** . ********* *********.******* 

277. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049734 (Rhizobium leguminosarum strain A1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggttgg	Protospacer
** *************** ******..**.* *

278. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP049734 (Rhizobium leguminosarum strain A1 plasmid pRLa11, complete sequence) position: , mismatch: 6, identity: 0.818

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggttgg	Protospacer
** *************** ******..**.* *

279. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030762 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggttgg	Protospacer
** *************** ******..**.* *

280. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022670 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR5, complete sequence) position: , mismatch: 6, identity: 0.818

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggttgg	Protospacer
** *************** ******..**.* *

281. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054035 (Rhizobium sp. JKLM13E plasmid pPR13E04, complete sequence) position: , mismatch: 6, identity: 0.818

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggttgg	Protospacer
** *************** ******..**.* *

282. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054024 (Rhizobium sp. JKLM12A2 plasmid pPR12A203, complete sequence) position: , mismatch: 6, identity: 0.818

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggttgg	Protospacer
** *************** ******..**.* *

283. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 6, identity: 0.818

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgcgctgcgcgccgagaccggcatg	Protospacer
*  **************** ******** *  *

284. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

285. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
ctggtcggcaacaacggcgtcgtcaccc-gcgcg	Protospacer
 * ********** ********.***** **.* 

286. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.818

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
ctggtcggcaacaacggcgtcgtcaccc-gcgcg	Protospacer
 * ********** ********.***** **.* 

287. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggcca	Protospacer
 * ** ************** ** ********  

288. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

289. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

290. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

291. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

292. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

293. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

294. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

295. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP024583 (Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atcg-tcggcaacaccggcgtcgccacccggcac	CRISPR spacer
-tcgctcggcaacaacgacgtcgccacccgcgaa	Protospacer
 *** ********* **.************  * 

296. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP046475 (Janibacter melonis strain M714 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
gccgtcggcagcaccggcgtcggca-ccggcgcc	Protospacer
..********.*********** ** *****.* 

297. spacer 3.32|69543|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP030371 (Salinibacter ruber strain RM158 plasmid pSR60, complete sequence) position: , mismatch: 6, identity: 0.818

-cgggcgtagacgtcgcggaaccggcggcggcgc	CRISPR spacer
gcggac-catacgtcgtggaaccgccggcggcgc	Protospacer
 ***.* .* ******.******* *********

298. spacer 3.32|69543|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP030363 (Salinibacter ruber strain SP73 plasmid pSR118, complete sequence) position: , mismatch: 6, identity: 0.818

-cgggcgtagacgtcgcggaaccggcggcggcgc	CRISPR spacer
gcggac-catacgtcgtggaaccgccggcggcgc	Protospacer
 ***.* .* ******.******* *********

299. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 6, identity: 0.818

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgcgctgcgcgccgagaccggcatg	Protospacer
*  **************** ******** *  *

300. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

301. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
ctggtcggcaacaacggcgtcgtcaccc-gcgcg	Protospacer
 * ********** ********.***** **.* 

302. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.818

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
ctggtcggcaacaacggcgtcgtcaccc-gcgcg	Protospacer
 * ********** ********.***** **.* 

303. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggcca	Protospacer
 * ** ************** ** ********  

304. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

305. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

306. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

307. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

308. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

309. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

310. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.818

-atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gagcg-cggcaacaccggcggcgacacccggccg	Protospacer
 * ** ************** ** ********  

311. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP024583 (Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atcg-tcggcaacaccggcgtcgccacccggcac	CRISPR spacer
-tcgctcggcaacaacgacgtcgccacccgcgaa	Protospacer
 *** ********* **.************  * 

312. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP046475 (Janibacter melonis strain M714 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
gccgtcggcagcaccggcgtcggca-ccggcgcc	Protospacer
..********.*********** ** *****.* 

313. spacer 3.57|69550|33|NZ_CP009803|PILER-CR matches to NZ_CP030371 (Salinibacter ruber strain RM158 plasmid pSR60, complete sequence) position: , mismatch: 6, identity: 0.818

-cgggcgtagacgtcgcggaaccggcggcggcgc	CRISPR spacer
gcggac-catacgtcgtggaaccgccggcggcgc	Protospacer
 ***.* .* ******.******* *********

314. spacer 3.57|69550|33|NZ_CP009803|PILER-CR matches to NZ_CP030363 (Salinibacter ruber strain SP73 plasmid pSR118, complete sequence) position: , mismatch: 6, identity: 0.818

-cgggcgtagacgtcgcggaaccggcggcggcgc	CRISPR spacer
gcggac-catacgtcgtggaaccgccggcggcgc	Protospacer
 ***.* .* ******.******* *********

315. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 6, identity: 0.818

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
ccgcgccgggctgatcgcgctgatcgcgggcac	Protospacer
 . ******************** *** ***.*

316. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_020303 (Corynebacterium halotolerans YIM 70093 = DSM 44683 plasmid pCha1, complete sequence) position: , mismatch: 6, identity: 0.818

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
gaccgccgggctgatcgcgctgatcgtggtccc	Protospacer
* ********************* **. * * *

317. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.818

--gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
cactcgcc--tcgggccggccgctggccggcgcgc	Protospacer
   *****  .*** ************.*******

318. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtgctcgggcacggttccggc	Protospacer
********* ***********. .*..*

319. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgacgtcctcgggcacggcgagata	Protospacer
***** ****************.  *  

320. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cttcgtcgtcctcggtcacggcataggg	Protospacer
* ************* ******** .. 

321. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtgatcgggcacggcaaattc	Protospacer
*********  ************    *

322. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP020698 (Sulfitobacter sp. D7 plasmid p4SUD7, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
ccaggtcgtccttgggcgcggcatcaaa	Protospacer
*   ********.****.********* 

323. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcttcctcgggctcggcacctgg	Protospacer
******* ********* *****.* . 

324. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP020447 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
catcgtcgtcctcggtcacggcaacgct	Protospacer
*.************* ******* *. .

325. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
tgtcgtcgtgctcgtgcacggcatgggc	Protospacer
.******** **** ********* ..*

326. spacer 6.1|79877|28|NZ_CP009803|CRT matches to MH371110 (Mycobacterium phage Magnar, complete genome) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
acacatcatcctcgggcacggcatccac	Protospacer
   *.**.***************** **

327. spacer 6.1|79877|28|NZ_CP009803|CRT matches to MK061415 (Mycobacterium phage Rhynn, complete genome) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
acacatcatcctcgggcacggcatccac	Protospacer
   *.**.***************** **

328. spacer 6.1|79877|28|NZ_CP009803|CRT matches to KP027205 (Mycobacterium phage Alvin, complete genome) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
acacatcatcctcgggcacggcatccac	Protospacer
   *.**.***************** **

329. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to AF447491 (Bacteriophage phiE125, complete genome) position: , mismatch: 6, identity: 0.812

ttcacgctgagcgcggcgtcccgct--cggacag	CRISPR spacer
atctcgctgagcgcggcgtctcgctacccgac--	Protospacer
 ** ****************.****  * ***  

330. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_003309 (Burkholderia phage phiE125, complete genome) position: , mismatch: 6, identity: 0.812

ttcacgctgagcgcggcgtcccgct--cggacag	CRISPR spacer
atctcgctgagcgcggcgtctcgctacccgac--	Protospacer
 ** ****************.****  * ***  

331. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 6, identity: 0.818

cacgatccggccggggcgatctgcgcgacgtgg	CRISPR spacer
tacgagccggccggggcgatctgcgcctggtgc	Protospacer
.**** ********************   *** 

332. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 6, identity: 0.818

cacgat-ccggccggggcgatctgcgcgacgtgg	CRISPR spacer
-aagatactggccgcggcgatctgctcgacgtga	Protospacer
 * *** *.***** ********** *******.

333. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 6, identity: 0.818

cacgat-ccggccggggcgatctgcgcgacgtgg	CRISPR spacer
-aagatactggccgcggcgatctgctcgacgtga	Protospacer
 * *** *.***** ********** *******.

334. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.818

cacgat-ccggccggggcgatctgcgcgacgtgg	CRISPR spacer
-aagatactggccgcggcgatctgctcgacgtga	Protospacer
 * *** *.***** ********** *******.

335. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 6, identity: 0.818

cacgat-ccggccggggcgatctgcgcgacgtgg	CRISPR spacer
-aagatactggccgcggcgatctgctcgacgtga	Protospacer
 * *** *.***** ********** *******.

336. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.818

cacgat-ccggccggggcgatctgcgcgacgtgg	CRISPR spacer
-aagatactggccgcggcgatctgctcgacgtga	Protospacer
 * *** *.***** ********** *******.

337. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 6, identity: 0.818

cacgat-ccggccggggcgatctgcgcgacgtgg	CRISPR spacer
-aagatactggccgcggcgatctgctcgacgtga	Protospacer
 * *** *.***** ********** *******.

338. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 6, identity: 0.818

cacgat-ccggccggggcgatctgcgcgacgtgg	CRISPR spacer
-aagatactggccgcggcgatctgctcgacgtga	Protospacer
 * *** *.***** ********** *******.

339. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.818

cacgat-ccggccggggcgatctgcgcgacgtgg	CRISPR spacer
-aagatactggccgcggcgatctgctcgacgtga	Protospacer
 * *** *.***** ********** *******.

340. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP047034 (Rhodobacter sphaeroides strain DSM 158 plasmid pB, complete sequence) position: , mismatch: 6, identity: 0.818

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
gccccgcgcagctcggccagccgggcgaggatc	Protospacer
.. ************* ********.***** *

341. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015291 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid c, complete sequence) position: , mismatch: 6, identity: 0.818

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
gccccgcgcagctcggccagccgggcgaggatc	Protospacer
.. ************* ********.***** *

342. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047040 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pB, complete sequence) position: , mismatch: 6, identity: 0.818

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
gccccgcgcagctcggccagccgggcgaggatc	Protospacer
.. ************* ********.***** *

343. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 6, identity: 0.818

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
gccccgcgcagctcggccagccgggcgaggatc	Protospacer
.. ************* ********.***** *

344. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP051471 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10B, complete sequence) position: , mismatch: 6, identity: 0.818

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
gccccgcgcagctcggccagccgggcgaggatc	Protospacer
.. ************* ********.***** *

345. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP030274 (Rhodobacter sphaeroides 2.4.1 plasmid pB, complete sequence) position: , mismatch: 6, identity: 0.818

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
gccccgcgcagctcggccagccgggcgaggatc	Protospacer
.. ************* ********.***** *

346. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015215 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid d, complete sequence) position: , mismatch: 6, identity: 0.818

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
gccccgcgcagctcggccagccgggcgaggatc	Protospacer
.. ************* ********.***** *

347. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 6, identity: 0.818

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
cagccgcgctgctcgggcagccgggcgagaaac	Protospacer
  ******* ***************.***.*.*

348. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.818

ctcaccgccgcgctcaccggcggc-gcgctgaag	CRISPR spacer
ctcgccgccgcgctcaccggcgccggcgcccac-	Protospacer
***.****************** * ****. *  

349. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 6, identity: 0.818

ctcaccgccgcgctcaccggcggc--gcgctgaag	CRISPR spacer
ctcaccggcgcgctcacgggcggcctgcgtcga--	Protospacer
******* ********* ******  ***..**  

350. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.818

ttcgttgaggttctcggtggcgccggtccggga	CRISPR spacer
tcggtgagggttctcggtggtgccggtccggga	Protospacer
*. ** ..************.************

351. spacer 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

tccagcgcacggcccccgacggacccgacgcgg--	CRISPR spacer
tccagcgcaccgcccccggcgga--caacgcagca	Protospacer
********** *******.****  *.****.*  

352. spacer 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.818

tccagcgcacggcccccgacggacccgacgcgg--	CRISPR spacer
tccagcgcaccgcccccggcgga--caacgcagca	Protospacer
********** *******.****  *.****.*  

353. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045376 (Sulfitobacter sp. THAF37 plasmid pTHAF37_d, complete sequence) position: , mismatch: 6, identity: 0.818

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
tcgcgggcggtgtcgaccagccggtcgagggtg	Protospacer
.**  ***** ************** *****.*

354. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP026282 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

355. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

356. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

357. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

358. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

359. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP041248 (Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

360. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

361. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

362. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

363. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP026237 (Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

364. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NC_006143 (Aeromonas caviae plasmid pFBAOT6, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

365. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP026234 (Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

366. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NZ_CP026717 (Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 6, identity: 0.8

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
gtcgttgatggtgtcctgcccaccgttccg	Protospacer
************* ******** ***  . 

367. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 6, identity: 0.806

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
cggacttgacgggcatgtcgaggccgttgag	Protospacer
***  . ******************  ****

368. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to MT776811 (Arthrobacter phage King2, complete genome) position: , mismatch: 7, identity: 0.788

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
cagctgaccgtcaacgccctgctgaaggcgccg	Protospacer
 .  ****** ****** ************* *

369. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_041931 (Arthrobacter phage Jawnski, complete genome) position: , mismatch: 7, identity: 0.788

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
cagctgaccgtcaacgccctgctgaaggcgccg	Protospacer
 .  ****** ****** ************* *

370. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_042014 (Arthrobacter phage Piccoletto, complete genome) position: , mismatch: 7, identity: 0.788

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
cagctgaccgtcaacgccctgctgaaggcgccg	Protospacer
 .  ****** ****** ************* *

371. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to MF377442 (Arthrobacter phage Franzy, complete genome) position: , mismatch: 7, identity: 0.788

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
cagctgaccgtcaacgccctgctgaaggcgccg	Protospacer
 .  ****** ****** ************* *

372. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_041930 (Arthrobacter phage Brent, complete genome) position: , mismatch: 7, identity: 0.788

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
cagctgaccgtcaacgccctgctgaaggcgccg	Protospacer
 .  ****** ****** ************* *

373. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to MF324907 (Arthrobacter phage Beans, complete genome) position: , mismatch: 7, identity: 0.788

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
cagctgaccgtcaacgccctgctgaaggcgccg	Protospacer
 .  ****** ****** ************* *

374. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.788

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
tggaagaccggccactcgctgctgaaggccaag	Protospacer
 * * ******* ** *************  **

375. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
tggaagaccggccactcgctgctgaaggccaag	Protospacer
 * * ******* ** *************  **

376. spacer 2.1|66336|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 7, identity: 0.788

cgcaggacgaccgcgatctgctc--gttgctgagc	CRISPR spacer
cgcaggacgacggcgatctcctcgagttcttca--	Protospacer
*********** ******* ***  *** .* *  

377. spacer 2.7|66703|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 7, identity: 0.788

ggcacgggcgcccgtgatcagccgctggttgtc	CRISPR spacer
ggcacgggcgcccgcgagcagccgctcatcctg	Protospacer
**************.** ******** .*. * 

378. spacer 2.7|66703|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013298 (Arthrobacter sp. YC-RL1 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.788

---ggcacgggcgcccgtgatcagccgctggttgtc	CRISPR spacer
tcggtcat---cgcccgcgatcagccgctggttctc	Protospacer
   * **.   ******.*************** **

379. spacer 2.7|66703|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

ggcacgggcgcccgtgatcagccgctggttgtc--	CRISPR spacer
ggcacgggcgctcgagatcagccg--gggcatcgg	Protospacer
***********.** *********  ** ..**  

380. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.788

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ggcggccgggtcggtgaccagggcgcgggttcc	Protospacer
*************** ******** . * . **

381. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041605 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.1, complete sequence) position: , mismatch: 7, identity: 0.788

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
cccgtaggggccggtgaccagggcctcgccgcc	Protospacer
  **   ***.**** *****************

382. spacer 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 7, identity: 0.788

tgtccttcgggtcgtgatgcataggtgtggcga	CRISPR spacer
cagccatcggatcgtgatgcataggtgtggggg	Protospacer
.. ** ****.******************* *.

383. spacer 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.788

tgtccttcgggtcgtgatgcataggtgtggcga	CRISPR spacer
ccgacgttgggtcgtgatgcataggtgtgggga	Protospacer
.   * *.********************** **

384. spacer 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048398 (Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence) position: , mismatch: 7, identity: 0.788

tgtccttcgggtcgtgatgcataggtgtggcga	CRISPR spacer
cggccgttgggtcgtgatgcataggtgtgaggc	Protospacer
.* ** *.*********************. * 

385. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK967395 (Mycobacterium phage WideWale, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

386. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF919500 (Mycobacterium phage Dalmatian, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

387. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK494087 (Mycobacterium phage DBQu4n, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgaatgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

388. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MT522004 (Mycobacterium phage Gail, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgaatgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

389. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

390. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF919536 (Mycobacterium phage TipsytheTRex, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

391. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_008203 (Mycobacterium phage Che12, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

392. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MG099947 (Mycobacterium phage Ph8s, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

393. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN585989 (Mycobacterium phage Superchunk, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

394. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN585983 (Mycobacterium phage Retro23, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

395. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KX758539 (Mycobacterium phage Jaan, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

396. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KY965065 (Mycobacterium phage Heffalump, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

397. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN585968 (Mycobacterium phage Leogania, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

398. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK279857 (Mycobacterium phage IronMan, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgaatgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

399. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KU297783 (Mycobacterium phage NaSiaTalie, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

400. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KY798216 (Mycobacterium phage Journey13, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgaatgggagttcatcgagaacga-gacaggc	Protospacer
 .*** **********.*********  ** ** 

401. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_022058 (Mycobacterium phage Adzzy, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

402. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF919538 (Mycobacterium phage Updawg, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

403. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MT639645 (Mycobacterium phage PainterBoy, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggt	Protospacer
 .*** **********.*********  ** ** 

404. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH825701 (Mycobacterium phage Flare16, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

405. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK061408 (Mycobacterium phage Centaur, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

406. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF919490 (Mycobacterium phage Anselm, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

407. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH509441 (Mycobacterium phage Acolyte, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

408. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KF017927 (Mycobacterium phage Odin, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

409. spacer 3.1|67649|33|NZ_CP009803|CRT matches to EU744250 (Mycobacterium virus Pukovnik, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

410. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF472893 (Mycobacterium phage MissWhite, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgaatgggagttcatcgagaacga-gacaggc	Protospacer
 .*** **********.*********  ** ** 

411. spacer 3.1|67649|33|NZ_CP009803|CRT matches to DQ398043 (Mycobacterium virus Che12, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

412. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

413. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN703408 (Mycobacterium phage Phaded, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

414. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK814748 (Mycobacterium phage XianYue, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

415. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN096376 (Mycobacterium phage Lucyedi, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggt	Protospacer
 .*** **********.*********  ** ** 

416. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KX576639 (Mycobacterium phage DudeLittle, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

417. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_031279 (Mycobacterium phage Bactobuster, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

418. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN310541 (Mycobacterium phage Jeeves, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

419. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KT381276 (Mycobacterium phage Serenity, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

420. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_023564 (Mycobacterium phage EagleEye, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggt	Protospacer
 .*** **********.*********  ** ** 

421. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KX758538 (Mycobacterium phage Kerberos, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgaatgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

422. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN585981 (Mycobacterium phage QueenB2, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

423. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

424. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

425. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN062708 (Mycobacteriumphage NothingSpecial, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

426. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH051252 (Mycobacterium phage Fameo, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

427. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MT310858 (Mycobacterium phage Iwokeuplikedis, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

428. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_028849 (Mycobacterium phage Luchador, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

429. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

430. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN586002 (Mycobacterium phage BiancaTri92, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

431. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KX574455 (Mycobacterium phage Pomar16, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgaatgggagttcatcgagaacga-gaccggc	Protospacer
 .*** **********.*********  **.** 

432. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KJ959632 (Mycobacterium phage Equemioh13, complete genome) position: , mismatch: 7, identity: 0.788

accgactgggagttcaccgagaacgactactgg-	CRISPR spacer
ctcgagtgggagttcatcgagaacga-gacgggc	Protospacer
 .*** **********.*********  ** ** 

433. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053444 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eB, complete sequence) position: , mismatch: 7, identity: 0.788

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggtggg	Protospacer
** *************** ******..**.  *

434. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050096 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence) position: , mismatch: 7, identity: 0.788

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggtggg	Protospacer
** *************** ******..**.  *

435. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050102 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b2, complete sequence) position: , mismatch: 7, identity: 0.788

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggtggg	Protospacer
** *************** ******..**.  *

436. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050107 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence) position: , mismatch: 7, identity: 0.788

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggtggg	Protospacer
** *************** ******..**.  *

437. spacer 3.7|68015|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050112 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence) position: , mismatch: 7, identity: 0.788

tggcaggagatccggtagaccgcgcccggctcg	CRISPR spacer
tgtcaggagatccggtagtccgcgcttggtggg	Protospacer
** *************** ******..**.  *

438. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP025615 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
ttcctgaacccgctgcgctgcgagaccgttccg	Protospacer
 .******* ******** **********.. *

439. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgcgctgcgcgccgaaaccggcatg	Protospacer
*  **************** ***.**** *  *

440. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgccctgcgcgccgagaccggcatg	Protospacer
*  ******** ******* ******** *  *

441. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgcgctccgcgccgagaccggcatg	Protospacer
*  *********** **** ******** *  *

442. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgcgctccgcgccgagaccggcatg	Protospacer
*  *********** **** ******** *  *

443. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
tccctgaccgcgcggcgcggcgagagccgccgg	Protospacer
 ****** ***** *********** *  *.**

444. spacer 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

-cgcgcgtggcgggggtgccggggctggtgtgac	CRISPR spacer
ctgcg-gaggcgggggtgccggggtcggtgtggg	Protospacer
 .*** * ****************..******. 

445. spacer 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 7, identity: 0.788

cgcgcgtggcgggggtgccggggctggtgtgac-	CRISPR spacer
ccggcgtgccgggcgtgccggggctgg-gtggtg	Protospacer
*  ***** **** ************* ***.. 

446. spacer 3.16|68566|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.788

gtgtggcgcctggcggcctgcaccgaaggcgac	CRISPR spacer
gcgctgcgcctcgcggcccgcaccgaaggccgc	Protospacer
*.*. ****** ******.*********** .*

447. spacer 3.16|68566|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.788

gtgtggcgcctggcggcctgcaccgaaggcgac	CRISPR spacer
gcgctgcgcctcgcggcccgcaccgaaggccgc	Protospacer
*.*. ****** ******.*********** .*

448. spacer 3.16|68566|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.788

gtgtggcgcctggcggcctgcaccga-aggcgac	CRISPR spacer
tggtggcgcccggcggccagcaccgacaggtaa-	Protospacer
  ********.******* ******* ***..* 

449. spacer 3.19|68749|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 7, identity: 0.788

aggctgatccgcagcttgtaggggtagagcgtc	CRISPR spacer
tcgccgcgccgcagcttgtagggggtgagcgtc	Protospacer
  **.*  ****************  *******

450. spacer 3.25|69116|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

gccaggccatgagtccgatcacgg-gcccgctgc	CRISPR spacer
gccaggccttgaggccgatcacggaaaacgatg-	Protospacer
******** **** ********** .  ** ** 

451. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP021409 (Celeribacter manganoxidans strain DY25 plasmid pDY25-E, complete sequence) position: , mismatch: 7, identity: 0.788

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
atcctcggcaccaccggcgtcgcca-acaacgcg	Protospacer
*** ****** **************  *..*.* 

452. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
tcggtgggcaacaccggcgtctcca-ccggcgcg	Protospacer
 . ** *************** *** *****.* 

453. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP025615 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
ttcctgaacccgctgcgctgcgagaccgttccg	Protospacer
 .******* ******** **********.. *

454. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgcgctgcgcgccgaaaccggcatg	Protospacer
*  **************** ***.**** *  *

455. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgccctgcgcgccgagaccggcatg	Protospacer
*  ******** ******* ******** *  *

456. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgcgctccgcgccgagaccggcatg	Protospacer
*  *********** **** ******** *  *

457. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagctgaacgcgctccgcgccgagaccggcatg	Protospacer
*  *********** **** ******** *  *

458. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
tccctgaccgcgcggcgcggcgagagccgccgg	Protospacer
 ****** ***** *********** *  *.**

459. spacer 3.40|68512|33|NZ_CP009803|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

-cgcgcgtggcgggggtgccggggctggtgtgac	CRISPR spacer
ctgcg-gaggcgggggtgccggggtcggtgtggg	Protospacer
 .*** * ****************..******. 

460. spacer 3.40|68512|33|NZ_CP009803|PILER-CR matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 7, identity: 0.788

cgcgcgtggcgggggtgccggggctggtgtgac-	CRISPR spacer
ccggcgtgccgggcgtgccggggctgg-gtggtg	Protospacer
*  ***** **** ************* ***.. 

461. spacer 3.41|68573|33|NZ_CP009803|PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.788

gtgtggcgcctggcggcctgcaccgaaggcgac	CRISPR spacer
gcgctgcgcctcgcggcccgcaccgaaggccgc	Protospacer
*.*. ****** ******.*********** .*

462. spacer 3.41|68573|33|NZ_CP009803|PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.788

gtgtggcgcctggcggcctgcaccgaaggcgac	CRISPR spacer
gcgctgcgcctcgcggcccgcaccgaaggccgc	Protospacer
*.*. ****** ******.*********** .*

463. spacer 3.41|68573|33|NZ_CP009803|PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.788

gtgtggcgcctggcggcctgcaccga-aggcgac	CRISPR spacer
tggtggcgcccggcggccagcaccgacaggtaa-	Protospacer
  ********.******* ******* ***..* 

464. spacer 3.44|68756|33|NZ_CP009803|PILER-CR matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 7, identity: 0.788

aggctgatccgcagcttgtaggggtagagcgtc	CRISPR spacer
tcgccgcgccgcagcttgtagggggtgagcgtc	Protospacer
  **.*  ****************  *******

465. spacer 3.50|69123|33|NZ_CP009803|PILER-CR matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

gccaggccatgagtccgatcacgg-gcccgctgc	CRISPR spacer
gccaggccttgaggccgatcacggaaaacgatg-	Protospacer
******** **** ********** .  ** ** 

466. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP021409 (Celeribacter manganoxidans strain DY25 plasmid pDY25-E, complete sequence) position: , mismatch: 7, identity: 0.788

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
atcctcggcaccaccggcgtcgcca-acaacgcg	Protospacer
*** ****** **************  *..*.* 

467. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

atcgtcggcaacaccggcgtcgccacccggcac-	CRISPR spacer
tcggtgggcaacaccggcgtctcca-ccggcgcg	Protospacer
 . ** *************** *** *****.* 

468. spacer 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT matches to AP013476 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-U-MedDCM-OCT-S44-C63) position: , mismatch: 7, identity: 0.788

gcctggggcgacgagtggctcggcgtctggaag	CRISPR spacer
tggttgggcgacctgtggctcggcgtctggatg	Protospacer
   * *******  ***************** *

469. spacer 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

gtcagcgccggcgagttcggcggaccacacggg	CRISPR spacer
atcagcgccggcgcgttcggctgaccacggcag	Protospacer
.************ ******* ******.  .*

470. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NC_005918 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence) position: , mismatch: 7, identity: 0.759

atgctcttcgccataatccagggcggcgt	CRISPR spacer
cagctcttcgccataaggcagggcgctga	Protospacer
  **************  ******* .* 

471. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP047262 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence) position: , mismatch: 7, identity: 0.759

atgctcttcgccataatccagggcggcgt	CRISPR spacer
cagctcttcgccataaggcagggcgctga	Protospacer
  **************  ******* .* 

472. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP026560 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence) position: , mismatch: 7, identity: 0.759

atgctcttcgccataatccagggcggcgt	CRISPR spacer
cagctcttcgccataaggcagggcgctga	Protospacer
  **************  ******* .* 

473. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_LT963406 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence) position: , mismatch: 7, identity: 0.759

atgctcttcgccataatccagggcggcgt	CRISPR spacer
cagctcttcgccataaggcagggcgctga	Protospacer
  **************  ******* .* 

474. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP017294 (Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

atgctcttcgccataatccagggcggcgt	CRISPR spacer
ttactcttcgccataatcgagggggggcg	Protospacer
 *.*************** **** **   

475. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP026565 (Pseudomonas avellanae strain R2leaf plasmid p3_tig6, complete sequence) position: , mismatch: 7, identity: 0.759

atgctcttcgccataatccagggcggcgt	CRISPR spacer
cagctcttcgccataaggcagggcgctga	Protospacer
  **************  ******* .* 

476. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

gtccgccgggctgatcgcgctgaacg-ccggcgc	CRISPR spacer
aggcgccgggctgatcgcgctggacgcccagca-	Protospacer
.  *******************.*** **.**. 

477. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 7, identity: 0.788

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
gcgcgcgacgctgatcgcgctgatcgtcggcgc	Protospacer
*. *** . ************** **.******

478. spacer 5.16|74596|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to MT657339 (Gordonia phage SpeedDemon, complete genome) position: , mismatch: 7, identity: 0.788

atgcggcccaggcccacggcggaggtgaccgcg-	CRISPR spacer
ccgcggcccaggccgccggcggaggtga-ggtgt	Protospacer
 .************  ************  *.* 

479. spacer 5.16|74596|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_031074 (Gordonia phage Bantam, complete genome) position: , mismatch: 7, identity: 0.788

atgcggcccaggcccacggcggaggtgaccgcg-	CRISPR spacer
ccgcggcccaggccgccggcggaggtga-ggtgt	Protospacer
 .************  ************  *.* 

480. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgacccgggcgaccccggctgcgccgcg	Protospacer
****************.***** ** * * .* 

481. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
cccggcaaccggtccggccgctgactggccgcc	Protospacer
 .** ******************.*****   *

482. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
cccgccgaccggcccggccgctggctgctgagc	Protospacer
 .****.*****.************** .* **

483. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

484. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

485. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

486. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

487. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

488. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

489. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgc-caaccggtccggccgctggctggcgcgc	CRISPR spacer
-ccgcgcaaccggctcggccgctggctggccggg	Protospacer
 .*** *******..***************  * 

490. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

491. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

492. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

493. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
ctcagcacgcggtccggccactggctggcgagc	Protospacer
 **. **  **********.********** **

494. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgc-caaccggtccggccgctggctggcgcgc	CRISPR spacer
-ccgcgcaaccggctcggccgctggctggccggg	Protospacer
 .*** *******..***************  * 

495. spacer 6.1|79877|28|NZ_CP009803|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgacgtcctcgggcacggcgaggta	Protospacer
***** ****************.  .  

496. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026282 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

497. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

498. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

499. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

500. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026237 (Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

501. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_006143 (Aeromonas caviae plasmid pFBAOT6, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

502. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

503. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

504. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

505. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP041248 (Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

506. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

507. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026234 (Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

508. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP026717 (Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 7, identity: 0.781

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
cgtcgttgatggtgtcctgcccaccgttccgg	Protospacer
.************* ******** ***  . *

509. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 7, identity: 0.788

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
ttggcgcggccgagcatgtcgaggccaacgttc	Protospacer
*.******* **.************* *.*  *

510. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 7, identity: 0.788

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
tcggacttgacgggcatgtcgaggccgttgagt	Protospacer
****  . ******************  ****.

511. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.788

tcggcgcggacgggcatgtcgaggc--ccatgagc	CRISPR spacer
ccggcgcggacgggcaggtcgcggcggcgctga--	Protospacer
.*************** **** ***  *  ***  

512. spacer 6.9|80358|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 7, identity: 0.788

ctgtcgacggtcagccaggacagccccagctcc	CRISPR spacer
ccggtgacggtcaggcaggacagctccagccgc	Protospacer
*.* .********* *********.*****. *

513. spacer 6.13|80602|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788

---gcctcgtggcagtcgaggaacaggccgtcgcgg	CRISPR spacer
caggcttc---gccgtcgaggaacaggacgtcgcgc	Protospacer
   **.**   ** ************* ******* 

514. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.788

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
tcgccgcgcagctcggccagccggttgcgctgc	Protospacer
 .************** ******* ** *  **

515. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788

ctcaccgccgcgctcaccggcggcgcgctgaag----	CRISPR spacer
cgcaccgccgcgcgcaccgccggcgcg----agcgcc	Protospacer
* *********** ***** *******    **    

516. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 7, identity: 0.788

ctcaccgccgcgctcaccggcggcgcgctgaag----	CRISPR spacer
ttccccgccgcgctcaccgacggcgcg----agcccc	Protospacer
.** ***************.*******    **    

517. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 7, identity: 0.788

ctcaccgccgcgctcaccggcggcgcgctgaag----	CRISPR spacer
ttccccgccgcgctcaccgacggcgcg----agcccc	Protospacer
.** ***************.*******    **    

518. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.788

ctcaccgccgcgctcaccggcggcgcgctgaag----	CRISPR spacer
ttccccgccgcgctcaccgacggcgcg----agcccc	Protospacer
.** ***************.*******    **    

519. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012258 (Cronobacter universalis NCTC 9529 plasmid pCUNV1, complete sequence) position: , mismatch: 7, identity: 0.788

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
cgcgacgtcacgctcaccggcggcgcgctcacg	Protospacer
* *. **.*.******************* * *

520. spacer 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gccctcgactacctcgccgacgactgcggggtg	CRISPR spacer
gcccgcgactacctcgccgacgacgacttcgtc	Protospacer
**** ******************* .*   ** 

521. spacer 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MH509447 (Microbacterium phage Eden, complete genome) position: , mismatch: 7, identity: 0.788

tcgcgggcggtgaggtcgaccatggaggccagc	CRISPR spacer
gggtgctcggtgaggtcgaccttggcggccagc	Protospacer
  *.*  ************** *** *******

522. spacer 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.788

gccgccgtgccggtcatggtcaccaccgtcgcg-	CRISPR spacer
gccgccgtgccggtcaggatcaccg-catagagc	Protospacer
**************** *.*****. *.* * * 

523. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.788

-ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
tccgcc-ttggtcgagctggccttcgtcggcgac	Protospacer
 ****.  ******* ***** **********  

524. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.788

-ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
tccgcc-ctggtcgagctggccttcgtcggcgac	Protospacer
 ****.  ******* ***** **********  

525. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

526. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

527. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

528. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

529. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

530. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

531. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

532. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

533. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

534. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

535. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

536. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

537. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

538. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

539. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

540. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

541. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

542. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

543. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

544. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

545. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

546. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

547. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

548. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

549. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

550. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

551. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

552. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

553. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

554. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

555. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

556. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

557. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

558. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

559. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

560. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

561. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

562. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

563. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

564. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

565. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

566. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

567. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

568. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

569. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

570. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

571. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

572. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

573. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

574. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

575. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

576. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

577. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

578. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

579. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

580. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

581. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

582. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

583. spacer 6.32|81761|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ctgagctc-tcgcccgaacgccaaggccggctgc	CRISPR spacer
-tggccacggcgcccgaccgccatggccggctgc	Protospacer
 **. * *  ******* ***** **********

584. spacer 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.788

ccgtagggcgcccagcgcatgccgtccgggttc	CRISPR spacer
ccggtaggcggccagcacatgccgtccgggaac	Protospacer
***  .**** *****.*************  *

585. spacer 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.788

ccgtagggcgcccagcgcatgccgtccgggttc	CRISPR spacer
ccggtaggcggccagcacatgccgtccgggaac	Protospacer
***  .**** *****.*************  *

586. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 7, identity: 0.788

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
gccgcgggcgcccgggtgatcgaggccggccgc	Protospacer
 ** . **** ****** *************.*

587. spacer 6.42|82371|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR594692 (Variovorax sp. WDL1 plasmid 4) position: , mismatch: 7, identity: 0.788

ttcggctacgtccgcatcgacacgctgcggctg	CRISPR spacer
cgcctctacgtccgcaaggacacgctgcggcag	Protospacer
. *  ***********  ************* *

588. spacer 6.42|82371|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP048419 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

ttcggctacgtccgcatcgacacgctgcggctg	CRISPR spacer
ttcggctacgtccgcatctgcacgcgcgagcag	Protospacer
****************** .*****   .** *

589. spacer 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP035509 (Haematobacter massiliensis strain OT1 plasmid pOT1-9, complete sequence) position: , mismatch: 7, identity: 0.788

tccagcgcacggcccccgacggacccgacgcgg	CRISPR spacer
gcgaggacacggcccccgccggagccgacgcgc	Protospacer
 * ** .*********** **** ******** 

590. spacer 6.43|82432|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP035509 (Haematobacter massiliensis strain OT1 plasmid pOT1-9, complete sequence) position: , mismatch: 7, identity: 0.788

tccagcgcacggcccccgacggacccgacgcgg	CRISPR spacer
gcgaggacacggcccccgccggagccgacgcgc	Protospacer
 * ** .*********** **** ******** 

591. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP003958 (Rhodococcus opacus PD630 plasmid 9, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
tcataggcggcgtcgaccagccggtagaggccc	Protospacer
.*.  ***** ******************* * 

592. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP003952 (Rhodococcus opacus PD630 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
tcataggcggcgtcgaccagccggtagaggccc	Protospacer
.*.  ***** ******************* * 

593. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
acgccccacgactcgaccagccggtagagggcg	Protospacer
 ** *    ** *********************

594. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

----ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
atgccccacgac----tcgaccagccggtagagggcg	Protospacer
    ** .**.*    *********************

595. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.788

----ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
atcccccacgac----tcgaccagccggtagagggcg	Protospacer
    ** .**.*    *********************

596. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
ccggcggcggggtcgagcagccggtggggcttg	Protospacer
**********.***** ********.*.*  .*

597. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
ccgacggcggtgtcgaccagccggccgtcggtg	Protospacer
***.****** *************. *  **.*

598. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
ccgacggcggtgtcgaccagccggccgccgggg	Protospacer
***.****** *************. *  ** *

599. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 7, identity: 0.774

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
tggcgcggccgagcatgtcgaggccaacgtt	Protospacer
.******* **.************* *.*  

600. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 7, identity: 0.774

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
tggcgcggacgggcatggcggggccttcggg	Protospacer
.**************** **.****. .*.*

601. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 7, identity: 0.774

cggcgcggacgggcatgtcgaggcccatgag-	CRISPR spacer
gggcgcggacggccatctcgagg-ccgcgatc	Protospacer
 *********** *** ****** **..**  

602. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 7, identity: 0.774

cggcgcggacgggcatgtcgaggcccatgag-	CRISPR spacer
gggcgcggacggccatctcgagg-ccgcgatc	Protospacer
 *********** *** ****** **..**  

603. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 7, identity: 0.774

cggcgcggacgggcatgtcgaggcccatgag-	CRISPR spacer
gggcgcggacggccatctcgagg-ccgcgatc	Protospacer
 *********** *** ****** **..**  

604. spacer 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.758

tctcctcctacaccgcgctggagaccaaggcac	CRISPR spacer
cctatgccttcaccgcgctggagaccacggccg	Protospacer
.** . *** ***************** ***  

605. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.758

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
ggcatgaccggcaacgcggcgctggatgtacca	Protospacer
****************** .****.* *..* .

606. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
ggcatgaccggcaacgcggcgctggatgtacca	Protospacer
****************** .****.* *..* .

607. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.758

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
ggcatgaccggcaacgcggcgctggatgtacca	Protospacer
****************** .****.* *..* .

608. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ctcggccgtgtcggtcaccatggcctcgggcgc	Protospacer
  ****** *********** *******    *

609. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to MN284895 (Mycobacterium phage Marshawn, complete genome) position: , mismatch: 8, identity: 0.758

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
catgtaggcgtcggtcgccagggcctcgccgcc	Protospacer
 ..*   * *******.****************

610. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 8, identity: 0.758

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ggcggccaggtcggtcagcagggcgcggatggc	Protospacer
*******.********* ****** . * .* *

611. spacer 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 8, identity: 0.758

tgtccttcgggtcgtgatgcataggtgtggcga	CRISPR spacer
cggcctgctggtcgtgatgcataggtgtgagcg	Protospacer
.* *** * ********************.  .

612. spacer 2.9|66825|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 8, identity: 0.758

tgtccttcgggtcgtgatgcataggtgtggcga	CRISPR spacer
cggcctgctggtcgtgatgcataggtgtgagcg	Protospacer
.* *** * ********************.  .

613. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
tcggcgctcggcgcgttgctggacagcgcgggt	Protospacer
..* . ****************.*.*******.

614. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
tcgctccccggcgcgctgctgggcggcctgttc	Protospacer
..*****.*******.*********** .*  *

615. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.758

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
tcgctccccggcgcgctgctgggcggcctgttc	Protospacer
..*****.*******.*********** .*  *

616. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 8, identity: 0.758

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
gtcttcctcggcgcgctgctgcgcggcgatgac	Protospacer
 * .***********.***** ******  *.*

617. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 8, identity: 0.758

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
gtcttcctcggcgcgctgctgcgcggcgatgac	Protospacer
 * .***********.***** ******  *.*

618. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 8, identity: 0.758

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
gtcttcctcggcgcgctgctgcgcggcgatgac	Protospacer
 * .***********.***** ******  *.*

619. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 8, identity: 0.758

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ctggcgctcggcgcattgctgcgcggcgcgctt	Protospacer
*** . ********.****** ********  .

620. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
tatgtctgggagttctccgagaacgacgacttc	Protospacer
  .* ********** *********** ***  

621. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH338234 (Mycobacterium phage Crucio, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

622. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH697591 (Mycobacterium phage QueenBeesly, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

623. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MT498060 (Mycobacterium Phage FiringLine, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

624. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KM463009 (Mycobacterium phage Power, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

625. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

626. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MT498066 (Mycobacterium phage Georgie2, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

627. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MT498041 (Mycobacterium phage KingCyrus, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

628. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK919472 (Mycobacterium phage Benvolio, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

629. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KF981601 (Mycobacterium phage Echild, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

630. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

631. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

632. spacer 3.1|67649|33|NZ_CP009803|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

633. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

634. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KU985095 (Mycobacterium phage ChipMunk, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

635. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN234203 (Mycobacterium phage SemperFi, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

636. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF919531 (Mycobacterium phage SnapTap, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

637. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF472896 (Mycobacterium phage JoshKayV, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

638. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_029043 (Mycobacterium phage SweetiePie, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

639. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

640. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KU985093 (Mycobacterium phage EvilGenius, complete genome) position: , mismatch: 8, identity: 0.758

accgactgggagttcaccgagaacgactactgg--	CRISPR spacer
ctcgagtgggagttcatcgagaacga--ggtgggc	Protospacer
 .*** **********.*********  . ***  

641. spacer 3.11|68261|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagttgaacgctctgcgcgccgagaccggcatg	Protospacer
*  .******* ******* ******** *  *

642. spacer 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 8, identity: 0.758

cgcgcgtggcgggggtgccggggctggtgtgac	CRISPR spacer
agcgcgtggcgcgggtgccggtgctggacccgc	Protospacer
 ********** ********* *****  . .*

643. spacer 3.18|68688|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP013125 (Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence) position: , mismatch: 8, identity: 0.758

atgaggatgggctgccagtagcggtagtcccac	CRISPR spacer
cggaggaggtgctgccagtagcggtagatcacc	Protospacer
  ***** * ***************** .*  *

644. spacer 3.27|69238|33|NZ_CP009803|CRT,CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 8, identity: 0.758

gccgtccgagacaacctcgaagccggtgtctgc	CRISPR spacer
atcgaaggaggcatcctcgaagccggtgtctcc	Protospacer
..**   ***.** ***************** *

645. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

atcgtcggcaacaccggcgtcg------ccacccggcac	CRISPR spacer
gtcgtcggccacaccggcgtcggcaagtccacc------	Protospacer
.******** ************      *****      

646. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP043850 (Micrococcus luteus strain NCCP 15687 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
ggagtcggagacaccggcgtcgccaccggctac	Protospacer
.  ***** .***************** * .**

647. spacer 3.31|69482|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagaccgagggcatggacctgtccaagatg	CRISPR spacer
gccgagagcgagggcctggacctgtccagccac	Protospacer
* ***** ******* ************.    

648. spacer 3.31|69482|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP031753 (Rhodobacter sphaeroides strain EBL0706 plasmid p.B, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagaccgagggcatggacctgtccaagatg	CRISPR spacer
ggcgagaccgagggcctgggcctgctggacatc	Protospacer
*************** ***.****.. .* ** 

649. spacer 3.32|69543|33|NZ_CP009803|CRT,CRISPRCasFinder matches to MH015258 (Ruegeria phage vB_RpoS-V16, complete genome) position: , mismatch: 8, identity: 0.758

cgggcgtagacgtcgcggaaccggcggcggcgc	CRISPR spacer
ccttcgcggacggcgcggaacgggcggcggcga	Protospacer
*   **..**** ******** ********** 

650. spacer 3.36|68268|33|NZ_CP009803|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

gccctgaacgcgctgcgcggcgagaccgtctgg	CRISPR spacer
gagttgaacgctctgcgcgccgagaccggcatg	Protospacer
*  .******* ******* ******** *  *

651. spacer 3.40|68512|33|NZ_CP009803|PILER-CR matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 8, identity: 0.758

cgcgcgtggcgggggtgccggggctggtgtgac	CRISPR spacer
agcgcgtggcgcgggtgccggtgctggacccgc	Protospacer
 ********** ********* *****  . .*

652. spacer 3.43|68695|33|NZ_CP009803|PILER-CR matches to NZ_CP013125 (Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence) position: , mismatch: 8, identity: 0.758

atgaggatgggctgccagtagcggtagtcccac	CRISPR spacer
cggaggaggtgctgccagtagcggtagatcacc	Protospacer
  ***** * ***************** .*  *

653. spacer 3.52|69245|33|NZ_CP009803|PILER-CR matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 8, identity: 0.758

gccgtccgagacaacctcgaagccggtgtctgc	CRISPR spacer
atcgaaggaggcatcctcgaagccggtgtctcc	Protospacer
..**   ***.** ***************** *

654. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

atcgtcggcaacaccggcgtcg------ccacccggcac	CRISPR spacer
gtcgtcggccacaccggcgtcggcaagtccacc------	Protospacer
.******** ************      *****      

655. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP043850 (Micrococcus luteus strain NCCP 15687 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
ggagtcggagacaccggcgtcgccaccggctac	Protospacer
.  ***** .***************** * .**

656. spacer 3.56|69489|33|NZ_CP009803|PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagaccgagggcatggacctgtccaagatg	CRISPR spacer
gccgagagcgagggcctggacctgtccagccac	Protospacer
* ***** ******* ************.    

657. spacer 3.56|69489|33|NZ_CP009803|PILER-CR matches to NZ_CP031753 (Rhodobacter sphaeroides strain EBL0706 plasmid p.B, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagaccgagggcatggacctgtccaagatg	CRISPR spacer
ggcgagaccgagggcctgggcctgctggacatc	Protospacer
*************** ***.****.. .* ** 

658. spacer 3.57|69550|33|NZ_CP009803|PILER-CR matches to MH015258 (Ruegeria phage vB_RpoS-V16, complete genome) position: , mismatch: 8, identity: 0.758

cgggcgtagacgtcgcggaaccggcggcggcgc	CRISPR spacer
ccttcgcggacggcgcggaacgggcggcggcga	Protospacer
*   **..**** ******** ********** 

659. spacer 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP032314 (Pannonibacter phragmitetus BB plasmid p.BB_2, complete sequence) position: , mismatch: 8, identity: 0.758

gactcctggaccggccgccggaacaccagcctc	CRISPR spacer
gcctcctcgcccggccgccggaacaccgcattg	Protospacer
* ***** * *****************.  .* 

660. spacer 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.758

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
tcgaccatccacggcgacggcacgacgacggcg	Protospacer
  * **. **.******** ************.

661. spacer 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.758

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
tcgaccatccacggcgacggcacgacgacggcg	Protospacer
  * **. **.******** ************.

662. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

atgctcttcgccataatccagggcggcgt	CRISPR spacer
tcctgcttcgccatgatgcagggcggcga	Protospacer
 . . *********.** ********** 

663. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.724

atgctcttcgccataatccagggcggcgt	CRISPR spacer
tcctgcttcgccatgatgcagggcggcga	Protospacer
 . . *********.** ********** 

664. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 8, identity: 0.724

atgctcttcgccataatccagggcggcgt	CRISPR spacer
tcctgcttcgccatgatgcagggcggcga	Protospacer
 . . *********.** ********** 

665. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.724

atgctcttcgccataatccagggcggcgt	CRISPR spacer
tcctgcttcgccatgatgcagggcggcga	Protospacer
 . . *********.** ********** 

666. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 8, identity: 0.724

atgctcttcgccataatccagggcggcgt	CRISPR spacer
tcctgcttcgccatgatgcagggcggcga	Protospacer
 . . *********.** ********** 

667. spacer 5.7|74051|29|NZ_CP009803|CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.724

atgctcttcgccataatccagggcggcgt	CRISPR spacer
tcctgcttcgccatgatgcagggcggcga	Protospacer
 . . *********.** ********** 

668. spacer 5.13|74413|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758

ctcggtggcatgggccccagccgccgagcacag-	CRISPR spacer
accggtggcatgggccgcagccgacg-tcactcc	Protospacer
 .************** ****** **  ***   

669. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.758

gtccgccgggctgatcgcgctgaacg-ccggcgc	CRISPR spacer
cggtgccgggctgatcgcgctggacgcccagca-	Protospacer
   .******************.*** **.**. 

670. spacer 5.15|74535|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 8, identity: 0.758

atgacgtcctgccaggtgcggccgccggagccg	CRISPR spacer
ttgacgtcctgccaggcgtggccgccgtggaat	Protospacer
 ***************.*.******** .*   

671. spacer 5.15|74535|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

atgacgtcctgccaggtgcggccgccggagccg	CRISPR spacer
gggacggcctgccaggtgctgccgccgtcggtg	Protospacer
. **** ************ *******  * .*

672. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

673. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

674. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

675. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

676. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

677. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

678. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

679. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

680. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

681. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

682. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

683. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

684. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

685. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

686. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

687. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

688. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

689. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

690. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

691. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

692. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

693. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

694. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

695. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

696. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

697. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

698. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

699. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

700. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

701. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

702. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

703. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

704. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

705. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

706. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

707. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

708. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

709. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

710. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

711. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

712. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

713. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

714. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

715. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

716. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

717. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

718. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

719. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

720. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

721. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

722. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

723. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

724. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

725. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

726. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

727. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

728. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

729. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

730. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

731. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

732. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

733. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

734. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

735. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgacgagccgggcggcctcgccgaggtgacg	Protospacer
******** **********.****    .*** 

736. spacer 5.24|75094|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.758

gtcgccaaccggtccggccgctggctggcgcgc	CRISPR spacer
cccgccgaccggcccggccgctggctgctcagc	Protospacer
 .****.*****.************** .  **

737. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.758

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
ggcccgaactcggcaccgccgaggatgtcgcgc	Protospacer
 *. *  ** **************.******* 

738. spacer 6.1|79877|28|NZ_CP009803|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.714

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
gaagttcgtcctcgggcacggcatcctg	Protospacer
 .   ********************   

739. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 8, identity: 0.75

-ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcgcacc-agcgcggcgtcgcgcgcggacag	Protospacer
   *.*.*. *********** *** *******

740. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

-ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcgcacc-agcgcggcgtcgcgcgcggacag	Protospacer
   *.*.*. *********** *** *******

741. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

-ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcgcacc-agcgcggcgtcgcgcgcggacag	Protospacer
   *.*.*. *********** *** *******

742. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 8, identity: 0.75

-ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcgcacc-agcgcggcgtcgcgcgcggacag	Protospacer
   *.*.*. *********** *** *******

743. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.758

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
ctggcgcggacgggcatggcggggccttcgggc	Protospacer
..**************** **.****. .*.**

744. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 8, identity: 0.758

tcggcgcggacgggcatgtcgaggcccatgagc-	CRISPR spacer
agggcgcggacggccatctcgagg-ccgcgatcc	Protospacer
  *********** *** ****** **..** * 

745. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 8, identity: 0.758

tcggcgcggacgggcatgtcgaggcccatgagc-	CRISPR spacer
agggcgcggacggccatctcgagg-ccgcgatcc	Protospacer
  *********** *** ****** **..** * 

746. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 8, identity: 0.758

tcggcgcggacgggcatgtcgaggcccatgagc-	CRISPR spacer
agggcgcggacggccatctcgagg-ccgcgatcc	Protospacer
  *********** *** ****** **..** * 

747. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.758

cacgatccggccggggcgatctgcgcgacgtgg	CRISPR spacer
atctggccggccggatcgatctgcgcgacgtgc	Protospacer
  * . ********. **************** 

748. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_LT559121 (Nonomuraea gerenzanensis isolate nono1 plasmid II, complete sequence) position: , mismatch: 8, identity: 0.758

cacgatccggccggggcgatctgcgcgacgtgg	CRISPR spacer
ctggcggcggccggggcgatccgcgcggcgtgc	Protospacer
*  *   **************.*****.**** 

749. spacer 6.10|80419|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 8, identity: 0.758

---gacacgatgcacgaatcgactgaggccgtacag	CRISPR spacer
atggac---gggcacgaagcgactgaggccgaacat	Protospacer
   ***   . ******* ************ *** 

750. spacer 6.12|80541|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 8, identity: 0.758

gcgaccggcggggacagccgtcagcgggcggac	CRISPR spacer
gctcatgtcggagacagccgtcagcgcgcggat	Protospacer
**   .* ***.************** *****.

751. spacer 6.13|80602|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to KT001914 (Caulobacter phage Seuss, complete genome) position: , mismatch: 8, identity: 0.758

gcctcgtggcagtcgaggaacaggccgtcgcgg	CRISPR spacer
tcggtgttccattcaaggaacaggccgtcgcgg	Protospacer
 *  .**  ** **.******************

752. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
acctccaggagctccggcagccgggtgaagagc	Protospacer
*. .*  * ***** *************.****

753. spacer 6.14|80663|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to KU204984 (Pseudomonas phage AAT-1, complete genome) position: , mismatch: 8, identity: 0.758

atgccgcgcagctcgggcagccgggtgaggagc	CRISPR spacer
ctgccgcgcagctccggcagcctggcaagcatg	Protospacer
 ************* ******* **..** *  

754. spacer 6.15|80724|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 8, identity: 0.758

ccggtccgtgcaggtcggcgtgctcggcaagcc	CRISPR spacer
cctttccgtgcaggtcggccagctcggcctcca	Protospacer
**  ***************  *******   * 

755. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
tccaccgccgcgcgcaccggcggcgcgtcttcg	Protospacer
..*********** *************..   *

756. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
gccgcggccgcggtcaccggcggcgcggtgacc	Protospacer
 .*.* ****** ************** ***  

757. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ctcaccgacgcgcccaccggcggccaactgctc	Protospacer
******* *****.**********  .***   

758. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ctcaccgacgcgcccaccggcggccaactgctc	Protospacer
******* *****.**********  .***   

759. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ctcaccgccgctctccccggcggcaccccgccc	Protospacer
*********** *** ********.* *.*   

760. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcg----cgctgaag	CRISPR spacer
atcgccgccgcgctcaccgacggcgccgccgcc----	Protospacer
 **.***************.*****    ***.    

761. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP054921 (Streptomyces sp. NA03103 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
agccccggcgcgcacaccggcggcgcgcagtgg	Protospacer
  * *** ***** ************** * .*

762. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047174 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ctcaccgacgcgctctccggcggccgcgtgcac	Protospacer
******* ******* ********    ** * 

763. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MK977696 (Gordonia phage SCentae, complete genome) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
atcaccggcgcgcccaccggcggcgacttcacg	Protospacer
 ****** *****.***********  .* * *

764. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
atcaccggcgcgcccaccggcggcgacttcacg	Protospacer
 ****** *****.***********  .* * *

765. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag-	CRISPR spacer
accaccggcgcgctcatcggcggcgc-cggtggc	Protospacer
 .***** ********.********* * * .* 

766. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag-	CRISPR spacer
accaccggcgcgctcatcggcggcgc-cggtggc	Protospacer
 .***** ********.********* * * .* 

767. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
gccatggccgcgctgcccggcggcgcgctggcg	Protospacer
 .**. ********  **************. *

768. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 8, identity: 0.758

ctcaccgccgcgctcaccggcggcgcgctgaag-	CRISPR spacer
accaccggcgcgctcatcggcggcgc-cggtggc	Protospacer
 .***** ********.********* * * .* 

769. spacer 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 8, identity: 0.758

gccctcgactacctcgccgacgactgcggggtg	CRISPR spacer
gccctggactacttcgccgacgacgagttgatg	Protospacer
***** ******.*********** .   *.**

770. spacer 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020883 (Xanthomonas citri pv. citri strain TX160042 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

tcgcgggcggtgaggtcgaccatggaggccagc	CRISPR spacer
actccggcggtgaggtcgagcatggcggcacga	Protospacer
 * * ************** ***** ***  * 

771. spacer 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020886 (Xanthomonas citri pv. citri strain TX160149 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

tcgcgggcggtgaggtcgaccatggaggccagc	CRISPR spacer
actccggcggtgaggtcgagcatggcggcacga	Protospacer
 * * ************** ***** ***  * 

772. spacer 6.24|81273|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020890 (Xanthomonas citri pv. citri strain TX160197 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

tcgcgggcggtgaggtcgaccatggaggccagc	CRISPR spacer
actccggcggtgaggtcgagcatggcggcacga	Protospacer
 * * ************** ***** ***  * 

773. spacer 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_010333 (Caulobacter sp. K31 plasmid pCAUL02, complete sequence) position: , mismatch: 8, identity: 0.758

gccgccgtgccggtcatggtcaccaccgtcgcg	CRISPR spacer
caggacgtgccggtcgtggtcaccgccgtcggc	Protospacer
   * **********.********.******  

774. spacer 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgccgtgccggtcatggtcaccaccgtcgcg	CRISPR spacer
caggccgtgccggtcgtcgtcaccaccctggag	Protospacer
   ************.* ********* * * *

775. spacer 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 8, identity: 0.758

gccgccgtgccggtcatggtcaccaccgtcgcg	CRISPR spacer
caggccgtgccggtcgtcgtcaccaccctggag	Protospacer
   ************.* ********* * * *

776. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 8, identity: 0.758

ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
tggctggtggtcgacctggctttcgccgagcgg	Protospacer
. ****************** ****.**.   *

777. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.758

ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
attcggtttgtcgcgctggcgttcgtcggcgcg	Protospacer
 . * * * ****  ******************

778. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.758

ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
attcggtttgtcgcgctggcgttcgtcggcgcg	Protospacer
 . * * * ****  ******************

779. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.758

ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
tcgctggtggtcgatctggggttcgacccttcg	Protospacer
.*************.**** ***** *  . **

780. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041158 (Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

cgggggatttcggccggctgggggtcggtgggg----	CRISPR spacer
cgggggatttcggcgggctgg----cggcgctgccat	Protospacer
************** ******    ***.*  *    

781. spacer 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.758

ccgtagggcgcccagcgcatgccgtccgggttc	CRISPR spacer
ccgtagggcgcccagcgcagggcgaaggtaatc	Protospacer
******************* * **   * . **

782. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 8, identity: 0.758

ttcgttgaggttctcggtggcgccggtccggga	CRISPR spacer
ctcgttgaggttctcggtggctccagtgccctg	Protospacer
.******************** **.** *   .

783. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 8, identity: 0.758

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
gcggccggccgccgggtcagcgaggccggcggc	Protospacer
 *  .**** ********* ********** .*

784. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to KX241618 (Xanthomonas phage Xoo-sp2, complete genome) position: , mismatch: 8, identity: 0.758

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
ctgctcggcggctgggtcatcgatgccgacggc	Protospacer
.. *********.********** ****.* .*

785. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
aggctggagccgacggcgccggcggtggcggcg	Protospacer
.****** ******** *********  * .* 

786. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

787. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

788. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

789. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
ccgctggcgccgacgaggccggcggtgccggcc	Protospacer
  *****.*******.********** .* .**

790. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

791. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

792. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

793. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029050 (Miniimonas sp. S16 plasmid pS16-1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gcgctgctggcgacggggccggcggttgctgtc	Protospacer
* **** ** ****************. *...*

794. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

795. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

796. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

797. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

798. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

799. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

800. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gggcgggtgccgacggtgccggcgatggcggcg	Protospacer
**** *********** *******.*  * .* 

801. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

802. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

803. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

804. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

805. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

806. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

807. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

808. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

809. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

810. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

811. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

812. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

813. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

814. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

815. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

816. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

817. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

818. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

819. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

820. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

821. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

822. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

823. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

824. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

825. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

826. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

827. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

828. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

829. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

830. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

831. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

832. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

833. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

834. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

835. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

836. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

837. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

838. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

839. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

840. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

841. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

842. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

843. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

844. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

845. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

846. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

847. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

848. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

849. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

850. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

851. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

852. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

853. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

854. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

855. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

856. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

857. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

858. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

859. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

860. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

861. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

862. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

863. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

864. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

865. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
gtgctggtgcagacggtgccggcggtggcggcg	Protospacer
* ******** ***** *********  * .* 

866. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

----ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
acaccccacgac----tcgaccagccggtacagggcg	Protospacer
    ** .**.*    ************** ******

867. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
acgccccacgactcgaccagccggtacagggcg	Protospacer
 ** *    ** ************** ******

868. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
acgccccacgactcgaccagccggtacagggcg	Protospacer
 ** *    ** ************** ******

869. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

----ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
atgccccacgac----tcgaccagccggtacagggcg	Protospacer
    ** .**.*    ************** ******

870. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
acgccccacgactcgaccagccggtagagcgcg	Protospacer
 ** *    ** ***************** ***

871. spacer 6.46|80177|30|NZ_CP009803|PILER-CR matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 8, identity: 0.733

gtcgttgatggtggcctgcccagcgtggtc	CRISPR spacer
caagacgatggaggcctgcccagcgcggta	Protospacer
   * .***** *************.*** 

872. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.742

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
gcgcgccgacgggcacgtcgaggcccgcggt	Protospacer
  **** ********.**********..*. 

873. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.742

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
cggcgcggacgggcaggtcgcggcggcgctg	Protospacer
*************** **** ***      *

874. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.742

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
gcgcgccgacgggcacgtcgaggcccgcggt	Protospacer
  **** ********.**********..*. 

875. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.742

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
tggtcatcgcgggcatgtcgaggcccttgag	Protospacer
.**.    .***************** ****

876. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.742

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
tcgaggcgacgggcacgtcgaggcccaggat	Protospacer
. * *  ********.*********** ** 

877. spacer 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.727

tctcctcctacaccgcgctggagaccaaggcac	CRISPR spacer
ccgaggtctacaccgcgctggagagcaaggcgg	Protospacer
.*    .***************** ******. 

878. spacer 1.3|65523|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

tctcctcctacaccgcgctggagaccaaggcac	CRISPR spacer
ccgaggtctataccgctctggagaccaaggcgc	Protospacer
.*    .***.***** **************.*

879. spacer 1.4|65584|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.727

ggcatgaccggcaacgcgctgctgaaggcgcag	CRISPR spacer
ggcacgaccggcaacacgctgctggtttcgggc	Protospacer
****.**********.********.   ** . 

880. spacer 2.6|66641|34|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

tcatcgagggaatcgacaaggcgcagccggagct	CRISPR spacer
ccctcgaggaaatcgacaaggcgccgcgcaagga	Protospacer
.* ******.************** **  .**  

881. spacer 2.8|66764|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032230 (Streptomyces seoulensis strain KCTC 9819 plasmid unnamed) position: , mismatch: 9, identity: 0.727

ggcggccgggtcggtcaccagggcctcgccgcc	CRISPR spacer
ggcggccgggttcgtcaccagggcggccagctc	Protospacer
***********. ***********  *    .*

882. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 9, identity: 0.727

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
gcaggcctcggcgcgctgccgggcggcgcggcg	Protospacer
 ..  **********.***.***********  

883. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

----ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ggcgcgg----tcggcgcgtttctcggcggcgcggcg	Protospacer
    * *    ********** ** **********  

884. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.727

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
agcctgcccggcgcgttgctgggcggcgtgctg	Protospacer
   ** *.********************.*   

885. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.727

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ggcttcctcggcgtgtggctgggcggcgtgctc	Protospacer
   .*********.** ***********.*  *

886. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
atggaagaaggcgcgttgctgggccgctcgggc	Protospacer
 **      *************** ** *****

887. spacer 2.12|67008|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

cggctctccgcctgcctgcggccctcctcggcc	CRISPR spacer
agcgccgccgcctgcttgcggccctcgtcggtg	Protospacer
 *  .* ********.********** ****. 

888. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ggcggctgggagttcaccgaggacgacctgcgc	Protospacer
. **.****************.*****.  .* 

889. spacer 3.1|67649|33|NZ_CP009803|CRT matches to AP018479 (Mycobacterium phage GS4E DNA, complete sequence) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgaatgggagttcatcgagaacgacgtaggc	Protospacer
 .*** **********.**********    * 

890. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgaatgggagttcatcgagaacgacgtaggc	Protospacer
 .*** **********.**********    * 

891. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MN369748 (Mycobacterium phage Miko, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

892. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

893. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF185727 (Mycobacterium phage BobSwaget, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

894. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MK801735 (Mycobacterium Phage Rachaly, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

895. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_023597 (Mycobacterium phage 20ES, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgaatgggagttcatcgagaacgacgtaggc	Protospacer
 .*** **********.**********    * 

896. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

897. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF140403 (Mycobacterium phage Changeling, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtaggc	Protospacer
 .*** **********.**********    * 

898. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KU761558 (Mycobacterium phage Loser, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

899. spacer 3.1|67649|33|NZ_CP009803|CRT matches to GU339467 (Mycobacterium phage RedRock, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

900. spacer 3.1|67649|33|NZ_CP009803|CRT matches to JN408461 (Mycobacterium phage Trixie, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

901. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KT588442 (Mycobacterium phage LadyBird, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgaatgggagttcatcgagaacgacgtaggc	Protospacer
 .*** **********.**********    * 

902. spacer 3.1|67649|33|NZ_CP009803|CRT matches to NC_023607 (Mycobacterium phage 40AC, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgaatgggagttcatcgagaacgacgtaggc	Protospacer
 .*** **********.**********    * 

903. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MF324899 (Mycobacterium phage Lokk, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

904. spacer 3.1|67649|33|NZ_CP009803|CRT matches to JX899358 (Mycobacterium phage First, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgaatgggagttcatcgagaacgacgtaggc	Protospacer
 .*** **********.**********    * 

905. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KU761559 (Mycobacterium phage ArcherNM, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgacgtgggc	Protospacer
 .*** **********.**********    * 

906. spacer 3.1|67649|33|NZ_CP009803|CRT matches to KX641263 (Mycobacterium phage Kalpine, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgagtgggagttcatcgagaacgaggtcggc	Protospacer
 .*** **********.*********   * * 

907. spacer 3.1|67649|33|NZ_CP009803|CRT matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 9, identity: 0.727

accgactgggagttcaccgagaacgactactgg	CRISPR spacer
ctcgaatgggagttcatcgagaacgagaccagc	Protospacer
 .*** **********.*********   * * 

908. spacer 3.12|68322|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 9, identity: 0.727

accggcttgttgtaggccacgtcccggccggcc	CRISPR spacer
accggcttgctgtaggccccgtcctcgaactcg	Protospacer
*********.******** *****. *    * 

909. spacer 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.727

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
cagcgtgcccacggcggcatgcgccgcgagcga	Protospacer
* *... ***. *******************. 

910. spacer 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_004574 (Ruegeria sp. PR1b plasmid pSD25, complete sequence) position: , mismatch: 9, identity: 0.727

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
gcatcggtccgggtcggcatgcgccccgagcat	Protospacer
 *.*   .***** *********** ******.

911. spacer 3.14|68444|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.727

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
cagcgtgcccacggcggcatgcgccgcgagcga	Protospacer
* *... ***. *******************. 

912. spacer 3.23|68994|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.727

ctcaaaaaggggaagctcgggagcctcacgccc	CRISPR spacer
tgcggcgcggcgaagctcgggatcctcacgccc	Protospacer
. *.. . ** *********** **********

913. spacer 3.26|69177|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.727

tacgcccgcatcacgctgcggctgcccgacacc	CRISPR spacer
tgggcccgcatcacgcggcggcggcccgcggtg	Protospacer
*. ************* ***** *****  .. 

914. spacer 3.37|68329|33|NZ_CP009803|PILER-CR matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 9, identity: 0.727

accggcttgttgtaggccacgtcccggccggcc	CRISPR spacer
accggcttgctgtaggccccgtcctcgaactcg	Protospacer
*********.******** *****. *    * 

915. spacer 3.39|68451|33|NZ_CP009803|PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.727

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
cagcgtgcccacggcggcatgcgccgcgagcga	Protospacer
* *... ***. *******************. 

916. spacer 3.39|68451|33|NZ_CP009803|PILER-CR matches to NC_004574 (Ruegeria sp. PR1b plasmid pSD25, complete sequence) position: , mismatch: 9, identity: 0.727

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
gcatcggtccgggtcggcatgcgccccgagcat	Protospacer
 *.*   .***** *********** ******.

917. spacer 3.39|68451|33|NZ_CP009803|PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.727

ccgtactcccggggcggcatgcgccgcgagcac	CRISPR spacer
cagcgtgcccacggcggcatgcgccgcgagcga	Protospacer
* *... ***. *******************. 

918. spacer 3.48|69001|33|NZ_CP009803|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.727

ctcaaaaaggggaagctcgggagcctcacgccc	CRISPR spacer
tgcggcgcggcgaagctcgggatcctcacgccc	Protospacer
. *.. . ** *********** **********

919. spacer 3.51|69184|33|NZ_CP009803|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.727

tacgcccgcatcacgctgcggctgcccgacacc	CRISPR spacer
tgggcccgcatcacgcggcggcggcccgcggtg	Protospacer
*. ************* ***** *****  .. 

920. spacer 4.1|69880|33|NZ_CP009803|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

atggcgtcgaggcggatgaagatggtgccgccc	CRISPR spacer
gcgtccatcaggcggatgaagatggtggcgacc	Protospacer
..* *  . ****************** ** **

921. spacer 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 9, identity: 0.727

gcctggggcgacgagtggctcggcgtctggaag	CRISPR spacer
ttcggcggcgacgagtcgttcggcgtctgggga	Protospacer
 .* * ********** *.***********...

922. spacer 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 9, identity: 0.727

gcctggggcgacgagtggctcggcgtctggaag	CRISPR spacer
ttcggcggcgacgagtcgttcggcgtctgggga	Protospacer
 .* * ********** *.***********...

923. spacer 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 9, identity: 0.727

gcctggggcgacgagtggctcggcgtctggaag	CRISPR spacer
ttcggcggcgacgagtcgttcggcgtctgggga	Protospacer
 .* * ********** *.***********...

924. spacer 5.1|73685|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 9, identity: 0.727

gcctggggcgacgagtggctcggcgtctggaag	CRISPR spacer
ttcggcggcgacgagtcgttcggcgtctgggga	Protospacer
 .* * ********** *.***********...

925. spacer 5.2|73746|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 9, identity: 0.727

ggcgagcagcccttgaagggcgtccatcagctc	CRISPR spacer
cacagccagcccttgcagggcgtccaacagcgt	Protospacer
 .*.. ********* ********** **** .

926. spacer 5.2|73746|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.727

ggcgagcagcccttgaagggcgtccatcagctc	CRISPR spacer
gagtggtgccccttaaagggcgtccttcagctc	Protospacer
*.  .*.. *****.********** *******

927. spacer 5.3|73807|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 9, identity: 0.727

gactcctggaccggccgccggaacaccagcctc	CRISPR spacer
ccgtctcggcccggccaccggaacaccagccgg	Protospacer
   **..** ******.**************  

928. spacer 5.4|73868|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP035505 (Kocuria indica strain CE7 plasmid pCE7, complete sequence) position: , mismatch: 9, identity: 0.727

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
gccgccgaccgcggcgacaccacgaccaccctc	Protospacer
*   **************.******* **  . 

929. spacer 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 9, identity: 0.727

gtcagcgccggcgagttcggcggaccacacggg	CRISPR spacer
gagaataccggcgagttcgtcggaccagacgat	Protospacer
*  *...************ ******* ***. 

930. spacer 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

gtcagcgccggcgagttcggcggaccacacggg	CRISPR spacer
gagaataccggcgagttcgtcggaccagacgat	Protospacer
*  *...************ ******* ***. 

931. spacer 5.6|73990|33|NZ_CP009803|CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

gtcagcgccggcgagttcggcggaccacacggg	CRISPR spacer
gagaataccggcgagttcgtcggaccagacgat	Protospacer
*  *...************ ******* ***. 

932. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.727

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgctgggcggcgatggcgcgacgctcgtgaacc	Protospacer
..********** **.***********     *

933. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.727

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgctgggcggcgatggcgcgacgctcgtgaacc	Protospacer
..********** **.***********     *

934. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.727

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgctgggcggcgatggcgcgacgctcgtgaacc	Protospacer
..********** **.***********     *

935. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgctgggcggcgatggcgcgacgctcgtgaacc	Protospacer
..********** **.***********     *

936. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.727

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgctgggcggcgatggcgcgacgctcgtgaacc	Protospacer
..********** **.***********     *

937. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.727

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgctgggcggcgatggcgcgacgctcgtgaacc	Protospacer
..********** **.***********     *

938. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.727

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgctgggcggcgatggcgcgacgctcgtgaacc	Protospacer
..********** **.***********     *

939. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.727

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
cgacgccgggctgatcgtgctgaccgccttcat	Protospacer
   **************.***** ****  *..

940. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 9, identity: 0.727

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
acgcatcgggcggatcgcgctgaaggccggcat	Protospacer
.. *..***** ************ ******..

941. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
ggtgaccggcctgatcgcgctgaccgccgccct	Protospacer
* . .**** ************* ***** * .

942. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
ggtgaccggcctgatcgcgctgaccgccgccct	Protospacer
* . .**** ************* ***** * .

943. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
ggtgaccggcctgatcgcgctgaccgccgccct	Protospacer
* . .**** ************* ***** * .

944. spacer 5.14|74474|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.727

gtccgccgggctgatcgcgctgaacgccggcgc	CRISPR spacer
ggtgaccggcctgatcgcgctgaccgccgccct	Protospacer
* . .**** ************* ***** * .

945. spacer 5.15|74535|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

atgacgtcctgccaggtgcggccgccggagccg	CRISPR spacer
gccacgtcctgcagggtgcggccgccggcgatc	Protospacer
.. ********* .************** * . 

946. spacer 5.16|74596|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 9, identity: 0.727

atgcggcccaggcccacggcggaggtgaccgcg	CRISPR spacer
tcgcggcccgggcccacggcgtaggttgtagtg	Protospacer
 .*******.*********** **** .. *.*

947. spacer 5.20|74850|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

gccgacgacccgggcggccccgcctcctcgacc	CRISPR spacer
gccgatgaccccggcggccccgcccgcggacgc	Protospacer
*****.***** ************. *  .  *

948. spacer 5.21|74911|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019309 (Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-2, complete sequence) position: , mismatch: 9, identity: 0.727

gcgtaggcgctgatgatctcgcgtgccgggttc	CRISPR spacer
acattcaggctgatgatcttgcgtgctgggtta	Protospacer
.*.*  . ***********.******.***** 

949. spacer 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

gtcggcgccgatgatcacgcggtgcgcgatgtt	CRISPR spacer
ttgattgccgatgaacacgcggttcgcgatgcg	Protospacer
 * . .******** ******** *******. 

950. spacer 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

gtcggcgccgatgatcacgcggtgcgcgatgtt	CRISPR spacer
gagaggagcgaggaccacgcggtgcgcgatgtc	Protospacer
*  .* . *** **.*****************.

951. spacer 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

gtcggcgccgatgatcacgcggtgcgcgatgtt	CRISPR spacer
gaacgcgccgacgagcacgcggtgcgcgggcgt	Protospacer
*   *******.** *************.   *

952. spacer 5.26|75216|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

gtcggcgccgatgatcacgcggtgcgcgatgtt	CRISPR spacer
ttgattgccgatgaacacgcggttcgcgatgcg	Protospacer
 * . .******** ******** *******. 

953. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

954. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

955. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

956. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

957. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

958. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

959. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

960. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

961. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

962. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

963. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

964. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

965. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

966. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

967. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

968. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

969. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

970. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

971. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

972. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

973. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

974. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

975. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

976. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

977. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

978. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

979. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

980. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

981. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

982. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

983. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

984. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

985. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

986. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

987. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

988. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

989. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

990. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

991. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

992. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

993. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

994. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

995. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

996. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

997. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

998. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

999. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1000. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1001. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1002. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1003. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1004. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1005. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1006. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1007. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1008. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1009. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1010. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1011. spacer 5.27|75277|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtgctcacgcggcaccgccgagggtgtcgcgg	CRISPR spacer
tcgacctccgcggcaccgccgaggcggtcgcgg	Protospacer
.  .*.. ****************  *******

1012. spacer 5.29|75399|33|NZ_CP009803|CRT,PILER-CR,CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.727

ctcgcccgggggcgttgcctgacgcgccgtcag	CRISPR spacer
gtttcccgggggcggcgcctgacgcgccttttc	Protospacer
 *. ********** .************ *.  

1013. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
agacggctgagagcggcgtcccgctcggcggg	Protospacer
     ****** ****************  .*

1014. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
ctcccgccgagcgcggcgtcccgctgaatgac	Protospacer
.** ***.***************** ..  * 

1015. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
tccgcgctgagcgcggcgtctcggtcgccttc	Protospacer
*.*.****************.** ***  .  

1016. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
gcctcctcgagcgcggcgtcgcgctcggccaa	Protospacer
 .* * ..************ ******* **.

1017. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.727

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
agcgcgccgacgggcacgtcgaggcccgcggtc	Protospacer
   **** ********.**********..*. *

1018. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
agcgcgccgacgggcacgtcgaggcccgcggtc	Protospacer
   **** ********.**********..*. *

1019. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 9, identity: 0.727

cacgatccggccggggcgatctgcgcgacgtgg	CRISPR spacer
agcagcagggccggggcggcctgcgcgacgtgg	Protospacer
 .*...  **********..*************

1020. spacer 6.9|80358|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.727

ctgtcgacggtcagccaggacagccccagctcc	CRISPR spacer
agcatgcccgtcagccaggctagccccagctcc	Protospacer
    .* * ********** .************

1021. spacer 6.12|80541|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 9, identity: 0.727

gcgaccggcggggacagccgtcagcgggcggac	CRISPR spacer
aggaccggcggggacagccgcctgcggcgctcc	Protospacer
. ******************.* ****     *

1022. spacer 6.12|80541|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MN908685 (Microbacterium phage PauloDiaboli, complete genome) position: , mismatch: 9, identity: 0.727

gcgaccggcggggacagccgtcagcgggcggac	CRISPR spacer
ggagaggtcggagacagccgtcagcgcgcggat	Protospacer
* ..  * ***.************** *****.

1023. spacer 6.15|80724|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 9, identity: 0.727

ccggtccgtgcaggtcggcgtgctcggcaagcc	CRISPR spacer
caccaccgggcaggtcggcctgctcggcaccgc	Protospacer
*    *** ********** *********   *

1024. spacer 6.15|80724|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.727

ccggtccgtgcaggtcggcgtgctcggcaagcc	CRISPR spacer
ggcgagcgtgcagggcggcgtgttcggcaacgc	Protospacer
   *  ******** *******.*******  *

1025. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ggctgggccccgctcaccggcggctcgctgacc	Protospacer
  *   *** ************** ******  

1026. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ggctgggccccgctcaccggcggctcgctgacc	Protospacer
  *   *** ************** ******  

1027. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ggctgggccccgctcaccggcggctcgctgacc	Protospacer
  *   *** ************** ******  

1028. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
gcggacgccgcgctcaccgtcggcgcggtggac	Protospacer
 . . ************** ******* **.* 

1029. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 9, identity: 0.727

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
cccggcgacgcgctcaccggcgtcgcgctcggc	Protospacer
*.*. ** ************** ****** .. 

1030. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 9, identity: 0.727

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ccgcaggttgcgctcaccggcggcgagcagaag	Protospacer
*.    *..**************** ** ****

1031. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.727

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
cggcgtgccgcgctcgccggcggcgccctgctg	Protospacer
*    .*********.********** ***  *

1032. spacer 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.727

ccatcgacaatctcaccgccgccctgcggaagc	CRISPR spacer
tgccagccgatctcagcgccgccctgcggcagc	Protospacer
.  . * *.****** ************* ***

1033. spacer 6.26|81395|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

gccgccgtgccggtcatggtcaccaccgtcgcg	CRISPR spacer
gccgccgtgccggtccaggtcaccctgacggct	Protospacer
***************  ******* . .. ** 

1034. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
tcggccctggtcgagctggccttcgtcggcgat	Protospacer
.** .  ******* ***** **********  

1035. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.727

ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
tcggccctggtcgagctggccttcgtcggcgac	Protospacer
.** .  ******* ***** **********  

1036. spacer 6.27|81456|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.727

ccgctggtggtcgacctggcgttcgtcggcgcg	CRISPR spacer
tcggccctggtcgagctggccttcgtcggcgat	Protospacer
.** .  ******* ***** **********  

1037. spacer 6.29|81578|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029360 (Azospirillum sp. CFH 70021 plasmid unnamed5) position: , mismatch: 9, identity: 0.727

aggtcaacggcgccgtcgtgactggtgggcagc	CRISPR spacer
cggtcaacgccgccgtcgtgacgggccagctct	Protospacer
 ******** ************ **. .**  .

1038. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR594661 (Variovorax sp. PBL-H6 plasmid 3) position: , mismatch: 9, identity: 0.727

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cggcggatttcggccggctgcgggaagtcaacg	Protospacer
*** **************** ***  * ... *

1039. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044974 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B4) plasmid pPBL-H3_B4-2, complete sequence) position: , mismatch: 9, identity: 0.727

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cggcggatttcggccggctgcgggaagtcaacg	Protospacer
*** **************** ***  * ... *

1040. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to AP018707 (Uncultured bacterium plasmid pSN1104-11 DNA, complete sequence) position: , mismatch: 9, identity: 0.727

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cggcggatttcggccggctgcgggaagtcaacg	Protospacer
*** **************** ***  * ... *

1041. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to AP018708 (Uncultured bacterium plasmid pSN1104-34 DNA, complete sequence) position: , mismatch: 9, identity: 0.727

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cggcggatttcggccggctgcgggaagtcaacg	Protospacer
*** **************** ***  * ... *

1042. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044977 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence) position: , mismatch: 9, identity: 0.727

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cggcggatttcggccggctgcgggaagtcaacg	Protospacer
*** **************** ***  * ... *

1043. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MN536506 (Uncultured bacterium plasmid pEN1, complete sequence) position: , mismatch: 9, identity: 0.727

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cggcggatttcggccggctgcgggaagtcaacg	Protospacer
*** **************** ***  * ... *

1044. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044551 (Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence) position: , mismatch: 9, identity: 0.727

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cggcggatttcggccggctgcgggaagtcaacg	Protospacer
*** **************** ***  * ... *

1045. spacer 6.30|81639|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR594677 (Variovorax sp. PBS-H4 plasmid 3) position: , mismatch: 9, identity: 0.727

cgggggatttcggccggctgggggtcggtgggg	CRISPR spacer
cggcggatttcggccggctgcgggaagtcaacg	Protospacer
*** **************** ***  * ... *

1046. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.727

ttcgttgaggttctcggtggcgccggtccggga	CRISPR spacer
cacgttgaggttcgcggtgccgccgggtgccga	Protospacer
. *********** ***** ****** .   **

1047. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.727

ttcgttgaggttctcggtggcgccggtccggga	CRISPR spacer
cacgttgaggttcgcggtgccgccgggtgccga	Protospacer
. *********** ***** ****** .   **

1048. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.727

ttcgttgaggttctcggtggcgccggtccggga	CRISPR spacer
cacgttgaggttcgcggtgccgccgggtgccga	Protospacer
. *********** ***** ****** .   **

1049. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 9, identity: 0.727

ttcgttgaggttctcggtggcgccg----gtccggga	CRISPR spacer
ctcgttgaggttctcggtctcgccgccgtattc----	Protospacer
.*****************  *****    .*.*    

1050. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018473 (Xanthomonas perforans strain LH3 plasmid pLH3.4, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1051. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018473 (Xanthomonas perforans strain LH3 plasmid pLH3.4, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1052. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX169264 (Pseudomonas aeruginosa strain D5170990 plasmid pD5170990, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1053. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KP975076 (Pseudomonas aeruginosa strain MRSN17623 plasmid pMRVIM0713, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1054. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MN336501 (Pseudomonas aeruginosa strain 164130 plasmid p4130-KPC, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1055. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014066 (Achromobacter xylosoxidans strain FDAARGOS_162 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1056. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014059 (Achromobacter xylosoxidans strain FDAARGOS_147 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1057. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021651 (Acidovorax sp. T1 plasmid p3-T1, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1058. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_009739 (Pseudomonas aeruginosa plasmid pMATVIM-7, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1059. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK423762 (Achromobacter ruhlandii strain 138R plasmid p138R, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1060. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033834 (Pseudomonas aeruginosa strain FDAARGOS_570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1061. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP013064 (Serratia marcescens SM39 plasmid pSMC1, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgcggtaacggcctggtcatcgaggccggcgac	Protospacer
. *  ...***** **************** **

1062. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_042132 (Gordonia phage Sour, complete genome) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
gtattcgtcggccaggtcatcgaggccggtcgg	Protospacer
 . .*** *****.***************.*. 

1063. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_009472 (Acidiphilium cryptum JF-5 plasmid pACRY06, complete sequence) position: , mismatch: 9, identity: 0.727

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
gccctcggcggccgcggcatcgaggaatttcgc	Protospacer
 ************* * ********    .*.*

1064. spacer 6.40|82249|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MN940411 (Staphylococcus phage f2b1, partial genome) position: , mismatch: 9, identity: 0.727

gcagagcaggcgcagcaggagacccaggccaac	CRISPR spacer
gcagagcaggagcagcaggagcccacagtacat	Protospacer
********** ********** **  .*.  *.

1065. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
accaccgtgccgatgcggccggcggtctccacg	Protospacer
.   . *******.* **************** 

1066. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 9, identity: 0.727

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
tggctggtgccgacggggacgacggcgccgcgc	Protospacer
 ***************** **.***. .*   *

1067. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.727

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
aaggcggtgtcggcggggccggcggtctcatcg	Protospacer
..* .****.**.****************  * 

1068. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 9, identity: 0.71

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
cggcggggacggccatgtcgaggttttcgtc	Protospacer
***** ****** **********... .*  

1069. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
ggaaccggacggggatgtcgcggcccatcgc	Protospacer
 *.  ******** ****** ******* . 

1070. spacer 6.47|80237|31|NZ_CP009803|PILER-CR matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 9, identity: 0.71

cggcgcggacgggcatgtcgaggcccatgag	CRISPR spacer
cggcggggacggccatgtcgaggttttcgtc	Protospacer
***** ****** **********... .*  

1071. spacer 2.3|66458|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to MN855882 (Bacteriophage sp. isolate 347, complete genome) position: , mismatch: 10, identity: 0.697

tggagggtgagggtcgcggtgtctgcgtcgtac	CRISPR spacer
gggatggtgacggtcgcggtgtctgccaatggg	Protospacer
 *** ***** ***************     . 

1072. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 10, identity: 0.697

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ggattcctcggcgtgtggctgggcggcgtgctg	Protospacer
  ..*********.** ***********.*   

1073. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 10, identity: 0.697

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ggcttcctcggcgtgtggctgggcggcgtgctg	Protospacer
   .*********.** ***********.*   

1074. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.697

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ggcttcctcggcgtgtggctgggcggcgtgctg	Protospacer
   .*********.** ***********.*   

1075. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 10, identity: 0.697

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ggcttcctcggcgtgtggctgggcggcgtgctg	Protospacer
   .*********.** ***********.*   

1076. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 10, identity: 0.697

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
gcgctcctcgtcgcgctgctgggcggtacccaa	Protospacer
 .******** ****.**********..*  . 

1077. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.697

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
ggcttcctcggcgtgtggctgggcggcgtgctg	Protospacer
   .*********.** ***********.*   

1078. spacer 3.15|68505|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP022304 (Thalassococcus sp. S3 plasmid pS3A, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgcgtggcgggggtgccggggctggtgtgac	CRISPR spacer
gccgcgtggccggtgtgccggggctgacggagg	Protospacer
  ******** ** ************..* .. 

1079. spacer 3.26|69177|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 10, identity: 0.697

tacgcccgcatcacgctgcggctgcccgacacc	CRISPR spacer
ggcgcgcgcttcacgctgcggctgccgctggac	Protospacer
 .*** *** ****************    . *

1080. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gggctcgtctacaccggcgtcgccaccctcacc	Protospacer
.   *** * ******************    *

1081. spacer 3.40|68512|33|NZ_CP009803|PILER-CR matches to NZ_CP022304 (Thalassococcus sp. S3 plasmid pS3A, complete sequence) position: , mismatch: 10, identity: 0.697

cgcgcgtggcgggggtgccggggctggtgtgac	CRISPR spacer
gccgcgtggccggtgtgccggggctgacggagg	Protospacer
  ******** ** ************..* .. 

1082. spacer 3.51|69184|33|NZ_CP009803|PILER-CR matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 10, identity: 0.697

tacgcccgcatcacgctgcggctgcccgacacc	CRISPR spacer
ggcgcgcgcttcacgctgcggctgccgctggac	Protospacer
 .*** *** ****************    . *

1083. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
gggctcgtctacaccggcgtcgccaccctcacc	Protospacer
.   *** * ******************    *

1084. spacer 4.1|69880|33|NZ_CP009803|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 10, identity: 0.697

atggcgtcgaggcggatgaagatggtgccgccc	CRISPR spacer
atggcggcgcggcggatgaagatgaagttcgga	Protospacer
****** ** **************. *..    

1085. spacer 4.1|69880|33|NZ_CP009803|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 10, identity: 0.697

atggcgtcgaggcggatgaagatggtgccgccc	CRISPR spacer
atggcggcgcggcggatgaagatgaagttcgga	Protospacer
****** ** **************. *..    

1086. spacer 4.1|69880|33|NZ_CP009803|CRISPRCasFinder matches to NC_017959 (Tistrella mobilis KA081020-065 plasmid pTM4, complete sequence) position: , mismatch: 10, identity: 0.697

atggcgtcgaggcggatgaagatggtgccgccc	CRISPR spacer
tcgagcccgagccggatgaagatggcgccgctg	Protospacer
 .*.  .**** *************.*****. 

1087. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgaacggcggcgtcgacgcgccgctcggtcgcg	Protospacer
..   ********.****** *********   

1088. spacer 5.8|74108|33|NZ_CP009803|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697

tactgggcggcgttgacgcgacgctcggtccgc	CRISPR spacer
cgtccggccgcgttgacgcgacgatcggtgcag	Protospacer
.... *** ************** ***** *. 

1089. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcggctgagggcggcgtctcgctcggcggg	Protospacer
     ****** ********.*******  .*

1090. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to MH976515 (Gordonia phage Octobien14, complete genome) position: , mismatch: 10, identity: 0.688

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
cgttggctgagggccgcgtcccgctcggggac	Protospacer
. .  ****** ** *************. * 

1091. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to MN096358 (Microbacterium phage LeeroyJenkins, complete genome) position: , mismatch: 10, identity: 0.688

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
tgtcgttgtaggtggcctgcccactaagacgc	Protospacer
********  ************* .. *..  

1092. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to MN096357 (Microbacterium phage WaterT, complete genome) position: , mismatch: 10, identity: 0.688

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
tgtcgttgtaggtggcctgcccactaagacgc	Protospacer
********  ************* .. *..  

1093. spacer 6.6|80176|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 10, identity: 0.688

tgtcgttgatggtggcctgcccagcgtggtcg	CRISPR spacer
ccaagacgatggaggcctgcccagcgcggtac	Protospacer
.   * .***** *************.***  

1094. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 10, identity: 0.697

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
tcggcggggacggccatgtcgaggttttcgtca	Protospacer
****** ****** **********... .*   

1095. spacer 6.7|80236|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 10, identity: 0.697

tcggcgcggacgggcatgtcgaggcccatgagc	CRISPR spacer
tcggcggggacggccatgtcgaggttttcgtca	Protospacer
****** ****** **********... .*   

1096. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.697

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ggtcccggcgccctcaccggcggcgcgcccggg	Protospacer
  . *** *** ****************. ..*

1097. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.697

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ggtcccggcgccctcaccggcggcgcgcccggg	Protospacer
  . *** *** ****************. ..*

1098. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 10, identity: 0.697

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
gtcaccgccgcgctgaccggcgccgatgcggtc	Protospacer
 ************* ******* **   .*.  

1099. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026306 (Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence) position: , mismatch: 10, identity: 0.697

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
gcgctcgccgcgcgcagcggcggcgcgctcacc	Protospacer
 .  .******** ** ************ *  

1100. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.697

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
gaagaggcggcgctcgccggcggcgcgctggac	Protospacer
   .  ** ******.**************.* 

1101. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
gttctagccgcgctcgccggtggcgcgctggcc	Protospacer
 *. . *********.****.*********.  

1102. spacer 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 10, identity: 0.697

gccctcgactacctcgccgacgactgcggggtg	CRISPR spacer
cggcccgactacctcgccgacgcccgcggctgc	Protospacer
   *.***************** *.****    

1103. spacer 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MK372342 (Enterobacteria phage vB_EcoS_IME542, complete genome) position: , mismatch: 10, identity: 0.697

ccatcgacaatctcaccgccgccctgcggaagc	CRISPR spacer
ccatcaacaatctcaacgccgcccttacctgtt	Protospacer
*****.********* *********     . .

1104. spacer 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to HM486077 (Tsukamurella phage TPA2, complete sequence) position: , mismatch: 10, identity: 0.697

ccatcgacaatctcaccgccgccctgcggaagc	CRISPR spacer
gtctcgacgatctcgccgccgccctgctcgatg	Protospacer
 . *****.*****.************  .*  

1105. spacer 6.25|81334|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NC_015210 (Tsukamurella phage TPA2, complete genome) position: , mismatch: 10, identity: 0.697

ccatcgacaatctcaccgccgccctgcggaagc	CRISPR spacer
gtctcgacgatctcgccgccgccctgctcgatg	Protospacer
 . *****.*****.************  .*  

1106. spacer 6.40|82249|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MK894437 (Microbacterium phage MonChoix, complete genome) position: , mismatch: 10, identity: 0.697

gcagagcaggcgcagcaggagacccaggccaac	CRISPR spacer
ctgaacaaggtgcagaaggagacccaggccacg	Protospacer
 ...*  ***.**** ***************  

1107. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MK937594 (Gordonia phage Galadriel, complete genome) position: , mismatch: 10, identity: 0.697

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
cggctggtgccgactcggccggcggtggtgcgt	Protospacer
 *************  **********  .   .

1108. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 10, identity: 0.697

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
cggctggtgccgactcggccggcggtggtgcgt	Protospacer
 *************  **********  .   .

1109. spacer 6.41|82310|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to MK977702 (Gordonia terrae phage McKinley, complete genome) position: , mismatch: 10, identity: 0.697

gggctggtgccgacggggccggcggtctccacc	CRISPR spacer
cggctggtgccgactcggccggcggtggtgcgt	Protospacer
 *************  **********  .   .

1110. spacer 6.45|82554|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.697

ccggcggcggagtcgaccagccggtagagggcg	CRISPR spacer
gcggcggccgcgtcgaccagccggtcctcgatc	Protospacer
 ******* * **************    *.. 

1111. spacer 2.10|66886|33|NZ_CP009803|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 11, identity: 0.667

ctgctcctcggcgcgttgctgggcggcgcgggc	CRISPR spacer
gccatcgtcggcgcgctgctgggcggcgtcatg	Protospacer
 .  ** ********.************. .  

1112. spacer 3.24|69055|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 11, identity: 0.667

gcacggtcggtaggtccgatcgtcggggagacg	CRISPR spacer
ttggcatcggtcggtcctatcgtcggggagctt	Protospacer
 ..  .***** ***** ************ . 

1113. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029453 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1114. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029453 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1115. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP023069 (Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1116. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP023069 (Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1117. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1118. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1119. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1120. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1121. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1122. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029233 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1123. spacer 3.28|69299|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP029233 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1124. spacer 3.49|69062|33|NZ_CP009803|PILER-CR matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 11, identity: 0.667

gcacggtcggtaggtccgatcgtcggggagacg	CRISPR spacer
ttggcatcggtcggtcctatcgtcggggagctt	Protospacer
 ..  .***** ***** ************ . 

1125. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP029453 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1126. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP029453 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1127. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP023069 (Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1128. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP023069 (Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1129. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1130. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1131. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1132. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1133. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1134. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP029233 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1135. spacer 3.53|69306|33|NZ_CP009803|PILER-CR matches to NZ_CP029233 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence) position: , mismatch: 11, identity: 0.667

atcgtcggcaacaccggcgtcgccacccggcac	CRISPR spacer
tatgtcggcaccaccggcgtcgacaccttcgtg	Protospacer
  .******* *********** ****.     

1136. spacer 6.3|79994|32|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.656

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
gcttcgcggagcgcggcgtcgcgctcgactcc	Protospacer
 .. *** ************ ******. .  

1137. spacer 6.8|80297|33|NZ_CP009803|CRT,CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 11, identity: 0.667

cacgatccggccggggcgatctgcgcgacgtgg	CRISPR spacer
tggtcaccggctggggcgatctgggcgacggca	Protospacer
..    *****.*********** ******  .

1138. spacer 6.18|80907|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 11, identity: 0.667

ctcaccgccgcgctcaccggcggcgcgctgaag	CRISPR spacer
ggtctcgccgcgctcagcgtcggcgcgctcgcc	Protospacer
  . .*********** ** ********* .  

1139. spacer 6.21|81090|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.667

gccctcgactacctcgccgacgactgcggggtg	CRISPR spacer
ctgctcgacgacctcgccgacggctgcaaacac	Protospacer
 . ****** ************.****...   

1140. spacer 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009882 (Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence) position: , mismatch: 11, identity: 0.667

ccgtagggcgcccagcgcatgccgtccgggttc	CRISPR spacer
ttcctgggcgcacaccgcatgccgtccggcacg	Protospacer
.. . ****** ** **************  . 

1141. spacer 6.37|82066|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045723 (Pantoea eucalypti strain LMG 24197 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.667

ccgtagggcgcccagcgcatgccgtccgggttc	CRISPR spacer
ttcctgggcgcgcatcgcatgccgtccggcact	Protospacer
.. . ****** ** **************  ..

1142. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 11, identity: 0.667

ttcgttgaggttctcggtggcgccggtccggga	CRISPR spacer
gatattgaggttcccggtgacgccggtcgcctt	Protospacer
  ..*********.*****.********     

1143. spacer 6.38|82127|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 11, identity: 0.667

ttcgttgaggttctcggtggcgccggtccggga	CRISPR spacer
gatattgaggttcccggtgacgccggtcgcctt	Protospacer
  ..*********.*****.********     

1144. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033327 (Xanthomonas cucurbitae strain ATCC 23378 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.667

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
cgtggtaatggcctggtcatcgaggccggcgac	Protospacer
. .  ....**** **************** **

1145. spacer 6.39|82188|33|NZ_CP009803|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 11, identity: 0.667

tccctcggcggccgggtcatcgaggccggccac	CRISPR spacer
atggaaagcggccggatcctcgaggccggcccg	Protospacer
 .    .********.** ************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009802
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_1 1073761-1073909 Orphan NA
2 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_2 1435845-1435990 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_3 2003345-2003493 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_4 2090083-2090227 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_5 2139871-2139970 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_6 2379131-2379220 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_7 2443014-2443327 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_8 2543485-2543572 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_9 2604166-2604376 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_10 2973718-2973804 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_11 2975284-2975383 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_12 2986711-2986932 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_13 3059790-3059911 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_15 3141339-3141480 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_14 3141034-3141273 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_16 3408675-3409009 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_17 3499783-3499998 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_18 3562872-3562997 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_19 3708021-3708131 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_20 3811269-3811364 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_21 3835980-3836088 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_22 3953658-3953746 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_23 4010200-4010286 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_24 4049643-4049811 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_25 4479374-4479472 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_26 4604978-4605063 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_27 4630888-4631101 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_28 5068645-5068795 orTypeII NA
2 spacers
Cas9_archaeal

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_29 5093666-5093780 orTypeII NA
2 spacers
Cas9_archaeal

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_30 5119113-5119200 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_31 5600003-5600091 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_32 5711258-5711359 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009802_33 6364035-6364255 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP009802_10 10.1|2973741|41|NZ_CP009802|CRISPRCasFinder 2973741-2973781 41 NZ_CP009802.1 2727495-2727535 2 0.951
NZ_CP009802_10 10.1|2973741|41|NZ_CP009802|CRISPRCasFinder 2973741-2973781 41 NZ_CP009802.1 4077371-4077411 2 0.951
NZ_CP009802_15 15.1|3141362|40|NZ_CP009802|CRISPRCasFinder 3141362-3141401 40 NZ_CP009802.1 3142726-3142765 2 0.95
NZ_CP009802_17 17.1|3499847|20|NZ_CP009802|PILER-CR 3499847-3499866 20 NZ_CP009802.1 2728088-2728107 1 0.95
NZ_CP009802_23 23.1|4010223|41|NZ_CP009802|CRISPRCasFinder 4010223-4010263 41 NZ_CP009802.1 3515287-3515327 0 1.0
NZ_CP009802_24 24.1|4049686|21|NZ_CP009802|PILER-CR 4049686-4049706 21 NZ_CP009802.1 3515289-3515309 2 0.905

1. spacer 10.1|2973741|41|NZ_CP009802|CRISPRCasFinder matches to position: 2727495-2727535, mismatch: 2, identity: 0.951

gttggttgccgggctccgtctcgaccgtgccggtcaccgat	CRISPR spacer
gtcggttgccgggccccgtctcgaccgtgccggtcaccgat	Protospacer
**.***********.**************************

2. spacer 10.1|2973741|41|NZ_CP009802|CRISPRCasFinder matches to position: 4077371-4077411, mismatch: 2, identity: 0.951

gttggttgccgggctccgtctcgaccgtgccggtcaccgat	CRISPR spacer
gtcggttgccggggtccgtctcgaccgtgccggtcaccgat	Protospacer
**.********** ***************************

3. spacer 15.1|3141362|40|NZ_CP009802|CRISPRCasFinder matches to position: 3142726-3142765, mismatch: 2, identity: 0.95

gaggtcggctgagcaccggctcaacggtgccggcccagaa	CRISPR spacer
gagatcggctgagcaccggctcaacggtgccggtccagaa	Protospacer
***.*****************************.******

4. spacer 17.1|3499847|20|NZ_CP009802|PILER-CR matches to position: 2728088-2728107, mismatch: 1, identity: 0.95

acgggcacgcaggggcggag	CRISPR spacer
acggccacgcaggggcggag	Protospacer
**** ***************

5. spacer 23.1|4010223|41|NZ_CP009802|CRISPRCasFinder matches to position: 3515287-3515327, mismatch: 0, identity: 1.0

gtctttgaccggcacggtcgggacggagcccggcaacccac	CRISPR spacer
gtctttgaccggcacggtcgggacggagcccggcaacccac	Protospacer
*****************************************

6. spacer 24.1|4049686|21|NZ_CP009802|PILER-CR matches to position: 3515289-3515309, mismatch: 2, identity: 0.905

cgagacggagcccggcaaacc	CRISPR spacer
cgggacggagcccggcaaccc	Protospacer
**.*************** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 119913-119938 2 0.923
NZ_CP009802_31 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder 5600031-5600063 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 151279-151311 2 0.939
NZ_CP009802_31 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder 5600031-5600063 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 19550-19582 2 0.939
NZ_CP009802_31 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder 5600031-5600063 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 155168-155200 2 0.939
NZ_CP009802_33 33.4|6364144|22|NZ_CP009802|PILER-CR 6364144-6364165 22 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 260115-260136 2 0.909
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP035421 Leisingera sp. NJS204 plasmid unnamed4, complete sequence 18801-18825 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP031958 Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence 44144-44168 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 28877-28901 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 34177-34201 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 33941-33965 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010626 Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence 37072-37096 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010671 Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence 37157-37181 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP038238 Leisingera sp. NJS201 plasmid unnamed4, complete sequence 95082-95106 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 37471-37495 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010685 Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence 37111-37135 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010633 Phaeobacter inhibens strain P78 plasmid pP78_d, complete sequence 40790-40814 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010720 Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence 37603-37627 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010660 Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence 37036-37060 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010622 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence 37156-37180 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 37192-37216 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010773 Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence 37576-37600 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010648 Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence 37569-37593 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 94576-94600 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010702 Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence 37199-37223 3 0.88
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP010748 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence 37138-37162 3 0.88
NZ_CP009802_16 16.6|3408705|32|NZ_CP009802|CRT 3408705-3408736 32 NZ_CP011808 Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence 56465-56496 3 0.906
NZ_CP009802_16 16.11|3408705|33|NZ_CP009802|PILER-CR 3408705-3408737 33 NZ_CP011808 Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence 56465-56497 3 0.909
NZ_CP009802_33 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder 6364134-6364158 25 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 21640-21664 3 0.88
NZ_CP009802_12 12.1|2986747|25|NZ_CP009802|PILER-CR 2986747-2986771 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2244363-2244387 4 0.84
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 36932-36956 4 0.84
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 553113-553137 4 0.84
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_LR594664 Variovorax sp. RA8 plasmid 3 300388-300413 4 0.846
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 43795-43820 4 0.846
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 43794-43819 4 0.846
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 43791-43816 4 0.846
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 117842-117867 4 0.846
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1588501-1588526 4 0.846
NZ_CP009802_33 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder 6364134-6364158 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1339647-1339671 4 0.84
NZ_CP009802_33 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder 6364134-6364158 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1344315-1344339 4 0.84
NZ_CP009802_33 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder 6364134-6364158 25 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 260113-260137 4 0.84
NZ_CP009802_33 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder 6364134-6364158 25 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 761511-761535 4 0.84
NZ_CP009802_33 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder 6364134-6364158 25 NZ_CP036516 Lichenihabitans psoromatis strain PAMC 29148 plasmid p_unnamed1, complete sequence 74034-74058 4 0.84
NZ_CP009802_4 4.1|2090117|29|NZ_CP009802|PILER-CR 2090117-2090145 29 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 194503-194531 5 0.828
NZ_CP009802_4 4.1|2090117|29|NZ_CP009802|PILER-CR 2090117-2090145 29 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 193081-193109 5 0.828
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 23574-23598 5 0.8
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 389756-389780 5 0.8
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 114624-114648 5 0.8
NZ_CP009802_12 12.2|2986808|25|NZ_CP009802|PILER-CR 2986808-2986832 25 NZ_CP018865 Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence 143857-143881 5 0.8
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP038238 Leisingera sp. NJS201 plasmid unnamed4, complete sequence 95077-95107 5 0.839
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP035421 Leisingera sp. NJS204 plasmid unnamed4, complete sequence 18800-18830 5 0.839
NZ_CP009802_18 18.2|3562953|28|NZ_CP009802|PILER-CR 3562953-3562980 28 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1298337-1298364 5 0.821
NZ_CP009802_18 18.2|3562953|28|NZ_CP009802|PILER-CR 3562953-3562980 28 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1587631-1587658 5 0.821
NZ_CP009802_27 27.1|4630918|31|NZ_CP009802|CRISPRCasFinder 4630918-4630948 31 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 74756-74786 5 0.839
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 115489-115514 5 0.808
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2475822-2475847 5 0.808
NZ_CP009802_31 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder 5600031-5600063 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 33268-33300 5 0.848
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 942836-942869 6 0.824
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 393389-393422 6 0.824
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 870286-870319 6 0.824
NZ_CP009802_4 4.1|2090117|29|NZ_CP009802|PILER-CR 2090117-2090145 29 MH045568 Microbacterium phage Kieran, complete genome 8428-8456 6 0.793
NZ_CP009802_4 4.1|2090117|29|NZ_CP009802|PILER-CR 2090117-2090145 29 MN062717 Microbacterium phage Sharkboy, complete genome 8424-8452 6 0.793
NZ_CP009802_4 4.1|2090117|29|NZ_CP009802|PILER-CR 2090117-2090145 29 NC_042099 Microbacterium phage Dismas, complete genome 8425-8453 6 0.793
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010626 Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence 37067-37097 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010671 Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence 37152-37182 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 37466-37496 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010685 Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence 37106-37136 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010633 Phaeobacter inhibens strain P78 plasmid pP78_d, complete sequence 40785-40815 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010720 Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence 37598-37628 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010660 Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence 37031-37061 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010622 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence 37151-37181 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 37187-37217 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010773 Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence 37571-37601 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010648 Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence 37564-37594 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 94571-94601 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010702 Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence 37194-37224 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP010748 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence 37133-37163 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 320454-320484 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP031958 Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence 44143-44173 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 28876-28906 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 34176-34206 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 33940-33970 6 0.806
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP015231 Epibacterium mobile F1926 plasmid unnamed1, complete sequence 1225605-1225635 6 0.806
NZ_CP009802_16 16.10|3408949|32|NZ_CP009802|CRT 3408949-3408980 32 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 268416-268447 6 0.812
NZ_CP009802_19 19.2|3708084|28|NZ_CP009802|PILER-CR 3708084-3708111 28 NZ_KP289281 Pseudomonas sp. EGD-AKN5 plasmid unnamed, complete sequence 36548-36575 6 0.786
NZ_CP009802_19 19.2|3708084|28|NZ_CP009802|PILER-CR 3708084-3708111 28 NC_004956 Pseudomonas sp. ADP atrazine catabolic plasmid pADP-1, complete sequence 36548-36575 6 0.786
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_CP048816 Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed 174171-174201 6 0.806
NZ_CP009802_27 27.3|4631040|31|NZ_CP009802|CRISPRCasFinder 4631040-4631070 31 MK967393 Rhodococcus phage Whack, complete genome 13218-13248 6 0.806
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1159510-1159535 6 0.769
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 451519-451544 6 0.769
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 MK686071 Streptomyces phage Mischief19, complete genome 15961-15986 6 0.769
NZ_CP009802_29 29.1|5093691|26|NZ_CP009802|PILER-CR 5093691-5093716 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1249445-1249470 6 0.769
NZ_CP009802_33 33.5|6364201|29|NZ_CP009802|PILER-CR 6364201-6364229 29 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 200638-200666 6 0.793
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NC_010335 Caulobacter sp. K31 plasmid pCAUL01, complete sequence 232268-232301 7 0.794
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 36927-36957 7 0.774
NZ_CP009802_15 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder 3141425-3141457 33 MN062714 Microbacterium Phage DirtyBubble, complete genome 13153-13185 7 0.788
NZ_CP009802_15 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder 3141425-3141457 33 MT024860 Microbacterium phage Stromboli, complete genome 13193-13225 7 0.788
NZ_CP009802_16 16.3|3408827|31|NZ_CP009802|CRISPRCasFinder 3408827-3408857 31 NC_015459 Pusillimonas sp. T7-7 plasmid unnamed, complete sequence 36194-36224 7 0.774
NZ_CP009802_16 16.3|3408827|31|NZ_CP009802|CRISPRCasFinder 3408827-3408857 31 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 720328-720358 7 0.774
NZ_CP009802_16 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder 3408949-3408979 31 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 23853-23883 7 0.774
NZ_CP009802_16 16.8|3408827|32|NZ_CP009802|CRT 3408827-3408858 32 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 101663-101694 7 0.781
NZ_CP009802_16 16.8|3408827|32|NZ_CP009802|CRT 3408827-3408858 32 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198779-198810 7 0.781
NZ_CP009802_16 16.9|3408888|32|NZ_CP009802|CRT 3408888-3408919 32 MH673671 Thermus phage phiKo, complete genome 5962-5993 7 0.781
NZ_CP009802_16 16.13|3408827|33|NZ_CP009802|PILER-CR 3408827-3408859 33 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 101663-101695 7 0.788
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 518158-518188 7 0.774
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5925230-5925260 7 0.774
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_CP008890 Dermacoccus nishinomiyaensis strain M25 plasmid unnamed, complete sequence 32344-32374 7 0.774
NZ_CP009802_31 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder 5600031-5600063 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 26338-26370 7 0.788
NZ_CP009802_31 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder 5600031-5600063 33 NZ_CP009439 Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence 62948-62980 7 0.788
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 492871-492904 8 0.765
NZ_CP009802_4 4.1|2090117|29|NZ_CP009802|PILER-CR 2090117-2090145 29 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 369712-369740 8 0.724
NZ_CP009802_4 4.1|2090117|29|NZ_CP009802|PILER-CR 2090117-2090145 29 NZ_CP011000 Sinorhizobium meliloti strain USDA1963 plasmid pHRB800, complete sequence 109695-109723 8 0.724
NZ_CP009802_4 4.1|2090117|29|NZ_CP009802|PILER-CR 2090117-2090145 29 NZ_CP021832 Sinorhizobium meliloti strain HM006 plasmid accessoryA, complete sequence 188304-188332 8 0.724
NZ_CP009802_12 12.3|2986741|31|NZ_CP009802|CRISPRCasFinder 2986741-2986771 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2244362-2244392 8 0.742
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 MK937603 Gordonia phage Bakery, complete genome 21800-21830 8 0.742
NZ_CP009802_15 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder 3141425-3141457 33 MT310853 Microbacterium phage AvGardian, complete genome 12854-12886 8 0.758
NZ_CP009802_16 16.3|3408827|31|NZ_CP009802|CRISPRCasFinder 3408827-3408857 31 MK376956 Gordonia phage WilliamBoone, complete genome 89867-89897 8 0.742
NZ_CP009802_16 16.3|3408827|31|NZ_CP009802|CRISPRCasFinder 3408827-3408857 31 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198780-198810 8 0.742
NZ_CP009802_16 16.4|3408888|31|NZ_CP009802|CRISPRCasFinder 3408888-3408918 31 MH673671 Thermus phage phiKo, complete genome 5962-5992 8 0.742
NZ_CP009802_16 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder 3408949-3408979 31 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 379888-379918 8 0.742
NZ_CP009802_16 16.7|3408766|32|NZ_CP009802|CRT 3408766-3408797 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 208827-208858 8 0.75
NZ_CP009802_16 16.8|3408827|32|NZ_CP009802|CRT 3408827-3408858 32 NC_015459 Pusillimonas sp. T7-7 plasmid unnamed, complete sequence 36193-36224 8 0.75
NZ_CP009802_16 16.8|3408827|32|NZ_CP009802|CRT 3408827-3408858 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 720327-720358 8 0.75
NZ_CP009802_16 16.8|3408827|32|NZ_CP009802|CRT 3408827-3408858 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 686364-686395 8 0.75
NZ_CP009802_16 16.8|3408827|32|NZ_CP009802|CRT 3408827-3408858 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 602813-602844 8 0.75
NZ_CP009802_16 16.9|3408888|32|NZ_CP009802|CRT 3408888-3408919 32 NZ_CP049321 Caballeronia sp. SBC2 plasmid pSBC2-5, complete sequence 86762-86793 8 0.75
NZ_CP009802_16 16.10|3408949|32|NZ_CP009802|CRT 3408949-3408980 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 23852-23883 8 0.75
NZ_CP009802_16 16.13|3408827|33|NZ_CP009802|PILER-CR 3408827-3408859 33 NC_015459 Pusillimonas sp. T7-7 plasmid unnamed, complete sequence 36192-36224 8 0.758
NZ_CP009802_16 16.13|3408827|33|NZ_CP009802|PILER-CR 3408827-3408859 33 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 602812-602844 8 0.758
NZ_CP009802_16 16.14|3408888|33|NZ_CP009802|PILER-CR 3408888-3408920 33 NZ_CP049321 Caballeronia sp. SBC2 plasmid pSBC2-5, complete sequence 86762-86794 8 0.758
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 287625-287655 8 0.742
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 949017-949047 8 0.742
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 550777-550807 8 0.742
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 208033-208063 8 0.742
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 AJ630128 Bacteriophage S-PM2 complete genome 164269-164299 8 0.742
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NC_006820 Synechococcus phage S-PM2, complete genome 164269-164299 8 0.742
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 LN828717 Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome 154725-154755 8 0.742
NZ_CP009802_27 27.3|4631040|31|NZ_CP009802|CRISPRCasFinder 4631040-4631070 31 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 719962-719992 8 0.742
NZ_CP009802_31 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder 5600031-5600063 33 NC_010905 Amycolatopsis benzoatilytica strain DSM 43387 plasmid pA387, complete sequence 6937-6969 8 0.758
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 61049-61082 9 0.735
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 799816-799849 9 0.735
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 573647-573680 9 0.735
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 37139-37172 9 0.735
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1888115-1888152 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 704679-704716 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 756280-756317 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1271599-1271636 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1400242-1400279 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 670513-670550 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 826466-826503 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 846544-846581 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1022445-1022482 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 581445-581482 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1175403-1175440 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 742792-742829 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1868284-1868321 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 281518-281555 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 832004-832041 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1155269-1155306 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 759721-759758 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 659058-659095 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 758320-758357 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 943369-943406 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 325206-325243 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 755575-755612 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 831993-832030 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 943336-943373 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 820268-820305 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 866236-866273 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 943337-943374 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 726133-726170 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 820268-820305 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 866236-866273 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 943350-943387 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 820268-820305 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 726161-726198 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 820272-820309 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 866236-866273 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 866236-866273 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 866236-866273 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 943350-943387 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1205914-1205951 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 943339-943376 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 726161-726198 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 759966-760003 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 740661-740698 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 795790-795827 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 831179-831216 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1318918-1318955 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 943339-943376 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 726161-726198 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 820268-820305 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 971958-971995 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 726161-726198 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 726161-726198 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 943350-943387 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 866238-866275 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1233589-1233626 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 943361-943398 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 943339-943376 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1233589-1233626 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1229745-1229782 9 0.763
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 943333-943370 9 0.763
NZ_CP009802_12 12.3|2986741|31|NZ_CP009802|CRISPRCasFinder 2986741-2986771 31 NZ_CP026927 Agrobacterium tumefaciens strain 1D1609 plasmid pAt1D1609a, complete sequence 137600-137630 9 0.71
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 113904-113934 9 0.71
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 269095-269125 9 0.71
NZ_CP009802_15 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder 3141425-3141457 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 182727-182759 9 0.727
NZ_CP009802_15 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder 3141425-3141457 33 MH045568 Microbacterium phage Kieran, complete genome 12871-12903 9 0.727
NZ_CP009802_15 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder 3141425-3141457 33 MN062717 Microbacterium phage Sharkboy, complete genome 12867-12899 9 0.727
NZ_CP009802_15 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder 3141425-3141457 33 NC_042099 Microbacterium phage Dismas, complete genome 12868-12900 9 0.727
NZ_CP009802_16 16.1|3408705|31|NZ_CP009802|CRISPRCasFinder 3408705-3408735 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 719603-719633 9 0.71
NZ_CP009802_16 16.4|3408888|31|NZ_CP009802|CRISPRCasFinder 3408888-3408918 31 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 320524-320554 9 0.71
NZ_CP009802_16 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder 3408949-3408979 31 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 268417-268447 9 0.71
NZ_CP009802_16 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder 3408949-3408979 31 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 11137-11167 9 0.71
NZ_CP009802_16 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder 3408949-3408979 31 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 11133-11163 9 0.71
NZ_CP009802_16 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder 3408949-3408979 31 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 11137-11167 9 0.71
NZ_CP009802_16 16.7|3408766|32|NZ_CP009802|CRT 3408766-3408797 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 474397-474428 9 0.719
NZ_CP009802_16 16.8|3408827|32|NZ_CP009802|CRT 3408827-3408858 32 MK376956 Gordonia phage WilliamBoone, complete genome 89866-89897 9 0.719
NZ_CP009802_27 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder 4630979-4631009 31 NZ_CP038235 Leisingera sp. NJS201 plasmid unnamed1, complete sequence 88550-88580 9 0.71
NZ_CP009802_31 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder 5600031-5600063 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 428469-428501 9 0.727
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NZ_CP025805 Sulfitobacter sp. SK012 plasmid unnamed1, complete sequence 6300-6333 10 0.706
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NZ_CP025806 Sulfitobacter sp. SK012 plasmid unnamed3, complete sequence 101359-101392 10 0.706
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 34794-34827 10 0.706
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 34794-34827 10 0.706
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 731149-731182 10 0.706
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1474205-1474238 10 0.706
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 KX522649 Mycobacterium phage Bircsak, complete genome 50306-50339 10 0.706
NZ_CP009802_2 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder 1435934-1435967 34 KX522943 Mycobacterium phage Gompeii16, complete genome 50307-50340 10 0.706
NZ_CP009802_4 4.2|2090180|38|NZ_CP009802|PILER-CR 2090180-2090217 38 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 624267-624304 10 0.737
NZ_CP009802_9 9.2|2604254|37|NZ_CP009802|CRISPRCasFinder 2604254-2604290 37 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1385838-1385874 10 0.73
NZ_CP009802_9 9.2|2604254|37|NZ_CP009802|CRISPRCasFinder 2604254-2604290 37 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1363804-1363840 10 0.73
NZ_CP009802_12 12.3|2986741|31|NZ_CP009802|CRISPRCasFinder 2986741-2986771 31 NC_019408 Caulobacter phage CcrRogue, complete genome 62193-62223 10 0.677
NZ_CP009802_12 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder 2986802-2986832 31 NZ_CP018865 Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence 143852-143882 10 0.677
NZ_CP009802_16 16.6|3408705|32|NZ_CP009802|CRT 3408705-3408736 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 719603-719634 10 0.688
NZ_CP009802_16 16.9|3408888|32|NZ_CP009802|CRT 3408888-3408919 32 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 320523-320554 10 0.688
NZ_CP009802_16 16.10|3408949|32|NZ_CP009802|CRT 3408949-3408980 32 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 11137-11168 10 0.688
NZ_CP009802_16 16.10|3408949|32|NZ_CP009802|CRT 3408949-3408980 32 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 11133-11164 10 0.688
NZ_CP009802_16 16.10|3408949|32|NZ_CP009802|CRT 3408949-3408980 32 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 11137-11168 10 0.688
NZ_CP009802_16 16.13|3408827|33|NZ_CP009802|PILER-CR 3408827-3408859 33 MK376956 Gordonia phage WilliamBoone, complete genome 89865-89897 10 0.697
NZ_CP009802_18 18.1|3562895|35|NZ_CP009802|PILER-CR 3562895-3562929 35 MH590600 Microbacterium phage KaiHaiDragon, complete genome 42149-42183 10 0.714
NZ_CP009802_18 18.1|3562895|35|NZ_CP009802|PILER-CR 3562895-3562929 35 MK977698 Microbacterium phage Busephilis, complete genome 42164-42198 10 0.714
NZ_CP009802_18 18.1|3562895|35|NZ_CP009802|PILER-CR 3562895-3562929 35 MK875798 Microbacterium phage Piperis, complete genome 42156-42190 10 0.714
NZ_CP009802_18 18.1|3562895|35|NZ_CP009802|PILER-CR 3562895-3562929 35 MT818415 Microbacterium phage Scumberland, complete genome 42466-42500 10 0.714
NZ_CP009802_18 18.1|3562895|35|NZ_CP009802|PILER-CR 3562895-3562929 35 MN444877 Microbacterium phage Antares, complete genome 42457-42491 10 0.714
NZ_CP009802_16 16.11|3408705|33|NZ_CP009802|PILER-CR 3408705-3408737 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 719603-719635 11 0.667
NZ_CP009802_14 14.3|3141209|40|NZ_CP009802|PILER-CR 3141209-3141248 40 KU530220 Streptomyces phage Xkcd426, complete genome 29731-29770 12 0.7
NZ_CP009802_14 14.5|3141209|41|NZ_CP009802|CRISPRCasFinder 3141209-3141249 41 KU530220 Streptomyces phage Xkcd426, complete genome 29731-29771 13 0.683

1. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.923

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
ctggtcgagaccgagctgaccgcgaa	Protospacer
**** ****************** **

2. spacer 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 2, identity: 0.939

ttgaccgggtgccggtaccggcccgcgtcgtca	CRISPR spacer
ttgaccgggtgccggtaccggcctgcgtcgtcc	Protospacer
***********************.******** 

3. spacer 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 2, identity: 0.939

ttgaccgggtgccggtaccggcccgcgtcgtca	CRISPR spacer
ttgaccgggtgccggtaccggcctgcgtcgtcc	Protospacer
***********************.******** 

4. spacer 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.939

ttgaccgggtgccggtaccggcccgcgtcgtca	CRISPR spacer
ttgaccgggtgccggtaccggcctgcgtcgtcc	Protospacer
***********************.******** 

5. spacer 33.4|6364144|22|NZ_CP009802|PILER-CR matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 2, identity: 0.909

tcgtcctcatgccggacgggcc	CRISPR spacer
tcgtcctcaagccggacgggct	Protospacer
********* ***********.

6. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP035421 (Leisingera sp. NJS204 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctca	Protospacer
* *****************.**** 

7. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

8. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

9. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

10. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

11. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

12. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

13. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP038238 (Leisingera sp. NJS201 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctca	Protospacer
* *****************.**** 

14. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

15. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010685 (Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

16. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010633 (Phaeobacter inhibens strain P78 plasmid pP78_d, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

17. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010720 (Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

18. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010660 (Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

19. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

20. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

21. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010773 (Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

22. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010648 (Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

23. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gttgatctcgcgggcgctgtcctcg	Protospacer
*.*************** ****** 

24. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

25. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gatgatctcgcgggcgcggccctcg	Protospacer
* *****************.**** 

26. spacer 16.6|3408705|32|NZ_CP009802|CRT matches to NZ_CP011808 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence) position: , mismatch: 3, identity: 0.906

-gcgctgatgggcgctcccgagcccgtccttgt	CRISPR spacer
ggcgctgat-ggcgcgcccgagcgcgtccttgt	Protospacer
 ******** ***** ******* *********

27. spacer 16.11|3408705|33|NZ_CP009802|PILER-CR matches to NZ_CP011808 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence) position: , mismatch: 3, identity: 0.909

-gcgctgatgggcgctcccgagcccgtccttgtg	CRISPR spacer
ggcgctgat-ggcgcgcccgagcgcgtccttgtg	Protospacer
 ******** ***** ******* **********

28. spacer 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 3, identity: 0.88

atcgtcctcatgccggacgggccgt	CRISPR spacer
atcgtcctcatgacgaacgggccgg	Protospacer
************ **.******** 

29. spacer 12.1|2986747|25|NZ_CP009802|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

acttccggctggcgctagccgaagc	CRISPR spacer
gcttccggctgccgctggccgaaga	Protospacer
.********** ****.******* 

30. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 4, identity: 0.84

gctgatctcgcgggcgcggtcctct	CRISPR spacer
aatgatctcgcgggcgcggccctca	Protospacer
. *****************.**** 

31. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 4, identity: 0.84

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gctgacctcgcgggcgcggtcgccg	Protospacer
*****.*************** .* 

32. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 4, identity: 0.846

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
atgggcgagaccgagctgagcgccgg	Protospacer
 ****************** ****..

33. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 4, identity: 0.846

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
ctgggcgaggccgagctgaacgccct	Protospacer
*********.********* ****  

34. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 4, identity: 0.846

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
ctgggcgaggccgagctgaacgccct	Protospacer
*********.********* ****  

35. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 4, identity: 0.846

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
ctgggcgaggccgagctgaacgccct	Protospacer
*********.********* ****  

36. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
ctgggcgagaccgcgctgaccctgaa	Protospacer
************* ******* . **

37. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 4, identity: 0.846

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
ctgggcgaggccaagctgaccgcgca	Protospacer
*********.**.**********  *

38. spacer 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 4, identity: 0.84

atcgtcctcatgccggacgggccgt	CRISPR spacer
ttcgtccccatgccggacggaccgg	Protospacer
 ******.************.*** 

39. spacer 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 4, identity: 0.84

atcgtcctcatgccggacgggccgt	CRISPR spacer
ttcgtccccatgccggacggaccgg	Protospacer
 ******.************.*** 

40. spacer 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 4, identity: 0.84

atcgtcctcatgccggacgggccgt	CRISPR spacer
gtcgtcctcaagccggacgggctct	Protospacer
.********* ***********. *

41. spacer 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 4, identity: 0.84

atcgtcctcatgccggacgggccgt	CRISPR spacer
gtcgtcctcatgccgggcgcgccgg	Protospacer
.***************.** **** 

42. spacer 33.2|6364134|25|NZ_CP009802|CRISPRCasFinder matches to NZ_CP036516 (Lichenihabitans psoromatis strain PAMC 29148 plasmid p_unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

atcgtcctcatgccggacgggccgt	CRISPR spacer
gtcgtcctcatgccggccgggacga	Protospacer
.*************** **** ** 

43. spacer 4.1|2090117|29|NZ_CP009802|PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 5, identity: 0.828

ggccaaggcccccgaggcgaagccggctg	CRISPR spacer
ggccaaggccgccgaggcgcagcccgaag	Protospacer
********** ******** **** *  *

44. spacer 4.1|2090117|29|NZ_CP009802|PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 5, identity: 0.828

ggccaaggcccccgaggcgaagccggctg	CRISPR spacer
ggccaaggccgccgaggcgcagcccgaag	Protospacer
********** ******** **** *  *

45. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 5, identity: 0.8

gctgatctcgcgggcgcggtcctct	CRISPR spacer
ctcgatctcgcgggcgcggtcctgc	Protospacer
 ..******************** .

46. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 5, identity: 0.8

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gctgatctcgcgggcgcggccggtg	Protospacer
*******************.*  . 

47. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatctcgcgggcgcggtcctct	CRISPR spacer
gctgatctcgcgggtgcggtcgagc	Protospacer
**************.******   .

48. spacer 12.2|2986808|25|NZ_CP009802|PILER-CR matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatctcgcgggcgcggtcctct	CRISPR spacer
ttcaatcacgcgggcgcggtcctct	Protospacer
 ...*** *****************

49. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP038238 (Leisingera sp. NJS201 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.839

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcatcgtc	Protospacer
.* *****************.**** ***.*

50. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP035421 (Leisingera sp. NJS204 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.839

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcatcgtc	Protospacer
.* *****************.**** ***.*

51. spacer 18.2|3562953|28|NZ_CP009802|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.821

ggcgtggctccggcggtgcggagcttgt	CRISPR spacer
gcggtggctccggcggtgcggtccttgc	Protospacer
*  ******************  ****.

52. spacer 18.2|3562953|28|NZ_CP009802|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.821

ggcgtggctccggcggtgcggagcttgt	CRISPR spacer
gcggtggctccggcggtgcggtccttgc	Protospacer
*  ******************  ****.

53. spacer 27.1|4630918|31|NZ_CP009802|CRISPRCasFinder matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 5, identity: 0.839

cgatgatgttcgtgacgaccggagcggcctc-	CRISPR spacer
cgatgacgttcgtgacgaccgg-gcgcccctg	Protospacer
******.*************** *** **.. 

54. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.808

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
aaccgcgagatcgagctgaccgccaa	Protospacer
    ******.***************

55. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
aagggcgagaccgagctgaccccgga	Protospacer
  ******************* * .*

56. spacer 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 5, identity: 0.848

ttgaccgggtgccggtaccggcccgcgtcgtca	CRISPR spacer
cgcaccgggtgccggtaccggcctgcgtcgtcc	Protospacer
.  ********************.******** 

57. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.824

gcgtcggcggggcgcggggcggcgggatcgatcc---	CRISPR spacer
gcgacggccgggcgcggggcggcgg---cgagccggt	Protospacer
*** **** ****************   *** **   

58. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.824

-gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
ggctccagc-gggcgcggggcggcgagatcgagcc	Protospacer
 ** .*.** ***************.****** **

59. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.824

gcgtcggcggggcgcggggcggcgggatcgatcc---	CRISPR spacer
gcgacggccgggcgcggggcggcgg---cgagccggt	Protospacer
*** **** ****************   *** **   

60. spacer 4.1|2090117|29|NZ_CP009802|PILER-CR matches to MH045568 (Microbacterium phage Kieran, complete genome) position: , mismatch: 6, identity: 0.793

ggccaaggcccccgaggcgaagccggctg	CRISPR spacer
gcgggaggcccgcgatgcgaagccggctg	Protospacer
*   .****** *** *************

61. spacer 4.1|2090117|29|NZ_CP009802|PILER-CR matches to MN062717 (Microbacterium phage Sharkboy, complete genome) position: , mismatch: 6, identity: 0.793

ggccaaggcccccgaggcgaagccggctg	CRISPR spacer
gcgggaggcccgcgatgcgaagccggctg	Protospacer
*   .****** *** *************

62. spacer 4.1|2090117|29|NZ_CP009802|PILER-CR matches to NC_042099 (Microbacterium phage Dismas, complete genome) position: , mismatch: 6, identity: 0.793

ggccaaggcccccgaggcgaagccggctg	CRISPR spacer
gcgggaggcccgcgatgcgaagccggctg	Protospacer
*   .****** *** *************

63. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

64. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

65. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

66. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010685 (Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

67. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010633 (Phaeobacter inhibens strain P78 plasmid pP78_d, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

68. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010720 (Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

69. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010660 (Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

70. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

71. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

72. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010773 (Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

73. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010648 (Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

74. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
ggttgatctcgcgggcgctgtcctcgatgcc	Protospacer
 *.*************** ******  .***

75. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

76. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

77. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cggtgacaccgcgggcgcggtcctcctcgcc	Protospacer
.* ***. .****************.*****

78. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

79. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

80. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

81. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 6, identity: 0.806

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cgatgatctcgcgggcgcggccctcggcgtc	Protospacer
.* *****************.****  **.*

82. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

-tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
ccgct-ttctcgcgggcgtggtcctcgtcgac	Protospacer
 .***  ***********.******* *** *

83. spacer 16.10|3408949|32|NZ_CP009802|CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

gcgacggtgaaggcgaagcgccccacccagcg---	CRISPR spacer
gcgacgttgaaggcgaagcg---caccgagagctt	Protospacer
****** *************   **** ** *   

84. spacer 19.2|3708084|28|NZ_CP009802|PILER-CR matches to NZ_KP289281 (Pseudomonas sp. EGD-AKN5 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

gtgagcggggagctagcgcccgcagtcg	CRISPR spacer
ctcttcgggaagctggcgcccgcagtcg	Protospacer
 *   ****.****.*************

85. spacer 19.2|3708084|28|NZ_CP009802|PILER-CR matches to NC_004956 (Pseudomonas sp. ADP atrazine catabolic plasmid pADP-1, complete sequence) position: , mismatch: 6, identity: 0.786

gtgagcggggagctagcgcccgcagtcg	CRISPR spacer
ctcttcgggaagctggcgcccgcagtcg	Protospacer
 *   ****.****.*************

86. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 6, identity: 0.806

ccaacgcgaccagggtgatcac-gtcgaaggt	CRISPR spacer
ccaaggcgaccagggtcatcacggttgatcg-	Protospacer
**** *********** ***** **.**  * 

87. spacer 27.3|4631040|31|NZ_CP009802|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 6, identity: 0.806

acaaggtccggaacggcgtcaagatgaagca--	CRISPR spacer
acaaggtctggaacggcatcaag--gacgccat	Protospacer
********.********.*****  ** **   

88. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.769

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
tctggcgagcccgagctgaccgccgg	Protospacer
.. ****** **************..

89. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.769

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
gtcaccgagaccgagctgaccgcctc	Protospacer
 * . *******************  

90. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to MK686071 (Streptomyces phage Mischief19, complete genome) position: , mismatch: 6, identity: 0.769

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
gagggcgagaccgaggtgaccgcgtc	Protospacer
  ************* *******   

91. spacer 29.1|5093691|26|NZ_CP009802|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.769

ctgggcgagaccgagctgaccgccaa	CRISPR spacer
tctggcgagcccgagctgaccgccgg	Protospacer
.. ****** **************..

92. spacer 33.5|6364201|29|NZ_CP009802|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.793

tcttcgagcgccggactggtctgggaagg	CRISPR spacer
tcgacgagcgccggacgggtctggaaaat	Protospacer
**  ************ *******.**. 

93. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 7, identity: 0.794

--gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
aggtgctggc--ggcgcgcggcggccggatcgatcc	Protospacer
  *.*..***  ****** ****** **********

94. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.774

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
caatgatctcgcgggcgcggccctcagcgtc	Protospacer
.. *****************.****  **.*

95. spacer 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder matches to MN062714 (Microbacterium Phage DirtyBubble, complete genome) position: , mismatch: 7, identity: 0.788

cgaaagacggcctcaagcgccgcccgggctagg	CRISPR spacer
cgcccgacggcctcatgcgccgcccgggcgggt	Protospacer
**   ********** ************* .* 

96. spacer 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder matches to MT024860 (Microbacterium phage Stromboli, complete genome) position: , mismatch: 7, identity: 0.788

cgaaagacggcctcaagcgccgcccgggctagg	CRISPR spacer
cgcccgacggcctcatgcgccgcccgggcgggt	Protospacer
**   ********** ************* .* 

97. spacer 16.3|3408827|31|NZ_CP009802|CRISPRCasFinder matches to NC_015459 (Pusillimonas sp. T7-7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

caggtcaggggctggctggacgatccggaca	CRISPR spacer
gaggtcaagggctggatggacgatcgcagca	Protospacer
 ******.******* *********  ..**

98. spacer 16.3|3408827|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.774

caggtcaggggctggctggacgatccggaca	CRISPR spacer
gagctcaagggctggctggacgatgagctca	Protospacer
 ** ***.****************  *  **

99. spacer 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 7, identity: 0.774

gcgacggtgaaggcgaagcgccccacccagc	CRISPR spacer
ttgacggtgaaggcgaagctcgccacggcgc	Protospacer
 .***************** * ****   **

100. spacer 16.8|3408827|32|NZ_CP009802|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

caggtcaggggctggctggacgatccggacac	CRISPR spacer
ctgatccccggctgggtggacgagccggacac	Protospacer
* *.**   ****** ******* ********

101. spacer 16.8|3408827|32|NZ_CP009802|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 7, identity: 0.781

caggtcaggggctggctggacgatc----cggacac	CRISPR spacer
ccggtcagcggctggctggccgatcgcttcgg----	Protospacer
* ****** ********** *****    ***    

102. spacer 16.9|3408888|32|NZ_CP009802|CRT matches to MH673671 (Thermus phage phiKo, complete genome) position: , mismatch: 7, identity: 0.781

cctcacggccaccgctcggcttc-acgatgcgc	CRISPR spacer
ccacacggccacccctcggcttctcccttgtg-	Protospacer
** ********** *********  *  **.* 

103. spacer 16.13|3408827|33|NZ_CP009802|PILER-CR matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 7, identity: 0.788

caggtcaggggctggctggacgatccggacacg	CRISPR spacer
ctgatccccggctgggtggacgagccggacacg	Protospacer
* *.**   ****** ******* *********

104. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.774

ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
gcgccacgaccagggcgatcacgtagaaggg	Protospacer
 *. *.*********.******** ***** 

105. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774

ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
gcacccgcacccgggtgatcacgccgaaggt	Protospacer
 ** *   *** ***********.*******

106. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP008890 (Dermacoccus nishinomiyaensis strain M25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
gcgacgggaccagggtgatcgcgtcgcggat	Protospacer
 *.*** *************.***** .*.*

107. spacer 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ttgaccgggtgccggtaccggcccgcgtcgtca	CRISPR spacer
tcgacgggatgccggtaccggcccgcgtcacgg	Protospacer
*.*** **.********************.. .

108. spacer 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 7, identity: 0.788

ttgaccgggtgccggtaccggcccgcgtcgtca	CRISPR spacer
cgaaccgggtggcggtagcggcccgcgtcgact	Protospacer
. .******** ***** ************ * 

109. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.765

gcgtc-ggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
-cgtcgggcggggcggcgggcggcgggatccggtg	Protospacer
 **** *********  ************* . . 

110. spacer 4.1|2090117|29|NZ_CP009802|PILER-CR matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 8, identity: 0.724

ggccaaggcccccgaggcgaagccggctg	CRISPR spacer
attgaaggccgccgaggcgaagccggtaa	Protospacer
. . ****** ***************. .

111. spacer 4.1|2090117|29|NZ_CP009802|PILER-CR matches to NZ_CP011000 (Sinorhizobium meliloti strain USDA1963 plasmid pHRB800, complete sequence) position: , mismatch: 8, identity: 0.724

ggccaaggcccccgaggcgaagccggctg	CRISPR spacer
attgaaggccgccgaggcgaagccggtaa	Protospacer
. . ****** ***************. .

112. spacer 4.1|2090117|29|NZ_CP009802|PILER-CR matches to NZ_CP021832 (Sinorhizobium meliloti strain HM006 plasmid accessoryA, complete sequence) position: , mismatch: 8, identity: 0.724

ggccaaggcccccgaggcgaagccggctg	CRISPR spacer
attgaaggccgccgaggcgaagccggtaa	Protospacer
. . ****** ***************. .

113. spacer 12.3|2986741|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aacttccggctggcgctagccgaagctcgcc	CRISPR spacer
cgcttccggctgccgctggccgaagaccgat	Protospacer
 .********** ****.******* .** .

114. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 8, identity: 0.742

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cggcgccgtcgctggcgcggtcctcgtcgcc	Protospacer
.* .* . **** ************ *****

115. spacer 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder matches to MT310853 (Microbacterium phage AvGardian, complete genome) position: , mismatch: 8, identity: 0.758

cgaaagacggcctcaagcgccgcccgggctagg	CRISPR spacer
cgcccgacggcctcatgcgccggccgggcgggt	Protospacer
**   ********** ****** ****** .* 

116. spacer 16.3|3408827|31|NZ_CP009802|CRISPRCasFinder matches to MK376956 (Gordonia phage WilliamBoone, complete genome) position: , mismatch: 8, identity: 0.742

caggtcaggggctggctggacgatccggaca	CRISPR spacer
atggtcaggcgctggctggacaatcccaagg	Protospacer
  ******* ***********.**** .* .

117. spacer 16.3|3408827|31|NZ_CP009802|CRISPRCasFinder matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 8, identity: 0.742

caggtcaggggctggctggacgatccggaca	CRISPR spacer
ccggtcagcggctggctggccgatcgcttcg	Protospacer
* ****** ********** *****    *.

118. spacer 16.4|3408888|31|NZ_CP009802|CRISPRCasFinder matches to MH673671 (Thermus phage phiKo, complete genome) position: , mismatch: 8, identity: 0.742

cctcacggccaccgctcggcttcacgatgcg	CRISPR spacer
ccacacggccacccctcggcttctcccttgt	Protospacer
** ********** ********* *  *   

119. spacer 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.742

gcgacggtgaaggcgaagcgccccacccagc	CRISPR spacer
gtgacggtgaaggcgaagcgcaccggcacat	Protospacer
*.******************* **. *  ..

120. spacer 16.7|3408766|32|NZ_CP009802|CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.75

ggggagggcaaccccccgagcggcaccccggc	CRISPR spacer
tcgccggtaaaccacccgaacggcaccccggc	Protospacer
  *  **  **** *****.************

121. spacer 16.8|3408827|32|NZ_CP009802|CRT matches to NC_015459 (Pusillimonas sp. T7-7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

caggtcaggggctggctggacgatccggacac	CRISPR spacer
gaggtcaagggctggatggacgatcgcagcaa	Protospacer
 ******.******* *********  ..** 

122. spacer 16.8|3408827|32|NZ_CP009802|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75

caggtcaggggctggctggacgatccggacac	CRISPR spacer
gagctcaagggctggctggacgatgagctcaa	Protospacer
 ** ***.****************  *  ** 

123. spacer 16.8|3408827|32|NZ_CP009802|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75

caggtcaggggctggctggacgatccggacac	CRISPR spacer
gcgttgaatggctggctggtcgatccggtcac	Protospacer
  * * *. ********** ******** ***

124. spacer 16.8|3408827|32|NZ_CP009802|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75

caggtcaggggctggctggacgatccggacac	CRISPR spacer
gcgttgaacggctggctggtcgatccggtcac	Protospacer
  * * *. ********** ******** ***

125. spacer 16.9|3408888|32|NZ_CP009802|CRT matches to NZ_CP049321 (Caballeronia sp. SBC2 plasmid pSBC2-5, complete sequence) position: , mismatch: 8, identity: 0.75

----cctcacggccaccgctcggcttcacgatgcgc	CRISPR spacer
tgagcgt----gacaccgcttggcgtcacgatgcgc	Protospacer
    * *    * *******.*** ***********

126. spacer 16.10|3408949|32|NZ_CP009802|CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75

gcgacggtgaaggcgaagcgccccacccagcg	CRISPR spacer
ttgacggtgaaggcgaagctcgccacggcgcc	Protospacer
 .***************** * ****   ** 

127. spacer 16.13|3408827|33|NZ_CP009802|PILER-CR matches to NC_015459 (Pusillimonas sp. T7-7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

caggtcaggggctggctggacgatccggacacg	CRISPR spacer
gaggtcaagggctggatggacgatcgcagcaag	Protospacer
 ******.******* *********  ..** *

128. spacer 16.13|3408827|33|NZ_CP009802|PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.758

caggtcaggggctggctggacgatccggacacg	CRISPR spacer
gcgttgaacggctggctggtcgatccggtcacg	Protospacer
  * * *. ********** ******** ****

129. spacer 16.14|3408888|33|NZ_CP009802|PILER-CR matches to NZ_CP049321 (Caballeronia sp. SBC2 plasmid pSBC2-5, complete sequence) position: , mismatch: 8, identity: 0.758

----cctcacggccaccgctcggcttcacgatgcgcg	CRISPR spacer
tgagcgt----gacaccgcttggcgtcacgatgcgcg	Protospacer
    * *    * *******.*** ************

130. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
tgcgcacgaccagggtgaacacctcgaagct	Protospacer
.  .*.************ *** ****** *

131. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.742

ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
gaaactcgaccagggtgatgacgtccgacgg	Protospacer
  *** ************* ***** .* * 

132. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.742

ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
gaaactcgaccagggtgatgacgtccgacgg	Protospacer
  *** ************* ***** .* * 

133. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.742

ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
gaaactcgaccagggtgatgacgtccgacgg	Protospacer
  *** ************* ***** .* * 

134. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to AJ630128 (Bacteriophage S-PM2 complete genome) position: , mismatch: 8, identity: 0.742

-ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
atttacat-accatggtgatcacttcgaaggt	Protospacer
 .. **.. **** ********* ********

135. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NC_006820 (Synechococcus phage S-PM2, complete genome) position: , mismatch: 8, identity: 0.742

-ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
atttacat-accatggtgatcacttcgaaggt	Protospacer
 .. **.. **** ********* ********

136. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to LN828717 (Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome) position: , mismatch: 8, identity: 0.742

-ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
atttacat-accatggtgatcacttcgaaggt	Protospacer
 .. **.. **** ********* ********

137. spacer 27.3|4631040|31|NZ_CP009802|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.742

acaaggtccggaacggcgtcaagatgaagca	CRISPR spacer
gtgacggccggaacggcgccaggatgaagcg	Protospacer
...* * ***********.**.********.

138. spacer 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder matches to NC_010905 (Amycolatopsis benzoatilytica strain DSM 43387 plasmid pA387, complete sequence) position: , mismatch: 8, identity: 0.758

ttgaccgggtgccggtaccggcccgcgtcgtca	CRISPR spacer
tcctgcggttgccggtaccggtccgcgtcggcg	Protospacer
*.   *** ************.******** *.

139. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
gcggcggccgggcgcggggcggcggaccaagtcg	Protospacer
*** **** ****************. . ..** 

140. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
gcgtcggggtggcgcggggcggcggccaggacag	Protospacer
******* * ***************    **.  

141. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtcggcggggcgcggggcggcgggatcgatcc---	CRISPR spacer
tcgtcggcgcggcgcggcgcggcgg---cggctcctg	Protospacer
 ******** ******* *******   **...*   

142. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
gcgagcgcggtgcgcagggcggcgggatcgccgg	Protospacer
***   **** ****.************** .  

143. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

144. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

145. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

146. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

147. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

148. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

149. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

150. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

151. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

152. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

153. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

154. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

155. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

156. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

157. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

158. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

159. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

160. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

161. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

162. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

163. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

164. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

165. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

166. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

167. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

168. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

169. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

170. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccccaggcaca	Protospacer
 ** ************** ********** *... **.

171. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

172. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

173. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

174. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

175. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

176. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

177. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

178. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

179. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

180. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

181. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

182. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

183. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

184. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

185. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

186. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

187. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

188. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

189. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

190. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

191. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

192. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

193. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

194. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

195. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

196. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

197. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

198. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

199. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

200. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgcccccaggcacagc	Protospacer
 ** ************** **********. * * *  

201. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgccccaggcacagcg	Protospacer
 ** ************** ********* *  * ..**

202. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.763

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cgctggcgccggccgccacggccgccccaggcacagcg	Protospacer
 ** ************** ********* *  * ..**

203. spacer 12.3|2986741|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP026927 (Agrobacterium tumefaciens strain 1D1609 plasmid pAt1D1609a, complete sequence) position: , mismatch: 9, identity: 0.71

aacttccggctggcgctagccgaagctcgcc	CRISPR spacer
ttggcccggctggccatagccgaagctcgaa	Protospacer
    .*********  *************  

204. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 9, identity: 0.71

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
catcgccgacgcgggcgccgtcctcttcgcc	Protospacer
....* .  ********* ************

205. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
ggacaccgtcgcgggcacggtccgcttcgcc	Protospacer
 * .. . ********.****** *******

206. spacer 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 9, identity: 0.727

cgaaagacggcctcaagcgccgcccgggctagg	CRISPR spacer
taggcgacggcctccagcgccgcgcgggcgatg	Protospacer
.... ********* ******** ***** * *

207. spacer 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder matches to MH045568 (Microbacterium phage Kieran, complete genome) position: , mismatch: 9, identity: 0.727

cgaaagacggcctcaagcgccgcccgggctagg	CRISPR spacer
ccgccgacggcctcatgcgccggccgggcgggt	Protospacer
* .  ********** ****** ****** .* 

208. spacer 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder matches to MN062717 (Microbacterium phage Sharkboy, complete genome) position: , mismatch: 9, identity: 0.727

cgaaagacggcctcaagcgccgcccgggctagg	CRISPR spacer
ccgccgacggcctcatgcgccggccgggcgggt	Protospacer
* .  ********** ****** ****** .* 

209. spacer 15.2|3141425|33|NZ_CP009802|CRISPRCasFinder matches to NC_042099 (Microbacterium phage Dismas, complete genome) position: , mismatch: 9, identity: 0.727

cgaaagacggcctcaagcgccgcccgggctagg	CRISPR spacer
ccgccgacggcctcatgcgccggccgggcgggt	Protospacer
* .  ********** ****** ****** .* 

210. spacer 16.1|3408705|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.71

gcgctgatgggcgctcccgagcccgtccttg	CRISPR spacer
aatctgatgggcgcggccgagcccgtcgcaa	Protospacer
.  ***********  *********** . .

211. spacer 16.4|3408888|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 9, identity: 0.71

cctcacggccaccgctcggcttcacgatgcg	CRISPR spacer
cgggacggccaccgcccggattcacgaaata	Protospacer
*   ***********.*** ******* ...

212. spacer 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

gcgacggtgaaggcgaagcgccccacccagc	CRISPR spacer
gcgacgttgaaggcgaagcgcaccgagagct	Protospacer
****** ************** **.   . .

213. spacer 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 9, identity: 0.71

gcgacggtgaaggcgaagcgccccacccagc	CRISPR spacer
tcgacgctgaaggcgaagcgcgccgtagtac	Protospacer
 ***** ************** **..   .*

214. spacer 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 9, identity: 0.71

gcgacggtgaaggcgaagcgccccacccagc	CRISPR spacer
tcgacgctgaaggcgaagcgcgccgtagtac	Protospacer
 ***** ************** **..   .*

215. spacer 16.5|3408949|31|NZ_CP009802|CRISPRCasFinder matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 9, identity: 0.71

gcgacggtgaaggcgaagcgccccacccagc	CRISPR spacer
tcgacgctgaaggcgaagcgcgccgtagtac	Protospacer
 ***** ************** **..   .*

216. spacer 16.7|3408766|32|NZ_CP009802|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.719

ggggagggcaaccccccgagcggcaccccggc	CRISPR spacer
tcaccggtaaaccacccgaacggcaccccggc	Protospacer
  .  **  **** *****.************

217. spacer 16.8|3408827|32|NZ_CP009802|CRT matches to MK376956 (Gordonia phage WilliamBoone, complete genome) position: , mismatch: 9, identity: 0.719

caggtcaggggctggctggacgatccggacac	CRISPR spacer
atggtcaggcgctggctggacaatcccaaggg	Protospacer
  ******* ***********.**** .* . 

218. spacer 27.2|4630979|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

ccaacgcgaccagggtgatcacgtcgaaggt	CRISPR spacer
agagcgcgaccaggtcgatcacgtcgagacc	Protospacer
  *.********** .***********.. .

219. spacer 31.1|5600031|33|NZ_CP009802|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

ttgaccgggtgccggtaccggcccgcgtcgtca	CRISPR spacer
ctgaccgggggccggtcccggcccggagccgcg	Protospacer
.******** ****** ******** . *  *.

220. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NZ_CP025805 (Sulfitobacter sp. SK012 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
tgaaggtttgggcgcggggctgcaggatcgatcc	Protospacer
  .  * . *********** **.**********

221. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NZ_CP025806 (Sulfitobacter sp. SK012 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
tgaaggtttgggcgcggggctgcaggatcgatcc	Protospacer
  .  * . *********** **.**********

222. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 10, identity: 0.706

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
gcgacggcggggcgctgggcggcgaggcgggcga	Protospacer
*** *********** ********.*.. *..  

223. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 10, identity: 0.706

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
gcgacggcggggcgctgggcggcgaggcgggcga	Protospacer
*** *********** ********.*.. *..  

224. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
gcgtcggcgtggcgtggggcggcgtcacgctcct	Protospacer
********* ****.*********  *.   .*.

225. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
ttttgaaggtggcgcggggcgtcgggattgatcc	Protospacer
 . * .. * *********** ******.*****

226. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to KX522649 (Mycobacterium phage Bircsak, complete genome) position: , mismatch: 10, identity: 0.706

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
tagtcggcggggctcgggccggcgggttggccga	Protospacer
  *********** **** ******* * * .  

227. spacer 2.2|1435934|34|NZ_CP009802|CRISPRCasFinder matches to KX522943 (Mycobacterium phage Gompeii16, complete genome) position: , mismatch: 10, identity: 0.706

gcgtcggcggggcgcggggcggcgggatcgatcc	CRISPR spacer
tagtcggcggggctcgggccggcgggttggccga	Protospacer
  *********** **** ******* * * .  

228. spacer 4.2|2090180|38|NZ_CP009802|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.737

agcaggcgccggccgccaaggccgcccccgcgaagacg	CRISPR spacer
cggccctgccggccgccgcggccgcccccgcgaagtct	Protospacer
 *    .**********. **************** * 

229. spacer 9.2|2604254|37|NZ_CP009802|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 10, identity: 0.73

taacttctagcccggccggcgtttgaggccacagttc	CRISPR spacer
acgtagccaacccggccggcgtttgacgccgcagttc	Protospacer
  ..  *.*.**************** ***.******

230. spacer 9.2|2604254|37|NZ_CP009802|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 10, identity: 0.73

taacttctagcccggccggcgtttgaggccacagttc	CRISPR spacer
acgtagccaacccggccggcgtttgacgccgcagttc	Protospacer
  ..  *.*.**************** ***.******

231. spacer 12.3|2986741|31|NZ_CP009802|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 10, identity: 0.677

aacttccggctggcgctagccgaagctcgcc	CRISPR spacer
ggtgaagggctggcgctggccgaaggtcgcg	Protospacer
...    **********.******* **** 

232. spacer 12.4|2986802|31|NZ_CP009802|CRISPRCasFinder matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 10, identity: 0.677

tgctgatctcgcgggcgcggtcctcttcgcc	CRISPR spacer
cttcaatcacgcgggcgcggtcctcttgcgg	Protospacer
. ...*** ******************    

233. spacer 16.6|3408705|32|NZ_CP009802|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.688

gcgctgatgggcgctcccgagcccgtccttgt	CRISPR spacer
aatctgatgggcgcggccgagcccgtcgcaag	Protospacer
.  ***********  *********** . . 

234. spacer 16.9|3408888|32|NZ_CP009802|CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 10, identity: 0.688

cctcacggccaccgctcggcttcacgatgcgc	CRISPR spacer
cgggacggccaccgcccggattcacgaaatag	Protospacer
*   ***********.*** ******* ... 

235. spacer 16.10|3408949|32|NZ_CP009802|CRT matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 10, identity: 0.688

gcgacggtgaaggcgaagcgccccacccagcg	CRISPR spacer
tcgacgctgaaggcgaagcgcgccgtagtacc	Protospacer
 ***** ************** **..   .* 

236. spacer 16.10|3408949|32|NZ_CP009802|CRT matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 10, identity: 0.688

gcgacggtgaaggcgaagcgccccacccagcg	CRISPR spacer
tcgacgctgaaggcgaagcgcgccgtagtacc	Protospacer
 ***** ************** **..   .* 

237. spacer 16.10|3408949|32|NZ_CP009802|CRT matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 10, identity: 0.688

gcgacggtgaaggcgaagcgccccacccagcg	CRISPR spacer
tcgacgctgaaggcgaagcgcgccgtagtacc	Protospacer
 ***** ************** **..   .* 

238. spacer 16.13|3408827|33|NZ_CP009802|PILER-CR matches to MK376956 (Gordonia phage WilliamBoone, complete genome) position: , mismatch: 10, identity: 0.697

caggtcaggggctggctggacgatccggacacg	CRISPR spacer
atggtcaggcgctggctggacaatcccaaggga	Protospacer
  ******* ***********.**** .* . .

239. spacer 18.1|3562895|35|NZ_CP009802|PILER-CR matches to MH590600 (Microbacterium phage KaiHaiDragon, complete genome) position: , mismatch: 10, identity: 0.714

ccctcgtggtgtttcacgtgaaacgtccgtcggag	CRISPR spacer
cgactctgatgtttcacgtgaaacatccgtcgacc	Protospacer
*  .. **.***************.*******.  

240. spacer 18.1|3562895|35|NZ_CP009802|PILER-CR matches to MK977698 (Microbacterium phage Busephilis, complete genome) position: , mismatch: 10, identity: 0.714

ccctcgtggtgtttcacgtgaaacgtccgtcggag	CRISPR spacer
cgactctgatgtttcacgtgaaacatccgtcgacc	Protospacer
*  .. **.***************.*******.  

241. spacer 18.1|3562895|35|NZ_CP009802|PILER-CR matches to MK875798 (Microbacterium phage Piperis, complete genome) position: , mismatch: 10, identity: 0.714

ccctcgtggtgtttcacgtgaaacgtccgtcggag	CRISPR spacer
cgactctgatgtttcacgtgaaacatccgtcgacc	Protospacer
*  .. **.***************.*******.  

242. spacer 18.1|3562895|35|NZ_CP009802|PILER-CR matches to MT818415 (Microbacterium phage Scumberland, complete genome) position: , mismatch: 10, identity: 0.714

ccctcgtggtgtttcacgtgaaacgtccgtcggag	CRISPR spacer
cgactctgatgtttcacgtgaaacatccgtcgacc	Protospacer
*  .. **.***************.*******.  

243. spacer 18.1|3562895|35|NZ_CP009802|PILER-CR matches to MN444877 (Microbacterium phage Antares, complete genome) position: , mismatch: 10, identity: 0.714

ccctcgtggtgtttcacgtgaaacgtccgtcggag	CRISPR spacer
cgactctgatgtttcacgtgaaacatccgtcgacc	Protospacer
*  .. **.***************.*******.  

244. spacer 16.11|3408705|33|NZ_CP009802|PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 11, identity: 0.667

gcgctgatgggcgctcccgagcccgtccttgtg	CRISPR spacer
aatctgatgggcgcggccgagcccgtcgcaagc	Protospacer
.  ***********  *********** . .  

245. spacer 14.3|3141209|40|NZ_CP009802|PILER-CR matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 12, identity: 0.7

gaagtgtggtgacgctcggccccaccgcgccggtcactgc	CRISPR spacer
cgcaggacgtgacgctggcccccaccgcgccggtcacgat	Protospacer
 . . *  ******** * ****************** ..

246. spacer 14.5|3141209|41|NZ_CP009802|CRISPRCasFinder matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 13, identity: 0.683

gaagtgtggtgacgctcggccccaccgcgccggtcactgct	CRISPR spacer
cgcaggacgtgacgctggcccccaccgcgccggtcacgatc	Protospacer
 . . *  ******** * ****************** ...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1674900 : 1716504 51 Streptomyces_phage(97.92%) terminase,capsid,portal NA
DBSCAN-SWA_2 2571508 : 2578524 8 Streptomyces_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage