Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 0 crisprs RT,csa3 0 0 8 0
NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 0 crisprs RT,csa3,cas3 0 0 2 0
NZ_CP023487 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 chromosome, complete genome 5 crisprs cas3,csa3,RT,DEDDh,DinG,WYL 2 2 10 0

Results visualization

1. NZ_CP023489
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 9430 8 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_2 12977 : 13232 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_3 16369 : 20654 4 Thalassomonas_phage(33.33%) NA NA
DBSCAN-SWA_4 24966 : 25788 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_5 59944 : 67643 11 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_6 75545 : 112216 31 Escherichia_phage(46.15%) transposase NA
DBSCAN-SWA_7 117744 : 118449 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_8 122697 : 123492 1 Macacine_betaherpesvirus(100.0%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023487
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023487_1 1655425-1655533 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023487_2 2216947-2217209 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023487_3 2630918-2631013 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023487_4 2730829-2730930 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023487_5 4668376-4668471 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023487_2 2.1|2217008|40|NZ_CP023487|PILER-CR 2217008-2217047 40 NZ_CP023487.1 2217311-2217350 1 0.975
NZ_CP023487_2 2.2|2217109|40|NZ_CP023487|PILER-CR 2217109-2217148 40 NZ_CP023487.1 2217311-2217350 1 0.975

1. spacer 2.1|2217008|40|NZ_CP023487|PILER-CR matches to position: 2217311-2217350, mismatch: 1, identity: 0.975

taccccgattagttcgccatcccgtaggcctgataagcga	CRISPR spacer
taccccgattagttcgccattccgtaggcctgataagcga	Protospacer
********************.*******************

2. spacer 2.2|2217109|40|NZ_CP023487|PILER-CR matches to position: 2217311-2217350, mismatch: 1, identity: 0.975

taccccgattagttcgccatcccgtaggcctgataagcga	CRISPR spacer
taccccgattagttcgccattccgtaggcctgataagcga	Protospacer
********************.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023487_5 5.1|4668406|36|NZ_CP023487|CRISPRCasFinder 4668406-4668441 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP023487_5 5.1|4668406|36|NZ_CP023487|CRISPRCasFinder 4668406-4668441 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP023487_5 5.1|4668406|36|NZ_CP023487|CRISPRCasFinder 4668406-4668441 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0
NZ_CP023487_3 3.1|2630948|36|NZ_CP023487|CRISPRCasFinder 2630948-2630983 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 1 0.972
NZ_CP023487_3 3.1|2630948|36|NZ_CP023487|CRISPRCasFinder 2630948-2630983 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 1 0.972
NZ_CP023487_3 3.1|2630948|36|NZ_CP023487|CRISPRCasFinder 2630948-2630983 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 1 0.972
NZ_CP023487_3 3.1|2630948|36|NZ_CP023487|CRISPRCasFinder 2630948-2630983 36 NZ_CP026278 Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence 8602-8637 4 0.889

1. spacer 5.1|4668406|36|NZ_CP023487|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 5.1|4668406|36|NZ_CP023487|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 5.1|4668406|36|NZ_CP023487|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

4. spacer 3.1|2630948|36|NZ_CP023487|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 1, identity: 0.972

acgcaaacccagtaaccacgctgcgtaccggcgggg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
*********************************.**

5. spacer 3.1|2630948|36|NZ_CP023487|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 1, identity: 0.972

acgcaaacccagtaaccacgctgcgtaccggcgggg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
*********************************.**

6. spacer 3.1|2630948|36|NZ_CP023487|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.972

acgcaaacccagtaaccacgctgcgtaccggcgggg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
*********************************.**

7. spacer 3.1|2630948|36|NZ_CP023487|CRISPRCasFinder matches to NZ_CP026278 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence) position: , mismatch: 4, identity: 0.889

acgcaaacccagtaaccacgctgcgtaccggcgggg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtacaagtgagg	Protospacer
**************************** .*.*.**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1800116 : 1817728 27 Salmonella_phage(30.43%) integrase attL 1792519:1792534|attR 1823548:1823563
DBSCAN-SWA_2 2189574 : 2196479 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_3 2237713 : 2246092 8 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_4 2371232 : 2509405 154 Enterobacteria_phage(22.58%) head,plate,holin,portal,capsid,tRNA,transposase,tail,protease,integrase,terminase attL 2428307:2428325|attR 2466055:2466073
DBSCAN-SWA_5 2615186 : 2697862 95 Klebsiella_phage(20.0%) head,plate,holin,portal,capsid,tRNA,tail,protease,terminase NA
DBSCAN-SWA_6 3357695 : 3374099 12 Salmonella_phage(50.0%) transposase NA
DBSCAN-SWA_7 3381858 : 3388287 7 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_8 3781436 : 3874042 99 Klebsiella_phage(40.43%) head,holin,capsid,portal,tRNA,transposase,tail,integrase,terminase attL 3772057:3772074|attR 3882309:3882326
DBSCAN-SWA_9 4148718 : 4158192 8 Brazilian_cedratvirus(16.67%) tRNA,protease NA
DBSCAN-SWA_10 4632408 : 4682706 70 Cronobacter_phage(25.93%) head,tRNA,lysis,tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP023488
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 27671 : 66335 32 Macacine_betaherpesvirus(17.65%) holin,integrase,transposase attL 36227:36243|attR 67017:67033
DBSCAN-SWA_2 105511 : 181904 66 Escherichia_phage(25.0%) protease,bacteriocin,integrase,transposase attL 124013:124072|attR 137907:138727
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage