Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009431 Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence 0 crisprs DEDDh,RT 0 0 1 0
NZ_CP009430 Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP009429 Sphingopyxis macrogoltabida strain 203 chromosome, complete genome 1 crisprs csa3,WYL,c2c9_V-U4,DinG,DEDDh 0 1 13 0

Results visualization

1. NZ_CP009430
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 64729 : 127384 49 Klosneuvirus(30.0%) holin,transposase NA
DBSCAN-SWA_2 388978 : 403746 14 Corynebacterium_phage(16.67%) transposase,integrase attL 395060:395080|attR 403835:403855
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009431
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6145 : 69233 50 Corynebacterium_phage(18.18%) transposase,protease,integrase attL 9941:9955|attR 72182:72196
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009429
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009429_1 4923835-4923918 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009429_1 1.1|4923862|30|NZ_CP009429|CRISPRCasFinder 4923862-4923891 30 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 216264-216293 8 0.733

1. spacer 1.1|4923862|30|NZ_CP009429|CRISPRCasFinder matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.733

tgacctttagtggccggaacggccacgggc	CRISPR spacer
cctcttggtgtggcctgaacggccacgggc	Protospacer
.  *.*   ****** **************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 156280 : 216817 62 Caulobacter_phage(15.79%) tail,capsid,tRNA,head,protease,portal,transposase NA
DBSCAN-SWA_2 810955 : 856217 36 Stenotrophomonas_phage(12.5%) transposase,integrase attL 852930:852989|attR 857253:857345
DBSCAN-SWA_3 1000515 : 1050958 49 Mycobacterium_phage(25.0%) tRNA,integrase attL 1018288:1018304|attR 1056126:1056142
DBSCAN-SWA_4 1187830 : 1196225 9 uncultured_Caudovirales_phage(83.33%) NA NA
DBSCAN-SWA_5 1384808 : 1397165 17 Sinorhizobium_phage(63.64%) terminase NA
DBSCAN-SWA_6 2323570 : 2387553 54 uncultured_Caudovirales_phage(33.33%) tail,transposase,integrase,plate attL 2320361:2320376|attR 2328912:2328927
DBSCAN-SWA_7 2818476 : 2886369 56 Aureococcus_anophage(18.75%) transposase,integrase attL 2870177:2870192|attR 2888182:2888197
DBSCAN-SWA_8 2893507 : 2925938 46 Pseudomonas_phage(22.22%) tail,capsid,integrase,terminase,head,protease,portal attL 2889367:2889382|attR 2930432:2930447
DBSCAN-SWA_9 3014081 : 3021765 12 Ochrobactrum_phage(33.33%) transposase,integrase attL 3011735:3011752|attR 3025907:3025924
DBSCAN-SWA_10 4164730 : 4199297 28 Mycobacterium_phage(25.0%) transposase,integrase attL 4157119:4157133|attR 4199712:4199726
DBSCAN-SWA_11 4208043 : 4219811 14 Bordetella_phage(25.0%) terminase NA
DBSCAN-SWA_12 4361172 : 4389937 25 Escherichia_phage(28.57%) integrase attL 4386353:4386412|attR 4389998:4390086
DBSCAN-SWA_13 4464494 : 4520091 46 Streptococcus_phage(16.67%) tRNA,transposase,integrase,protease attL 4458992:4459009|attR 4497438:4497455
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage