Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010870 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP010872 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6003, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP010871 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP010869 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 chromosome, complete genome 1 crisprs cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,WYL 0 5 2 0

Results visualization

1. NZ_CP010870
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 51438 : 100996 34 Enterobacteria_phage(27.27%) transposase,integrase attL 48016:48031|attR 62219:62234
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010871
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 124399 : 154644 31 uncultured_Mediterranean_phage(14.29%) integrase,transposase,holin attL 128409:128424|attR 135116:135131
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP010869
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010869_1 578322-578899 TypeI-E NA
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 8699-8730 5 0.844
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP046575 Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence 18555-18586 5 0.844
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 319244-319275 6 0.812
NZ_CP010869_1 1.4|578534|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578534-578565 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 723933-723964 7 0.781
NZ_CP010869_1 1.4|578534|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578534-578565 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 452345-452376 7 0.781
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 12807-12838 8 0.75
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP021915 Sagittula sp. P11 plasmid unnamed2, complete sequence 81709-81740 8 0.75
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP010856 Marinovum algicola DG 898 plasmid pMaD1, complete sequence 88457-88488 8 0.75
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP045373 Sulfitobacter sp. THAF37 plasmid pTHAF37_a, complete sequence 66853-66884 8 0.75
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP018081 Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence 183254-183285 8 0.75
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 396154-396185 8 0.75
NZ_CP010869_1 1.9|578839|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578839-578870 32 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 541152-541183 8 0.75
NZ_CP010869_1 1.9|578839|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578839-578870 32 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 1247-1278 8 0.75
NZ_CP010869_1 1.5|578595|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578595-578626 32 NZ_CP051543 Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence 105469-105500 9 0.719
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP015236 Rhodococcus fascians D188 plasmid pFiD188, complete sequence 73122-73153 9 0.719
NZ_CP010869_1 1.2|578412|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578412-578443 32 NZ_CP017783 Rhodobacter sp. LPB0142 plasmid pEJ02, complete sequence 1975-2006 10 0.688
NZ_CP010869_1 1.2|578412|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578412-578443 32 NZ_CP017784 Rhodobacter sp. LPB0142 plasmid pEJ03, complete sequence 3047-3078 10 0.688
NZ_CP010869_1 1.2|578412|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578412-578443 32 NZ_CP028921 Gemmobacter sp. HYN0069 plasmid unnamed3, complete sequence 17181-17212 10 0.688
NZ_CP010869_1 1.4|578534|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578534-578565 32 MT723933 Streptomyces phage Keanu, complete genome 5646-5677 10 0.688
NZ_CP010869_1 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT 578778-578809 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1211804-1211835 10 0.688

1. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 5, identity: 0.844

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
caattcgaagccaagggtgccgccgaggtggc	Protospacer
*** **********************  .**.

2. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 5, identity: 0.844

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
caattcgaagccaagggtgccgccgaggtggc	Protospacer
*** **********************  .**.

3. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 6, identity: 0.812

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
caattcgaagccgagggtgccgccgaggtggc	Protospacer
*** ********.*************  .**.

4. spacer 1.4|578534|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

tcgatatagcccgtcacgcccgttgcggcatt	CRISPR spacer
ccgatatcgctcgtcacgcccgttgccgtttc	Protospacer
.****** **.*************** *. *.

5. spacer 1.4|578534|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 7, identity: 0.781

tcgatatagcccgtcacgcccgttgcggcatt	CRISPR spacer
ccgatatcgctcgtcacgcccgttgccgtttc	Protospacer
.****** **.*************** *. *.

6. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 8, identity: 0.75

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
gacgtcgaagcgaaggatgccgccgacgagat	Protospacer
 * .******* ****.**********  *.*

7. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021915 (Sagittula sp. P11 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
aagatcgaggccaaggctgccgccgaagccgc	Protospacer
 *.*****.******* *********  * *.

8. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010856 (Marinovum algicola DG 898 plasmid pMaD1, complete sequence) position: , mismatch: 8, identity: 0.75

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
aagatcgaggccaaggctgccgccgaagccgc	Protospacer
 *.*****.******* *********  * *.

9. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045373 (Sulfitobacter sp. THAF37 plasmid pTHAF37_a, complete sequence) position: , mismatch: 8, identity: 0.75

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
aagatcgaggccaaggctgccgccgaagccgc	Protospacer
 *.*****.******* *********  * *.

10. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018081 (Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
aagatcgaggccaaggctgccgccgaagccgc	Protospacer
 *.*****.******* *********  * *.

11. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
aagatcgaagccaaggaggccgccgaagctga	Protospacer
 *.*************. ********  * * 

12. spacer 1.9|578839|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gatttcaacccgctggatgactggtacggctt	CRISPR spacer
gatttcaactcgctggattactggctggatct	Protospacer
*********.******** *****.  *...*

13. spacer 1.9|578839|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.75

gatttcaacccgctggatgactggt---acggctt	CRISPR spacer
actttcaacctgctgggtgactggtcgaaggg---	Protospacer
. ********.*****.********   * **   

14. spacer 1.5|578595|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051543 (Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence) position: , mismatch: 9, identity: 0.719

cagctggctatactgcgcgagacggatccggt	CRISPR spacer
gcgctggccatgctgcgcgagacggccgccgc	Protospacer
  ******.**.************* . * *.

15. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015236 (Rhodococcus fascians D188 plasmid pFiD188, complete sequence) position: , mismatch: 9, identity: 0.719

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
gcggtcttcgccaatggtgccgccggcccggt	Protospacer
  ..**   ***** **********.******

16. spacer 1.2|578412|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017783 (Rhodobacter sp. LPB0142 plasmid pEJ02, complete sequence) position: , mismatch: 10, identity: 0.688

aagggttacctgatcggctcgaacagtcagat	CRISPR spacer
cgcttctgcctgatcgtctcgaacaggcagac	Protospacer
 .   .*.******** ********* ****.

17. spacer 1.2|578412|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017784 (Rhodobacter sp. LPB0142 plasmid pEJ03, complete sequence) position: , mismatch: 10, identity: 0.688

aagggttacctgatcggctcgaacagtcagat	CRISPR spacer
cgcttctgcctgatcgtctcgaacaggcagac	Protospacer
 .   .*.******** ********* ****.

18. spacer 1.2|578412|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028921 (Gemmobacter sp. HYN0069 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

aagggttacctgatcggctcgaacagtcagat	CRISPR spacer
cgcttctgcctgatcgtctcgaacaggcagac	Protospacer
 .   .*.******** ********* ****.

19. spacer 1.4|578534|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to MT723933 (Streptomyces phage Keanu, complete genome) position: , mismatch: 10, identity: 0.688

tcgatatagcccgtcacgcccgttgcggcatt	CRISPR spacer
gggcagcagcccgtcacccccggtgcggcacc	Protospacer
  *  ..********** **** *******..

20. spacer 1.8|578778|32|NZ_CP010869|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 10, identity: 0.688

caaatcgaagccaagggtgccgccgacccggt	CRISPR spacer
gcgatcgaagccgatggtgccgccgacagcaa	Protospacer
  .*********.* ************   . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 665319 : 708518 47 Streptococcus_phage(16.67%) holin,protease,tRNA NA
DBSCAN-SWA_2 1655616 : 1668521 16 Paracoccus_phage(33.33%) portal,tail,protease,capsid,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage