Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012403 Azospirillum thiophilum strain BV-S chromosome 3, complete sequence 2 crisprs NA 0 6 1 0
NZ_CP012404 Azospirillum thiophilum strain BV-S chromosome 4, complete sequence 1 crisprs csa3,DEDDh 0 0 1 0
NZ_CP012407 Azospirillum thiophilum strain BV-S chromosome 7, complete sequence 2 crisprs c2c9_V-U4,cas14j 0 1 3 0
NZ_CP012408 Azospirillum thiophilum strain BV-S chromosome 8, complete sequence 0 crisprs PD-DExK 0 0 0 0
NZ_CP012405 Azospirillum thiophilum strain BV-S chromosome 5, complete sequence 1 crisprs csa3 0 1 44 0
NZ_CP012401 Azospirillum thiophilum strain BV-S chromosome 1, complete sequence 2 crisprs csa3,DEDDh,WYL,DinG,casR,RT,cas3 0 0 3 0
NZ_CP012402 Azospirillum thiophilum strain BV-S chromosome 2, complete sequence 1 crisprs csa3 0 0 0 0
NZ_CP012406 Azospirillum thiophilum strain BV-S chromosome 6, complete sequence 1 crisprs WYL 0 0 3 0

Results visualization

1. NZ_CP012403
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012403_1 213915-214209 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012403_2 214320-214397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 921508-921537 2 0.933
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 194682-194711 3 0.9
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 294180-294209 4 0.867
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 192162-192191 5 0.833
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1813744-1813773 5 0.833
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1820832-1820861 5 0.833
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 2164683-2164712 5 0.833
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 194736-194765 5 0.833
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 2237345-2237374 5 0.833
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1002282-1002311 5 0.833
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 377274-377303 5 0.833
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NC_014030 Salinibacter ruber M8 plasmid pSR61, complete sequence 6831-6860 5 0.833
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 76471-76500 5 0.833
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 76579-76608 5 0.833
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 CP003956 Rhodococcus opacus PD630 plasmid 7, complete sequence 35904-35933 5 0.833
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 46972-47001 5 0.833
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 413215-413244 6 0.8
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 314982-315011 6 0.8
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 148158-148187 6 0.8
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NC_007100 Pseudomonas aeruginosa plasmid Rms149, complete sequence 29721-29750 6 0.8
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 148212-148241 6 0.8
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NC_018580 Gordonia sp. KTR9 plasmid pGKT2, complete sequence 59621-59650 6 0.8
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 560380-560409 6 0.8
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 592756-592785 6 0.8
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NC_048047 Caulobacter phage CcrBL9, complete genome 252510-252539 6 0.8
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 227457-227486 6 0.8
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 112928-112957 6 0.8
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1644842-1644871 6 0.8
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1621304-1621333 6 0.8
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 63424-63453 6 0.8
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 194513-194542 6 0.8
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 380841-380870 6 0.8
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1409056-1409085 6 0.8
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 152032-152061 7 0.767
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 336990-337019 7 0.767
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 120476-120505 7 0.767
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 449680-449709 7 0.767
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_CP006993 Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence 92696-92725 7 0.767
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 MK580972 Stenotrophomonas phage YB07, complete genome 103028-103057 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 294288-294317 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 713608-713637 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 352905-352934 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 695702-695731 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 693188-693217 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 691376-691405 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 115245-115274 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 228462-228491 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 247792-247821 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 292446-292475 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1590464-1590493 7 0.767
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 37571-37600 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NZ_CP035502 Sphingosinicella sp. BN140058 plasmid p1, complete sequence 191107-191136 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NC_009426 Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence 183649-183678 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NC_002033 Novosphingobium aromaticivorans plasmid pNL1, complete sequence 127037-127066 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 172460-172489 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 GU911304 Burkholderia phage KL3, complete genome 6626-6655 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 128643-128672 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 143210-143239 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 132458-132487 7 0.767
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NZ_CP033228 Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence 152666-152695 7 0.767
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 18372-18401 7 0.767
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP027406 Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed1, complete sequence 4816-4845 8 0.733
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 81624-81653 8 0.733
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NC_008386 Roseobacter denitrificans OCh 114 plasmid pTB1, complete sequence 58524-58553 8 0.733
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 580763-580792 8 0.733
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2350177-2350206 8 0.733
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_CP007256 Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence 19218-19247 8 0.733
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 137332-137361 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 299949-299978 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 12750-12779 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 72677-72706 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 392569-392598 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 23236-23265 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 710205-710234 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 774609-774638 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 444387-444416 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP031159 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence 16970-16999 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 1180429-1180458 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP007257 Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence 147764-147793 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1086065-1086094 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1186014-1186043 8 0.733
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 190263-190292 8 0.733
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 1081708-1081737 8 0.733
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NZ_CP024426 Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence 35246-35275 8 0.733
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NZ_CP020445 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence 149222-149251 8 0.733
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 161749-161778 8 0.733
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NC_023142 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence 18169-18198 8 0.733
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 18145-18174 8 0.733
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 258311-258340 8 0.733
NZ_CP012403_2 2.1|214344|30|NZ_CP012403|CRISPRCasFinder 214344-214373 30 NZ_CP010593 Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence 18166-18195 8 0.733
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 634309-634338 9 0.7
NZ_CP012403_1 1.1|213939|30|NZ_CP012403|CRISPRCasFinder 213939-213968 30 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 93885-93914 9 0.7
NZ_CP012403_1 1.2|213993|30|NZ_CP012403|CRISPRCasFinder 213993-214022 30 NZ_CP024445 Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence 39973-40002 9 0.7
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_HG938357 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141b, complete sequence 14577-14606 9 0.7
NZ_CP012403_1 1.3|214047|30|NZ_CP012403|CRISPRCasFinder 214047-214076 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 515578-515607 9 0.7
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 273319-273348 9 0.7
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 188749-188778 9 0.7
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 252757-252786 9 0.7
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 273503-273532 9 0.7
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 722750-722779 9 0.7
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 411361-411390 9 0.7
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 239500-239529 9 0.7
NZ_CP012403_1 1.4|214101|30|NZ_CP012403|CRISPRCasFinder 214101-214130 30 MN871455 UNVERIFIED: Pseudomonas phage Pa-B, complete genome 9190-9219 9 0.7
NZ_CP012403_1 1.5|214155|30|NZ_CP012403|CRISPRCasFinder 214155-214184 30 NZ_LR594692 Variovorax sp. WDL1 plasmid 4 4898-4927 9 0.7

1. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.933

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
aagcagagtgtcgtttccgttgccccccag	Protospacer
.*****.***********************

2. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.9

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
ttccagacggtcgttgccttcgtcgccgga	Protospacer
*** ** *********************.*

3. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cgacaggaagtcggcgccgtcgccacccga	Protospacer
 * ***** *************** *****

4. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
tacaagtcggtcggtgacttcgtcgccgtt	Protospacer
* *********** ** ***********  

5. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.833

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
gatcagcctgtcgttgccattaccgccggt	Protospacer
* ***** *********** ********  

6. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.833

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
gatcagcctgtcgttgccattaccgccggt	Protospacer
* ***** *********** ********  

7. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.833

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
ggtcagcgtgtcgtcgccagtaccgccgga	Protospacer
* *****.******.************* .

8. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.833

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
gatcagcacgtcgttgccggtaccgccgaa	Protospacer
* ******.*********.********* .

9. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.833

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
ggtcagcgtgtcgtcgccagtaccgccgga	Protospacer
* *****.******.************* .

10. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.833

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
ggtcagcgtgtcgttgccagtgccgccgga	Protospacer
* *****.*************.****** .

11. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 5, identity: 0.833

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
gatcagcatgtcgttgccggtgccgccatg	Protospacer
* ****************.**.*****..*

12. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NC_014030 (Salinibacter ruber M8 plasmid pSR61, complete sequence) position: , mismatch: 5, identity: 0.833

gtccaatac--gtcgtcgtgaccgccgccgaa	CRISPR spacer
--tcaatgcttgtcgtcgggaccgccgccgaa	Protospacer
  .****.*  ******* *************

13. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 5, identity: 0.833

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggacaggatgtcgtcgccgtcgcccccgaa	Protospacer
.* ********** ************* .*

14. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 5, identity: 0.833

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggacaggatgtcgtcgccgtcgcccccgaa	Protospacer
.* ********** ************* .*

15. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.833

agtca-ggatgtcggcgccgtcgccccccga	CRISPR spacer
-gtcattcatgtcggtgccgtcgcccgccga	Protospacer
 ****   *******.********** ****

16. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.833

gtccagc-acgtcgcggccggcaccaccgat	CRISPR spacer
-ctcagcaacgacgcggccagcaccaccgat	Protospacer
 ..**** *** *******.***********

17. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
atcgcgacgggcgttgccttcgtcgccgag	Protospacer
 **. * *** ******************.

18. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.8

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
atcgcgacgggcgttgccttcgtcgccgag	Protospacer
 **. * *** ******************.

19. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.8

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
gtccagaatgtcgttgccgtcgtcgccgaa	Protospacer
 ** **   ********* ***********

20. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 6, identity: 0.8

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
gaccagcgtgtcgttgcccgtaccgccgtc	Protospacer
* .****.********** *********. 

21. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.8

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
ggacagcatgtcgttgccggtgccgccatg	Protospacer
*  ***************.**.*****..*

22. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NC_018580 (Gordonia sp. KTR9 plasmid pGKT2, complete sequence) position: , mismatch: 6, identity: 0.8

---gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
ctggtc---tttgtcgtcgtcaccgccgccgaa	Protospacer
   ***   * .******** ************

23. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.8

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
ggcgactacgtcgtcctgaccgtcgccgac	Protospacer
* * * ********* ******.****** 

24. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.8

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
gacggagacgtcgtcatgaccggcgccgaa	Protospacer
* * .* ********.****** *******

25. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 6, identity: 0.8

gtccaata-cgtcgtcgtgaccgccgccgaa	CRISPR spacer
-accaccatcgtcgtcgagaccgccgccgat	Protospacer
  *** .* ******** ************ 

26. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 6, identity: 0.8

agtcaggatgtcggcgccgtcgcc----ccccga	CRISPR spacer
gttcaggatgtcggcgccgtcgccatagcc----	Protospacer
. **********************    **    

27. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.8

agtcaggatgtcggcgccgtcgcc----ccccga	CRISPR spacer
gttcaggatgtcggcgccgtcgccatagcc----	Protospacer
. **********************    **    

28. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.8

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
aaccaggatttcggcgccggcgccccccag	Protospacer
*..****** ********* ********..

29. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.8

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
aaccaggatttcggcgccggcgccccccag	Protospacer
*..****** ********* ********..

30. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
tgtcaggatgttggcgccgtcgccgcgcag	Protospacer
 **********.************ * *..

31. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.8

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggtcaggctgtcggcgccgtcgaccacggt	Protospacer
.****** ************** ** * * 

32. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.8

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggacaggctgtcggcgccgtcgccaccggt	Protospacer
.* **** **************** ** * 

33. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
caacacggtgtcgtttccgttgccgccgaa	Protospacer
 *.** ****************** ** *.

34. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 7, identity: 0.767

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
attgatcacgtcgttgccagtgccgccgct	Protospacer
..* * **.************.******* 

35. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
cgtgaccttgtcgttgccagcaccgccgct	Protospacer
  * * * ************.******** 

36. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.767

--gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
cgggcgggt--gtcgtcgtgaacgccgccgaa	Protospacer
  * * ..*  ********** **********

37. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
ggagactacgtcgtcctgaccgtcgccgac	Protospacer
*   * ********* ******.****** 

38. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP006993 (Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence) position: , mismatch: 7, identity: 0.767

gtccaa---tacgtcgtcgtgaccgccgccgaa	CRISPR spacer
---cgaggctacgtcgtcgtgaccccagccgat	Protospacer
   *.*   *************** * ***** 

39. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to MK580972 (Stenotrophomonas phage YB07, complete genome) position: , mismatch: 7, identity: 0.767

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
aacgcaaacatcgtcctgaccgccgccgaa	Protospacer
. *  * **.***** **************

40. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cttcagaatgtcgtcgccgtcgcccccttc	Protospacer
  ****.****** *************.  

41. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cttcagaatgtcggcgccgtcgccaccgtt	Protospacer
  ****.***************** **   

42. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cttcagaatgtcggcgccgtcgccgccgtt	Protospacer
  ****.***************** **   

43. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cttcagaatgtcggcgccgtcgccgccgtt	Protospacer
  ****.***************** **   

44. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cttcagaatgtcggcgccgtcgccgccgtt	Protospacer
  ****.***************** **   

45. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cttcagaatgtcggcgccgtcgccgccgtt	Protospacer
  ****.***************** **   

46. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ttccagtatgtcggcgccgtcgccgccggt	Protospacer
  .*** ***************** ** * 

47. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
atccaggatgtcgtcgccgtcgccgccgat	Protospacer
* .********** ********** ** . 

48. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cttcaggatgttggcgccgtcgccgcgcag	Protospacer
  *********.************ * *..

49. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cttcaggatgttggcgccgtcgccgcgcag	Protospacer
  *********.************ * *..

50. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
tgacagaatgtcggcgccggcgccccacac	Protospacer
 * ***.************ ****** *. 

51. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.767

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
tgggataatttcggcgccatcgccccccga	Protospacer
 *  * .** ********.***********

52. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP035502 (Sphingosinicella sp. BN140058 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
ctccagcacgtcgcggctggcacacctgcg	Protospacer
 ****************.*****  *.*  

53. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.767

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
ctcgtcgacgtcgcggcaggcaccatcgat	Protospacer
 **    ********** *******.****

54. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.767

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
ctcgtcgacgtcgcggcaggcaccatcgat	Protospacer
 **    ********** *******.****

55. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
gtcgagcacgtcgcggccggaacggcagca	Protospacer
*** **************** ** .* *  

56. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to GU911304 (Burkholderia phage KL3, complete genome) position: , mismatch: 7, identity: 0.767

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
ttccagcacgtcgcggtcggcatccgagaa	Protospacer
 ***************.*****.*   ** 

57. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 7, identity: 0.767

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
gtccaggacgtcgcggccggcggcgcctcg	Protospacer
****** **************. *.**   

58. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 7, identity: 0.767

-gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
caggcggcg-gtcgcggccggcaacaccgat	Protospacer
 .  *.**. ************* *******

59. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
gtccaggacgtcgcggccggcggcgcctcg	Protospacer
****** **************. *.**   

60. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP033228 (Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence) position: , mismatch: 7, identity: 0.767

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
ctcgtcgacgtcgcggcaggcaccatcgat	Protospacer
 **    ********** *******.****

61. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.767

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
agtcagggtgtcgttgccgttgccgccgcg	Protospacer
.. ************ ******** **  *

62. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP027406 (Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
gaaaataatgtcattgccttcgtcgccgaa	Protospacer
   **    ***.*****************

63. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 8, identity: 0.733

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
gttgatgcggtcgttgccttcgccgccgtc	Protospacer
 *..*  ***************.*****  

64. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NC_008386 (Roseobacter denitrificans OCh 114 plasmid pTB1, complete sequence) position: , mismatch: 8, identity: 0.733

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
gaaaataatgtcattgccttcgtcgccgaa	Protospacer
   **    ***.*****************

65. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
cgccatcatgtcgttgcctgtaccgccaac	Protospacer
  .** ************ ********.  

66. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
ggcgtggtcgtcgccgtgaccgccgccgac	Protospacer
* *  .  *****.*************** 

67. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP007256 (Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence) position: , mismatch: 8, identity: 0.733

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
catcggtgcgtcgtcgtcaccgccgccgag	Protospacer
  .*..*.********* ***********.

68. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.733

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
cggcaatacgtggtcgtgaccgccaacggt	Protospacer
   ******** ************. **. 

69. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ccacaggaagtcggcgccgtcgccaccgtc	Protospacer
   ***** *************** **   

70. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
gaacaggatgtcgtcgccgtcgccgccgcc	Protospacer
.. ********** ********** **   

71. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ccgcagaatgtcggcgccgtcgccgccgtt	Protospacer
   ***.***************** **   

72. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
gcgcagaatgtcggcgccgtcgccgccgct	Protospacer
.  ***.***************** **   

73. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggtcacgatgtcggcgccgtcgtaggacgc	Protospacer
.**** ****************.    ** 

74. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggcgctgatgtcgccgccgtcgtcccccgc	Protospacer
.*.   ******* ********.****** 

75. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggtcacgatgtcgtcgccgtcgccggcatt	Protospacer
.**** ******* **********  *   

76. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggtcacgatgtcgtcgccgtcgccggcatt	Protospacer
.**** ******* **********  *   

77. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggtcacgatgtcggcgccgtcgtaggacgc	Protospacer
.**** ****************.    ** 

78. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggcgctgatgtcgccgccgtcgtcccccgc	Protospacer
.*.   ******* ********.****** 

79. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
atccacgatgtcggcgccgtcgcgccagag	Protospacer
* .** ***************** **  ..

80. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggcgctgatgtcgccgccgtcgtcccccgc	Protospacer
.*.   ******* ********.****** 

81. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggcgctgatgtcgccgccgtcgtcccccgc	Protospacer
.*.   ******* ********.****** 

82. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
gatcaggatgtcggcgccttcgcgggcata	Protospacer
..**************** ****   *  *

83. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.733

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
ttccagcccgtcgcggccggcatccagcac	Protospacer
 ****** **************.*    *.

84. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 8, identity: 0.733

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
atacagggtgtcgtttcccgtgcccccggc	Protospacer
. .***************  ******* . 

85. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
atacagggtgtcgtttcccgtgcccccggc	Protospacer
. .***************  ******* . 

86. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
atacagggtgtcgtttcccgtgcccccggc	Protospacer
. .***************  ******* . 

87. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 8, identity: 0.733

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
tttcagggtgtcgttaccgtcgcccccgct	Protospacer
   ************ ****.******   

88. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 8, identity: 0.733

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
tttcagggtgtcgttaccgtcgcccccgct	Protospacer
   ************ ****.******   

89. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 8, identity: 0.733

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
atacagggtgtcgtttcccgtgcccccggc	Protospacer
. .***************  ******* . 

90. spacer 2.1|214344|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 8, identity: 0.733

gagcagggtgtcgtttccgttgccccccag	CRISPR spacer
tttcagggtgtcgttaccgtcgcccccgct	Protospacer
   ************ ****.******   

91. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.7

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
gcggaaggtgtcgttgccttcgccgccgaa	Protospacer
 . .*.   *************.*******

92. spacer 1.1|213939|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.7

ttcaagtcggtcgttgccttcgtcgccgaa	CRISPR spacer
gcggaaggtgtcgttgccttcgccgccgaa	Protospacer
 . .*.   *************.*******

93. spacer 1.2|213993|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP024445 (Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence) position: , mismatch: 9, identity: 0.7

gctcagcatgtcgttgccagtaccgccgcg	CRISPR spacer
cactagaatgtcgttgccagcaccgccttc	Protospacer
  ..** *************.****** . 

94. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_HG938357 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141b, complete sequence) position: , mismatch: 9, identity: 0.7

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
cccagctacgtcgtcgtgatcgccgccacc	Protospacer
 .* . *************.*******.  

95. spacer 1.3|214047|30|NZ_CP012403|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.7

gtccaatacgtcgtcgtgaccgccgccgaa	CRISPR spacer
cccggcgacgtcgtcgtcaccgccgccggg	Protospacer
 .* .  ********** **********..

96. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.7

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cgtcaggatatcggcgccgtcgagcaagac	Protospacer
 ********.************  *   . 

97. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
gtcgaggatgtcgccgccgtcgcccttgaa	Protospacer
. . ********* ***********.. .*

98. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 9, identity: 0.7

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
gtgaacgatgtcggccccgtcgcccccgat	Protospacer
.   * ********* *********** . 

99. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.7

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cgtcaggatatcggcgccgtcgagcaagac	Protospacer
 ********.************  *   . 

100. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cgtcaggatatcggcgccgtcgagcaagac	Protospacer
 ********.************  *   . 

101. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.7

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
cgtcaggatatcggcgccgtcgagcaagac	Protospacer
 ********.************  *   . 

102. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.7

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
ggtcaggatgtcggcaccgtcggcggggcg	Protospacer
.**************.****** *     .

103. spacer 1.4|214101|30|NZ_CP012403|CRISPRCasFinder matches to MN871455 (UNVERIFIED: Pseudomonas phage Pa-B, complete genome) position: , mismatch: 9, identity: 0.7

agtcaggatgtcggcgccgtcgccccccga	CRISPR spacer
gatcaggatgtcggcgcggtagccctggag	Protospacer
..*************** ** ****.  ..

104. spacer 1.5|214155|30|NZ_CP012403|CRISPRCasFinder matches to NZ_LR594692 (Variovorax sp. WDL1 plasmid 4) position: , mismatch: 9, identity: 0.7

gtccagcacgtcgcggccggcaccaccgat	CRISPR spacer
acgagggccgtcgccgccggcaccaccgag	Protospacer
..  .*  ****** ************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 798158 : 806091 8 uncultured_Mediterranean_phage(83.33%) tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP012404
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012404_1 481998-482211 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 453707 : 491361 22 Corynebacterium_phage(25.0%) bacteriocin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP012405
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012405_1 336483-336669 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012405_1 1.2|336597|42|NZ_CP012405|PILER-CR 336597-336638 42 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 94458-94499 2 0.952
NZ_CP012405_1 1.2|336597|42|NZ_CP012405|PILER-CR 336597-336638 42 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 227903-227944 4 0.905
NZ_CP012405_1 1.2|336597|42|NZ_CP012405|PILER-CR 336597-336638 42 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 94692-94733 5 0.881
NZ_CP012405_1 1.2|336597|42|NZ_CP012405|PILER-CR 336597-336638 42 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 228293-228334 6 0.857

1. spacer 1.2|336597|42|NZ_CP012405|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.952

gacaccagcagggtgttgcccgcagtgcccagcgtgacgatg	CRISPR spacer
gaaaccagcagggtgttgcccgcggtgcccagcgtgacgatg	Protospacer
** ********************.******************

2. spacer 1.2|336597|42|NZ_CP012405|PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.905

gacaccagcagggtgttgcccgcagtgcccagcgtgacgatg	CRISPR spacer
gtgaccagcagggtgttgcccgcggtgcccagcgtgacgacg	Protospacer
*  ********************.****************.*

3. spacer 1.2|336597|42|NZ_CP012405|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.881

gacaccagcagggtgttgcccgcagtgcccagcgtgacgatg	CRISPR spacer
acgacctgcagggtgttgcccgcggtgcccagcgtgacgatg	Protospacer
.  *** ****************.******************

4. spacer 1.2|336597|42|NZ_CP012405|PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.857

gacaccagcagggtgttgcccgcagtgcccagcgtgacgatg	CRISPR spacer
acgatctgcagggtgttgcccgcggtgcccagcgtgacgatg	Protospacer
.  *.* ****************.******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14192 13 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 19324 : 20440 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_3 30783 : 31863 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_4 35081 : 35831 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_5 38962 : 40121 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_6 56291 : 59757 4 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_7 78267 : 82553 4 Phage_TP(50.0%) NA NA
DBSCAN-SWA_8 87866 : 89492 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_9 92745 : 93804 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_10 99469 : 100105 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_11 122676 : 130213 8 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_12 134422 : 135193 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_13 140317 : 141109 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_14 154894 : 163329 8 Klosneuvirus(40.0%) NA NA
DBSCAN-SWA_15 167409 : 168423 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_16 179394 : 180615 1 Roseobacter_phage(100.0%) NA NA
DBSCAN-SWA_17 191885 : 193526 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_18 202727 : 203270 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_19 206407 : 207193 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_20 224261 : 226705 3 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_21 232885 : 237389 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_22 240664 : 241864 1 Corynebacterium_phage(100.0%) transposase NA
DBSCAN-SWA_23 245914 : 247192 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_24 269226 : 270009 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_25 276624 : 277698 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_26 290613 : 297140 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_27 305686 : 306424 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_28 315506 : 317678 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_29 331676 : 333635 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_30 348751 : 349603 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_31 360613 : 363867 3 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_32 375445 : 376952 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_33 381505 : 383182 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_34 402926 : 404573 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_35 407978 : 413012 5 Bordetella_phage(33.33%) NA NA
DBSCAN-SWA_36 421727 : 424517 4 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_37 431463 : 433182 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_38 442179 : 445497 4 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_39 456228 : 461681 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_40 465055 : 476793 11 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_41 481979 : 485794 4 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_42 489503 : 492286 2 Hepacivirus(50.0%) NA NA
DBSCAN-SWA_43 496446 : 499413 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_44 504944 : 510287 4 Klosneuvirus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP012401
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012401_1 95083-95187 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012401_2 2084769-2084893 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 451529 : 501454 51 Pseudomonas_phage(33.33%) integrase,portal,capsid,protease,tRNA,terminase attL 451436:451457|attR 467123:467144
DBSCAN-SWA_2 1402677 : 1412484 10 Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus(16.67%) terminase NA
DBSCAN-SWA_3 2024814 : 2066549 53 Erwinia_phage(16.67%) integrase,transposase attL 2037416:2037435|attR 2068723:2068742
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP012407
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012407_1 8012-8099 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012407_2 59854-59971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012407_2 2.1|59894|38|NZ_CP012407|CRISPRCasFinder 59894-59931 38 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 284780-284817 0 1.0
NZ_CP012407_2 2.1|59894|38|NZ_CP012407|CRISPRCasFinder 59894-59931 38 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 224718-224755 6 0.842
NZ_CP012407_2 2.1|59894|38|NZ_CP012407|CRISPRCasFinder 59894-59931 38 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 291494-291531 7 0.816

1. spacer 2.1|59894|38|NZ_CP012407|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcggcaccgacgtcatcacggtcggcacggccggcg	CRISPR spacer
tgtcggcaccgacgtcatcacggtcggcacggccggcg	Protospacer
**************************************

2. spacer 2.1|59894|38|NZ_CP012407|CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.842

tgtcggcaccgacgtcatcacggtcggcacggccggcg	CRISPR spacer
cgctgccaccgacgtcatcacgatcggcaccgccggcg	Protospacer
.*..* ****************.******* *******

3. spacer 2.1|59894|38|NZ_CP012407|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 7, identity: 0.816

tgtcggcaccgacgtcatcacggtcgg---cacggccggcg	CRISPR spacer
cgtcggcaccgacgtgatcacgctcggcgacacggcca---	Protospacer
.************** ****** ****   *******.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11555 : 68859 37 Yellowstone_lake_phycodnavirus(22.22%) transposase NA
DBSCAN-SWA_2 109458 : 186473 50 uncultured_marine_virus(15.38%) transposase,holin NA
DBSCAN-SWA_3 266498 : 281764 11 Tupanvirus(30.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP012406
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012406_1 460663-460813 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 188793 : 197850 7 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_2 204285 : 226301 24 Pseudomonas_phage(23.08%) capsid,head NA
DBSCAN-SWA_3 339876 : 366570 39 uncultured_marine_virus(10.53%) integrase,head,capsid,terminase,portal attL 326188:326204|attR 368153:368169
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_CP012402
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012402_1 1129747-1129995 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage