Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012373 Beggiatoa leptomitoformis strain D-402 chromosome, complete genome 7 crisprs DEDDh,cas3,cas10,csa3,RT 0 15 9 0

Results visualization

1. NZ_CP012373
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012373_1 552059-552295 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012373_2 945619-945987 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012373_3 1966232-1966414 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012373_4 2230966-2231121 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012373_5 3241978-3242161 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012373_6 3500145-3500724 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012373_7 3708860-3708954 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012373_1 1.2|552161|32|NZ_CP012373|CRT 552161-552192 32 MK387337 Vibrio phage ValB1MD, complete genome 28579-28610 5 0.844
NZ_CP012373_1 1.5|552162|32|NZ_CP012373|PILER-CR 552162-552193 32 MK387337 Vibrio phage ValB1MD, complete genome 28579-28610 5 0.844
NZ_CP012373_1 1.8|552161|33|NZ_CP012373|CRISPRCasFinder 552161-552193 33 MK387337 Vibrio phage ValB1MD, complete genome 28579-28611 5 0.848
NZ_CP012373_1 1.2|552161|32|NZ_CP012373|CRT 552161-552192 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2374100-2374131 6 0.812
NZ_CP012373_1 1.5|552162|32|NZ_CP012373|PILER-CR 552162-552193 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2374100-2374131 6 0.812
NZ_CP012373_1 1.3|552229|31|NZ_CP012373|CRT 552229-552259 31 NZ_CP033050 Virgibacillus halodenitrificans strain Bac324 plasmid unnamed, complete sequence 179798-179828 7 0.774
NZ_CP012373_1 1.6|552230|31|NZ_CP012373|PILER-CR 552230-552260 31 NZ_CP033050 Virgibacillus halodenitrificans strain Bac324 plasmid unnamed, complete sequence 179798-179828 7 0.774
NZ_CP012373_3 3.1|1966270|30|NZ_CP012373|PILER-CR 1966270-1966299 30 NC_022050 Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence 40999-41028 7 0.767
NZ_CP012373_3 3.1|1966270|30|NZ_CP012373|PILER-CR 1966270-1966299 30 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 147618-147647 7 0.767
NZ_CP012373_1 1.2|552161|32|NZ_CP012373|CRT 552161-552192 32 NZ_CP007767 Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence 32674-32705 8 0.75
NZ_CP012373_1 1.2|552161|32|NZ_CP012373|CRT 552161-552192 32 NZ_CP044261 Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence 31359-31390 8 0.75
NZ_CP012373_1 1.2|552161|32|NZ_CP012373|CRT 552161-552192 32 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 331988-332019 8 0.75
NZ_CP012373_1 1.5|552162|32|NZ_CP012373|PILER-CR 552162-552193 32 NZ_CP007767 Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence 32674-32705 8 0.75
NZ_CP012373_1 1.5|552162|32|NZ_CP012373|PILER-CR 552162-552193 32 NZ_CP044261 Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence 31359-31390 8 0.75
NZ_CP012373_1 1.5|552162|32|NZ_CP012373|PILER-CR 552162-552193 32 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 331988-332019 8 0.75
NZ_CP012373_1 1.9|552229|32|NZ_CP012373|CRISPRCasFinder 552229-552260 32 NZ_CP033050 Virgibacillus halodenitrificans strain Bac324 plasmid unnamed, complete sequence 179798-179829 8 0.75
NZ_CP012373_6 6.1|3500181|32|NZ_CP012373|PILER-CR,CRT 3500181-3500212 32 MN417334 Clostridium phage CPAS-15, complete genome 23071-23102 8 0.75
NZ_CP012373_6 6.1|3500181|32|NZ_CP012373|PILER-CR,CRT 3500181-3500212 32 MF001357 Clostridium phage CP3, partial genome 641-672 8 0.75
NZ_CP012373_6 6.2|3500249|30|NZ_CP012373|PILER-CR,CRT 3500249-3500278 30 MN692957 Marine virus AFVG_117M60, complete genome 36488-36517 8 0.733
NZ_CP012373_6 6.4|3500382|30|NZ_CP012373|PILER-CR,CRT 3500382-3500411 30 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 20042-20071 8 0.733
NZ_CP012373_6 6.4|3500382|30|NZ_CP012373|PILER-CR,CRT 3500382-3500411 30 JQ680349 Unidentified phage clone 1013_scaffold24 genomic sequence 29804-29833 8 0.733
NZ_CP012373_1 1.1|552095|30|NZ_CP012373|CRT 552095-552124 30 AP014207 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C8-MedDCM-OCT-S26-C6, *** SEQUENCING IN PROGRESS *** 2322-2351 9 0.7
NZ_CP012373_1 1.3|552229|31|NZ_CP012373|CRT 552229-552259 31 MN871444 UNVERIFIED: Serratia phage KpGz_1, complete genome 49553-49583 9 0.71
NZ_CP012373_1 1.4|552096|30|NZ_CP012373|PILER-CR 552096-552125 30 AP014207 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C8-MedDCM-OCT-S26-C6, *** SEQUENCING IN PROGRESS *** 2322-2351 9 0.7
NZ_CP012373_1 1.6|552230|31|NZ_CP012373|PILER-CR 552230-552260 31 MN871444 UNVERIFIED: Serratia phage KpGz_1, complete genome 49553-49583 9 0.71
NZ_CP012373_1 1.8|552161|33|NZ_CP012373|CRISPRCasFinder 552161-552193 33 NZ_CP007767 Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence 32673-32705 9 0.727
NZ_CP012373_1 1.8|552161|33|NZ_CP012373|CRISPRCasFinder 552161-552193 33 NZ_CP044261 Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence 31358-31390 9 0.727
NZ_CP012373_1 1.8|552161|33|NZ_CP012373|CRISPRCasFinder 552161-552193 33 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 331988-332020 9 0.727
NZ_CP012373_1 1.2|552161|32|NZ_CP012373|CRT 552161-552192 32 MN693402 Marine virus AFVG_25M260, complete genome 22109-22140 10 0.688
NZ_CP012373_1 1.5|552162|32|NZ_CP012373|PILER-CR 552162-552193 32 MN693402 Marine virus AFVG_25M260, complete genome 22109-22140 10 0.688
NZ_CP012373_4 4.1|2230996|33|NZ_CP012373|CRISPRCasFinder 2230996-2231028 33 AP013497 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S35-C79 4324-4356 10 0.697
NZ_CP012373_4 4.1|2230996|33|NZ_CP012373|CRISPRCasFinder 2230996-2231028 33 AP013775 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S26-C73, *** SEQUENCING IN PROGRESS *** 8948-8980 10 0.697
NZ_CP012373_4 4.1|2230996|33|NZ_CP012373|CRISPRCasFinder 2230996-2231028 33 AP013498 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S38-C76 24489-24521 10 0.697
NZ_CP012373_6 6.8|3500660|32|NZ_CP012373|PILER-CR 3500660-3500691 32 MN694562 Marine virus AFVG_250M829, complete genome 31480-31511 11 0.656
NZ_CP012373_6 6.12|3500657|32|NZ_CP012373|CRT 3500657-3500688 32 MN694562 Marine virus AFVG_250M829, complete genome 31480-31511 11 0.656

1. spacer 1.2|552161|32|NZ_CP012373|CRT matches to MK387337 (Vibrio phage ValB1MD, complete genome) position: , mismatch: 5, identity: 0.844

atggaacaattccttgaagaacaaaac-accat	CRISPR spacer
gtcgaacaattcgttgaagaacaaaactatca-	Protospacer
.* ********* ************** *.** 

2. spacer 1.5|552162|32|NZ_CP012373|PILER-CR matches to MK387337 (Vibrio phage ValB1MD, complete genome) position: , mismatch: 5, identity: 0.844

atggaacaattccttgaagaacaaaac-accat	CRISPR spacer
gtcgaacaattcgttgaagaacaaaactatca-	Protospacer
.* ********* ************** *.** 

3. spacer 1.8|552161|33|NZ_CP012373|CRISPRCasFinder matches to MK387337 (Vibrio phage ValB1MD, complete genome) position: , mismatch: 5, identity: 0.848

atggaacaattccttgaagaacaaaac-accatg	CRISPR spacer
gtcgaacaattcgttgaagaacaaaactatcat-	Protospacer
.* ********* ************** *.*** 

4. spacer 1.2|552161|32|NZ_CP012373|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

atggaacaattccttgaagaaca-aaacaccat	CRISPR spacer
atggaacatttccttgaagcacacgaacaata-	Protospacer
******** ********** *** .**** .* 

5. spacer 1.5|552162|32|NZ_CP012373|PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

atggaacaattccttgaagaaca-aaacaccat	CRISPR spacer
atggaacatttccttgaagcacacgaacaata-	Protospacer
******** ********** *** .**** .* 

6. spacer 1.3|552229|31|NZ_CP012373|CRT matches to NZ_CP033050 (Virgibacillus halodenitrificans strain Bac324 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

aagatgctgatgtagtgggttttgtatatcg	CRISPR spacer
accatgctaatgtagcgggttttgtagttgg	Protospacer
*  *****.******.**********  * *

7. spacer 1.6|552230|31|NZ_CP012373|PILER-CR matches to NZ_CP033050 (Virgibacillus halodenitrificans strain Bac324 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

aagatgctgatgtagtgggttttgtatatcg	CRISPR spacer
accatgctaatgtagcgggttttgtagttgg	Protospacer
*  *****.******.**********  * *

8. spacer 3.1|1966270|30|NZ_CP012373|PILER-CR matches to NC_022050 (Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence) position: , mismatch: 7, identity: 0.767

gtacactcggtatattcagcgtctgctgga	CRISPR spacer
aagcgctcggtatattcagcgtctgcaaca	Protospacer
. .*.********************* . *

9. spacer 3.1|1966270|30|NZ_CP012373|PILER-CR matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 7, identity: 0.767

gtacactcggtatattcagcgtctgctgga	CRISPR spacer
cgacactcggtatatgcagcgtcaccgcga	Protospacer
  ************* *******  *  **

10. spacer 1.2|552161|32|NZ_CP012373|CRT matches to NZ_CP007767 (Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence) position: , mismatch: 8, identity: 0.75

atggaacaattccttgaagaacaaaacaccat	CRISPR spacer
aaagaaccattccttgaagatcaaaacaaaga	Protospacer
* .**** ************ *******  . 

11. spacer 1.2|552161|32|NZ_CP012373|CRT matches to NZ_CP044261 (Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence) position: , mismatch: 8, identity: 0.75

atggaacaattccttgaagaacaaaacaccat	CRISPR spacer
aaagaaccattccttgaagatcaaaacaaaga	Protospacer
* .**** ************ *******  . 

12. spacer 1.2|552161|32|NZ_CP012373|CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 8, identity: 0.75

atggaacaattccttgaagaacaaaacaccat	CRISPR spacer
gtacaacaataccttcaagaacaaaacaaaaa	Protospacer
.*. ****** **** ************  * 

13. spacer 1.5|552162|32|NZ_CP012373|PILER-CR matches to NZ_CP007767 (Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence) position: , mismatch: 8, identity: 0.75

atggaacaattccttgaagaacaaaacaccat	CRISPR spacer
aaagaaccattccttgaagatcaaaacaaaga	Protospacer
* .**** ************ *******  . 

14. spacer 1.5|552162|32|NZ_CP012373|PILER-CR matches to NZ_CP044261 (Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence) position: , mismatch: 8, identity: 0.75

atggaacaattccttgaagaacaaaacaccat	CRISPR spacer
aaagaaccattccttgaagatcaaaacaaaga	Protospacer
* .**** ************ *******  . 

15. spacer 1.5|552162|32|NZ_CP012373|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 8, identity: 0.75

atggaacaattccttgaagaacaaaacaccat	CRISPR spacer
gtacaacaataccttcaagaacaaaacaaaaa	Protospacer
.*. ****** **** ************  * 

16. spacer 1.9|552229|32|NZ_CP012373|CRISPRCasFinder matches to NZ_CP033050 (Virgibacillus halodenitrificans strain Bac324 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

aagatgctgatgtagtgggttttgtatatcgg	CRISPR spacer
accatgctaatgtagcgggttttgtagttgga	Protospacer
*  *****.******.**********  * *.

17. spacer 6.1|3500181|32|NZ_CP012373|PILER-CR,CRT matches to MN417334 (Clostridium phage CPAS-15, complete genome) position: , mismatch: 8, identity: 0.75

accataatccctaggtggactttgacatacgt	CRISPR spacer
actgatatgcctatgtggactttgacatattt	Protospacer
**..  ** **** ***************. *

18. spacer 6.1|3500181|32|NZ_CP012373|PILER-CR,CRT matches to MF001357 (Clostridium phage CP3, partial genome) position: , mismatch: 8, identity: 0.75

accataatccctaggtggactttgacatacgt	CRISPR spacer
actgatatgcctatgtggactttgacatattt	Protospacer
**..  ** **** ***************. *

19. spacer 6.2|3500249|30|NZ_CP012373|PILER-CR,CRT matches to MN692957 (Marine virus AFVG_117M60, complete genome) position: , mismatch: 8, identity: 0.733

agaagcgacttgataacgctacgaattctg	CRISPR spacer
acgttgtacttgataacgctactcattctg	Protospacer
* .    ***************  ******

20. spacer 6.4|3500382|30|NZ_CP012373|PILER-CR,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 8, identity: 0.733

cacaatggaattgatgagtatttgctcccc	CRISPR spacer
aacaatggaattgatgtgtatatgtcagct	Protospacer
 *************** **** **..  *.

21. spacer 6.4|3500382|30|NZ_CP012373|PILER-CR,CRT matches to JQ680349 (Unidentified phage clone 1013_scaffold24 genomic sequence) position: , mismatch: 8, identity: 0.733

cacaatggaattgatgagtatttgctcccc	CRISPR spacer
cttcatggaattgatgagtattggcatatc	Protospacer
* . ****************** ** . .*

22. spacer 1.1|552095|30|NZ_CP012373|CRT matches to AP014207 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C8-MedDCM-OCT-S26-C6, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7

tacccatcattgattgaagacttggggggc	CRISPR spacer
acgctctcattgattgaagtcttggggaaa	Protospacer
   *. ************* *******.. 

23. spacer 1.3|552229|31|NZ_CP012373|CRT matches to MN871444 (UNVERIFIED: Serratia phage KpGz_1, complete genome) position: , mismatch: 9, identity: 0.71

aagatgctgatgtagtgggttttgtatatcg	CRISPR spacer
ctctacctgatgtagttggttttgtagattg	Protospacer
      ********** ********* **.*

24. spacer 1.4|552096|30|NZ_CP012373|PILER-CR matches to AP014207 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C8-MedDCM-OCT-S26-C6, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7

tacccatcattgattgaagacttggggggc	CRISPR spacer
acgctctcattgattgaagtcttggggaaa	Protospacer
   *. ************* *******.. 

25. spacer 1.6|552230|31|NZ_CP012373|PILER-CR matches to MN871444 (UNVERIFIED: Serratia phage KpGz_1, complete genome) position: , mismatch: 9, identity: 0.71

aagatgctgatgtagtgggttttgtatatcg	CRISPR spacer
ctctacctgatgtagttggttttgtagattg	Protospacer
      ********** ********* **.*

26. spacer 1.8|552161|33|NZ_CP012373|CRISPRCasFinder matches to NZ_CP007767 (Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence) position: , mismatch: 9, identity: 0.727

atggaacaattccttgaagaacaaaacaccatg	CRISPR spacer
aaagaaccattccttgaagatcaaaacaaagat	Protospacer
* .**** ************ *******  .  

27. spacer 1.8|552161|33|NZ_CP012373|CRISPRCasFinder matches to NZ_CP044261 (Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence) position: , mismatch: 9, identity: 0.727

atggaacaattccttgaagaacaaaacaccatg	CRISPR spacer
aaagaaccattccttgaagatcaaaacaaagat	Protospacer
* .**** ************ *******  .  

28. spacer 1.8|552161|33|NZ_CP012373|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 9, identity: 0.727

atggaacaattccttgaagaacaaaacaccatg	CRISPR spacer
gtacaacaataccttcaagaacaaaacaaaaaa	Protospacer
.*. ****** **** ************  * .

29. spacer 1.2|552161|32|NZ_CP012373|CRT matches to MN693402 (Marine virus AFVG_25M260, complete genome) position: , mismatch: 10, identity: 0.688

atggaacaattccttgaagaacaaaacaccat	CRISPR spacer
gctcaacaattacttgaagaacaaaacctttc	Protospacer
..  ******* *************** .. .

30. spacer 1.5|552162|32|NZ_CP012373|PILER-CR matches to MN693402 (Marine virus AFVG_25M260, complete genome) position: , mismatch: 10, identity: 0.688

atggaacaattccttgaagaacaaaacaccat	CRISPR spacer
gctcaacaattacttgaagaacaaaacctttc	Protospacer
..  ******* *************** .. .

31. spacer 4.1|2230996|33|NZ_CP012373|CRISPRCasFinder matches to AP013497 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S35-C79) position: , mismatch: 10, identity: 0.697

gacaaggtcagcttgggcaatggcaaggtctgc	CRISPR spacer
accaatgtcagcatgggcaatggcaagagtaaa	Protospacer
. *** ****** **************. . . 

32. spacer 4.1|2230996|33|NZ_CP012373|CRISPRCasFinder matches to AP013775 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S26-C73, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.697

gacaaggtcagcttgggcaatggcaaggtctgc	CRISPR spacer
accaatgtcagcatgggcaatggcaagagtaaa	Protospacer
. *** ****** **************. . . 

33. spacer 4.1|2230996|33|NZ_CP012373|CRISPRCasFinder matches to AP013498 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S38-C76) position: , mismatch: 10, identity: 0.697

gacaaggtcagcttgggcaatggcaaggtctgc	CRISPR spacer
accaatgtcagcatgggcaatggcaagagtaaa	Protospacer
. *** ****** **************. . . 

34. spacer 6.8|3500660|32|NZ_CP012373|PILER-CR matches to MN694562 (Marine virus AFVG_250M829, complete genome) position: , mismatch: 11, identity: 0.656

ttgtcagtctctccaccatactgcattagttc	CRISPR spacer
agtacagtctctccaccttcctgcatttcccg	Protospacer
    ************* * *******  .. 

35. spacer 6.12|3500657|32|NZ_CP012373|CRT matches to MN694562 (Marine virus AFVG_250M829, complete genome) position: , mismatch: 11, identity: 0.656

ttgtcagtctctccaccatactgcattagttc	CRISPR spacer
agtacagtctctccaccttcctgcatttcccg	Protospacer
    ************* * *******  .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1442180 : 1498955 52 Rhodococcus_phage(20.0%) integrase,tail,transposase,tRNA attL 1472992:1473007|attR 1497631:1497646
DBSCAN-SWA_2 2166079 : 2173584 7 Ostreococcus_lucimarinus_virus(16.67%) NA NA
DBSCAN-SWA_3 3030146 : 3096086 57 Mycobacterium_phage(25.0%) transposase,tRNA NA
DBSCAN-SWA_4 3107520 : 3173279 53 Paramecium_bursaria_Chlorella_virus(20.0%) protease,transposase NA
DBSCAN-SWA_5 3351400 : 3419004 50 Wolbachia_phage(30.0%) transposase NA
DBSCAN-SWA_6 3434710 : 3511561 56 Tupanvirus(25.0%) transposase,tRNA NA
DBSCAN-SWA_7 3774717 : 3832549 50 Morganella_phage(58.33%) transposase NA
DBSCAN-SWA_8 3875646 : 3931915 45 Hokovirus(20.0%) transposase,tRNA NA
DBSCAN-SWA_9 4202829 : 4252878 43 Streptococcus_phage(12.5%) protease,transposase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage