Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009240 Megasphaera elsdenii 14-14 chromosome, complete genome 2 crisprs cas14j,cas14k,DEDDh,c2c10_CAS-V-U3,csa3,cas3,WYL,cas5,cas8c,cas7,RT 0 1 5 0

Results visualization

1. NZ_CP009240
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009240_1 308453-308540 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009240_2 1557186-1560793 TypeI I-C
53 spacers
cas14j,cas7,cas8c,cas5,cas3,cas14k

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009240_2 2.1|1557218|34|NZ_CP009240|CRISPRCasFinder,CRT 1557218-1557251 34 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 276402-276435 10 0.706

1. spacer 2.1|1557218|34|NZ_CP009240|CRISPRCasFinder,CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 10, identity: 0.706

agagtggtggcaccaccatcgatggcgtgccttt	CRISPR spacer
tgggtgatggcaccagcatcgatggcgccggctc	Protospacer
 *.***.******** ***********.   .*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1321704 : 1328935 7 Agrobacterium_phage(16.67%) protease NA
DBSCAN-SWA_2 1863153 : 1881591 19 Bacillus_phage(66.67%) transposase,integrase attL 1863488:1863501|attR 1881713:1881726
DBSCAN-SWA_3 1916368 : 1923090 12 uncultured_Caudovirales_phage(33.33%) integrase attL 1908040:1908055|attR 1927931:1927946
DBSCAN-SWA_4 2045528 : 2052580 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2146689 : 2208043 52 Indivirus(18.18%) protease,transposase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage