Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012343 Lactiplantibacillus plantarum strain ZS2058 chromosome, complete genome 4 crisprs DinG,DEDDh,cas3,csa3,WYL,cas9,cas1,cas2,csn2 1 40 5 0

Results visualization

1. NZ_CP012343
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012343_1 375039-380326 Orphan NA
70 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012343_2 1769788-1770013 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012343_3 1949494-1949579 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012343_4 2563734-2564693 TypeII NA
14 spacers
csn2,cas2,cas1,cas9,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP012343_2 2.1|1769846|26|NZ_CP012343|PILER-CR 1769846-1769871 26 NZ_CP012343.1 1769762-1769787 0 1.0

1. spacer 2.1|1769846|26|NZ_CP012343|PILER-CR matches to position: 1769762-1769787, mismatch: 0, identity: 1.0

cattcaatgttccaagcccattagta	CRISPR spacer
cattcaatgttccaagcccattagta	Protospacer
**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012343_4 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT 2563770-2563799 30 NZ_CP035140 Leuconostoc mesenteroides strain SRCM103356 plasmid unnamed1, complete sequence 11712-11741 0 1.0
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16064-16097 1 0.971
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16196-16229 1 0.971
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16328-16361 1 0.971
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17354-17387 1 0.971
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18668-18701 1 0.971
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19772-19805 1 0.971
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157480-157513 1 0.971
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153190-153223 1 0.971
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155920-155953 1 0.971
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151861-151894 1 0.971
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154720-154753 1 0.971
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154918-154951 1 0.971
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155116-155149 1 0.971
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155350-155383 1 0.971
NZ_CP012343_4 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT 2563770-2563799 30 NZ_CP035749 Leuconostoc mesenteroides strain SRCM103460 plasmid unnamed3, complete sequence 9890-9919 1 0.967
NZ_CP012343_4 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT 2563770-2563799 30 NZ_CP028257 Leuconostoc mesenteroides strain SRCM102735 plasmid unnamed2, complete sequence 17607-17636 1 0.967
NZ_CP012343_4 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT 2563770-2563799 30 NC_018699 Leuconostoc carnosum JB16 plasmid pKLC4, complete sequence 1151-1180 1 0.967
NZ_CP012343_4 4.13|2564562|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR 2564562-2564591 30 NZ_CP025993 Lactobacillus plantarum subsp. plantarum strain LB1-2 plasmid pLB1-2B, complete sequence 48438-48467 1 0.967
NZ_CP012343_1 1.18|377003|40|NZ_CP012343|CRT 377003-377042 40 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157294-157333 2 0.95
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153802-153823 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154750-154771 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154948-154969 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155146-155167 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155380-155401 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156076-156097 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156616-156637 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157438-157459 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1267-1288 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1573-1594 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2143-2164 2 0.909
NZ_CP012343_1 1.28|377699|22|NZ_CP012343|CRT 377699-377720 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3109-3130 2 0.909
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17504-17537 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17570-17603 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18086-18119 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18230-18263 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18818-18851 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19568-19601 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19712-19745 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19892-19925 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20078-20111 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16442-16475 2 0.941
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17120-17153 2 0.941
NZ_CP012343_1 1.34|378005|34|NZ_CP012343|CRT 378005-378038 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155992-156025 2 0.941
NZ_CP012343_1 1.34|378005|34|NZ_CP012343|CRT 378005-378038 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2221-2254 2 0.941
NZ_CP012343_1 1.39|378329|34|NZ_CP012343|CRT 378329-378362 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157606-157639 2 0.941
NZ_CP012343_1 1.39|378329|34|NZ_CP012343|CRT 378329-378362 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154774-154807 2 0.941
NZ_CP012343_1 1.39|378329|34|NZ_CP012343|CRT 378329-378362 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155170-155203 2 0.941
NZ_CP012343_1 1.39|378329|34|NZ_CP012343|CRT 378329-378362 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155224-155257 2 0.941
NZ_CP012343_1 1.39|378329|34|NZ_CP012343|CRT 378329-378362 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155404-155437 2 0.941
NZ_CP012343_1 1.44|378635|34|NZ_CP012343|CRT 378635-378668 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156412-156445 2 0.941
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19640-19673 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151495-151528 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153010-153043 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153064-153097 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153970-154003 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154024-154057 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156010-156043 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156322-156355 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157498-157531 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1993-2026 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3043-3076 2 0.941
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3565-3598 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151477-151510 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151495-151528 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153652-153685 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153670-153703 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154222-154255 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154240-154273 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154630-154663 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154648-154681 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154864-154897 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155062-155095 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155296-155329 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155560-155593 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156826-156859 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156844-156877 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156994-157027 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157012-157045 2 0.941
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157120-157153 2 0.941
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153934-153967 2 0.941
NZ_CP012343_1 1.64|379931|28|NZ_CP012343|CRT 379931-379958 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156322-156349 2 0.929
NZ_CP012343_1 1.64|379931|28|NZ_CP012343|CRT 379931-379958 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153064-153091 2 0.929
NZ_CP012343_1 1.64|379931|28|NZ_CP012343|CRT 379931-379958 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157300-157327 2 0.929
NZ_CP012343_1 1.64|379931|28|NZ_CP012343|CRT 379931-379958 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3043-3070 2 0.929
NZ_CP012343_1 1.67|380105|22|NZ_CP012343|CRT 380105-380126 22 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1082784-1082805 2 0.909
NZ_CP012343_1 1.67|380105|22|NZ_CP012343|CRT 380105-380126 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2161-2182 2 0.909
NZ_CP012343_1 1.67|380105|22|NZ_CP012343|CRT 380105-380126 22 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 901632-901653 2 0.909
NZ_CP012343_1 1.67|380105|22|NZ_CP012343|CRT 380105-380126 22 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 999573-999594 2 0.909
NZ_CP012343_1 1.67|380105|22|NZ_CP012343|CRT 380105-380126 22 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1295194-1295215 2 0.909
NZ_CP012343_1 1.67|380105|22|NZ_CP012343|CRT 380105-380126 22 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 984451-984472 2 0.909
NZ_CP012343_1 1.67|380105|22|NZ_CP012343|CRT 380105-380126 22 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1107973-1107994 2 0.909
NZ_CP012343_1 1.67|380105|22|NZ_CP012343|CRT 380105-380126 22 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1071569-1071590 2 0.909
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151441-151474 2 0.941
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155812-155845 2 0.941
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151987-152020 2 0.941
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155866-155899 2 0.941
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156538-156571 2 0.941
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157282-157315 2 0.941
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1237-1270 2 0.941
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2167-2200 2 0.941
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3343-3376 2 0.941
NZ_CP012343_4 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT 2563770-2563799 30 NZ_LN890333 Leuconostoc gelidum subsp. gasicomitatum KG16-1 isolate LEKG1 plasmid III, complete sequence 21367-21396 2 0.933
NZ_CP012343_4 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT 2563770-2563799 30 NZ_CP028268 Pediococcus pentosaceus strain SRCM102739 plasmid unnamed2, complete sequence 80-109 2 0.933
NZ_CP012343_1 1.27|377645|34|NZ_CP012343|CRT 377645-377678 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21124-21157 3 0.912
NZ_CP012343_1 1.27|377645|34|NZ_CP012343|CRT 377645-377678 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21322-21355 3 0.912
NZ_CP012343_1 1.27|377645|34|NZ_CP012343|CRT 377645-377678 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15925-15958 3 0.912
NZ_CP012343_1 1.27|377645|34|NZ_CP012343|CRT 377645-377678 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9682-9715 3 0.912
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16736-16769 3 0.912
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17732-17765 3 0.912
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18494-18527 3 0.912
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19214-19247 3 0.912
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21214-21247 3 0.912
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15835-15868 3 0.912
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9772-9805 3 0.912
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9916-9949 3 0.912
NZ_CP012343_1 1.55|379427|34|NZ_CP012343|CRT 379427-379460 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3151-3184 3 0.912
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18158-18191 3 0.912
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18542-18575 3 0.912
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20018-20051 3 0.912
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20102-20135 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151387-151420 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151423-151456 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151459-151492 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153100-153133 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153454-153487 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153874-153907 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155578-155611 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157264-157297 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157300-157333 3 0.912
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1633-1666 3 0.912
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156304-156337 3 0.912
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157408-157441 3 0.912
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157570-157603 3 0.912
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1525-1558 3 0.912
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1753-1786 3 0.912
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2257-2290 3 0.912
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3529-3562 3 0.912
NZ_CP012343_1 1.60|379715|34|NZ_CP012343|CRT 379715-379748 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157192-157225 3 0.912
NZ_CP012343_1 1.60|379715|34|NZ_CP012343|CRT 379715-379748 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2275-2308 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151531-151564 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151567-151600 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154042-154075 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154738-154771 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154936-154969 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155134-155167 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155368-155401 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155848-155881 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155902-155935 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156790-156823 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156958-156991 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157192-157225 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157300-157333 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157426-157459 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2275-2308 3 0.912
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3133-3166 3 0.912
NZ_CP012343_1 1.64|379931|28|NZ_CP012343|CRT 379931-379958 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151495-151522 3 0.893
NZ_CP012343_1 1.64|379931|28|NZ_CP012343|CRT 379931-379958 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1543-1570 3 0.893
NZ_CP012343_1 1.64|379931|28|NZ_CP012343|CRT 379931-379958 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2275-2302 3 0.893
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151477-151510 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151951-151984 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153472-153505 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153490-153523 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153952-153985 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154648-154681 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154684-154717 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154702-154735 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154900-154933 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154954-154987 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155062-155095 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155098-155131 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155296-155329 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155332-155365 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155542-155575 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155560-155593 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156808-156841 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156976-157009 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1273-1306 3 0.912
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1831-1864 3 0.912
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157300-157327 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157588-157615 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21088-21115 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 985-1012 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15475-15502 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15583-15610 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15709-15736 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1543-1570 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1813-1840 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1957-1984 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3133-3160 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3169-3196 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3451-3478 4 0.857
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9646-9673 4 0.857
NZ_CP012343_1 1.34|378005|34|NZ_CP012343|CRT 378005-378038 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15619-15652 4 0.882
NZ_CP012343_1 1.44|378635|34|NZ_CP012343|CRT 378635-378668 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9574-9607 4 0.882
NZ_CP012343_1 1.55|379427|34|NZ_CP012343|CRT 379427-379460 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155506-155539 4 0.882
NZ_CP012343_1 1.55|379427|34|NZ_CP012343|CRT 379427-379460 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156286-156319 4 0.882
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16550-16583 4 0.882
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17228-17261 4 0.882
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18032-18065 4 0.882
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18974-19007 4 0.882
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19514-19547 4 0.882
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3223-3256 4 0.882
NZ_CP012343_1 1.60|379715|34|NZ_CP012343|CRT 379715-379748 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153028-153061 4 0.882
NZ_CP012343_1 1.60|379715|34|NZ_CP012343|CRT 379715-379748 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153064-153097 4 0.882
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156322-156355 4 0.882
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1543-1576 4 0.882
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3043-3076 4 0.882
NZ_CP012343_2 2.1|1769846|26|NZ_CP012343|PILER-CR 1769846-1769871 26 AP014283 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C59, *** SEQUENCING IN PROGRESS *** 15532-15557 4 0.846
NZ_CP012343_4 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT 2563770-2563799 30 NZ_CP025208 Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence 6101-6130 4 0.867
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1111-1144 5 0.853
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154648-154681 5 0.853
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156556-156589 5 0.853
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1615-1648 5 0.853
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3547-3580 5 0.853
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16160-16193 5 0.853
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16292-16325 5 0.853
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16424-16457 5 0.853
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17102-17135 5 0.853
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17336-17369 5 0.853
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19754-19787 5 0.853
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154558-154591 5 0.853
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3241-3274 5 0.853
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156028-156061 5 0.853
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156376-156409 5 0.853
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21142-21175 5 0.853
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21340-21373 5 0.853
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15943-15976 5 0.853
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9700-9733 5 0.853
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9844-9877 5 0.853
NZ_CP012343_4 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT 2563770-2563799 30 NZ_CP020413 Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence 8131-8160 5 0.833
NZ_CP012343_4 4.16|2564034|27|NZ_CP012343|PILER-CR 2564034-2564060 27 KC710998 Shigella phage pSf-1, complete genome 20581-20607 5 0.815
NZ_CP012343_1 1.29|377741|28|NZ_CP012343|CRT 377741-377768 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1210 6 0.786
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16178-16211 6 0.824
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16310-16343 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154468-154501 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155830-155863 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1489-1522 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1849-1882 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3361-3394 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21232-21265 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15853-15886 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9790-9823 6 0.824
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9934-9967 6 0.824
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1489-1522 6 0.824
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2065-2098 6 0.824
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3361-3394 6 0.824
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21232-21265 6 0.824
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15853-15886 6 0.824
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9790-9823 6 0.824
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9934-9967 6 0.824
NZ_CP012343_1 1.34|378005|34|NZ_CP012343|CRT 378005-378038 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2119-2152 6 0.824
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153064-153097 6 0.824
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154630-154663 6 0.824
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154864-154897 6 0.824
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1057-1090 6 0.824
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1957-1990 6 0.824
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 985-1018 6 0.824
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16178-16211 6 0.824
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16310-16343 6 0.824
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18650-18683 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MH752840 Escherichia phage vB_EcoM-Pr121LW, complete genome 32094-32127 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MH491969 Escherichia phage LL12, complete genome 72895-72928 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 KT001917 Escherichia phage Murica, complete genome 71634-71667 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MT884010 Escherichia phage vb_EcoM_bov22_2, complete genome 103894-103927 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 LR694610 Escherichia phage rV5_ev168 genome assembly, chromosome: 1 73273-73306 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MT884008 Escherichia phage vb_EcoM_bov10K2, complete genome 103893-103926 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MT884009 Escherichia phage vb_EcoM_bov11CS3, complete genome 103893-103926 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MK962749 Shigella phage CM1, complete genome 72462-72495 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MN850597 Escherichia phage isim, complete genome 105844-105877 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MN850578 Escherichia phage nomo, complete genome 87017-87050 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MT884011 Escherichia phage vb_EcoM_bov25_3, complete genome 103893-103926 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MN850612 Escherichia phage magaca, complete genome 33938-33971 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 LR699804 Escherichia phage rV5_ev146 genome assembly, chromosome: 1 74710-74743 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MG065635 UNVERIFIED: Campylobacter phage C12, complete genome 106491-106524 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MK373780 Escherichia phage vB_EcoM_HdK5, complete genome 106748-106781 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 LR694611 Escherichia phage rV5_ev158 genome assembly, chromosome: 1 73324-73357 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MG065653 UNVERIFIED: Campylobacter phage C14, complete genome 45931-45964 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MN850627 Escherichia phage pangalan, complete genome 66869-66902 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MN850595 Escherichia phage naswa, complete genome 4406-4439 6 0.824
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MN850576 Escherichia phage ime, complete genome 16305-16338 6 0.824
NZ_CP012343_1 1.55|379427|34|NZ_CP012343|CRT 379427-379460 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154504-154537 6 0.824
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16160-16193 6 0.824
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16292-16325 6 0.824
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16424-16457 6 0.824
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17102-17135 6 0.824
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17336-17369 6 0.824
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19754-19787 6 0.824
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15595-15628 6 0.824
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15721-15754 6 0.824
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152041-152074 6 0.824
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154096-154129 6 0.824
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154132-154165 6 0.824
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155746-155779 6 0.824
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3079-3112 6 0.824
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887811-2887844 6 0.824
NZ_CP012343_1 1.60|379715|34|NZ_CP012343|CRT 379715-379748 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154828-154861 6 0.824
NZ_CP012343_1 1.60|379715|34|NZ_CP012343|CRT 379715-379748 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155794-155827 6 0.824
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1216 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1147-1180 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2203-2236 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2575-2608 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21286-21319 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21304-21337 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21358-21391 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15763-15796 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15907-15940 6 0.824
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9988-10021 6 0.824
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16550-16583 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17228-17261 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18032-18065 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18974-19007 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19514-19547 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16160-16193 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16292-16325 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16424-16457 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17102-17135 7 0.794
NZ_CP012343_1 1.30|377789|34|NZ_CP012343|CRT 377789-377822 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19754-19787 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155992-156025 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157138-157171 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1957-1990 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 985-1018 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21070-21103 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15457-15490 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15565-15598 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15691-15724 7 0.794
NZ_CP012343_1 1.32|377897|34|NZ_CP012343|CRT 377897-377930 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9628-9661 7 0.794
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154468-154501 7 0.794
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21070-21103 7 0.794
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15457-15490 7 0.794
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15565-15598 7 0.794
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15691-15724 7 0.794
NZ_CP012343_1 1.33|377951|34|NZ_CP012343|CRT 377951-377984 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9628-9661 7 0.794
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156322-156355 7 0.794
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1543-1576 7 0.794
NZ_CP012343_1 1.42|378527|34|NZ_CP012343|CRT 378527-378560 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3043-3076 7 0.794
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16550-16583 7 0.794
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17228-17261 7 0.794
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18032-18065 7 0.794
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18974-19007 7 0.794
NZ_CP012343_1 1.43|378581|34|NZ_CP012343|CRT 378581-378614 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19514-19547 7 0.794
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MG065644 UNVERIFIED: Campylobacter phage A147, complete genome 98515-98548 7 0.794
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MG065647 UNVERIFIED: Campylobacter phage D#, complete genome 16703-16736 7 0.794
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MG065646 UNVERIFIED: Campylobacter phage D1, complete genome 59221-59254 7 0.794
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 MG065690 UNVERIFIED: Campylobacter phage A135, complete genome 124804-124837 7 0.794
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16178-16211 7 0.794
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16310-16343 7 0.794
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18650-18683 7 0.794
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16880-16913 7 0.794
NZ_CP012343_1 1.56|379481|34|NZ_CP012343|CRT 379481-379514 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18614-18647 7 0.794
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154828-154861 7 0.794
NZ_CP012343_1 1.58|379607|34|NZ_CP012343|CRT 379607-379640 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155794-155827 7 0.794
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154186-154219 7 0.794
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154504-154537 7 0.794
NZ_CP012343_1 1.60|379715|34|NZ_CP012343|CRT 379715-379748 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1216 7 0.794
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18572-18605 7 0.794
NZ_CP012343_1 1.62|379823|34|NZ_CP012343|CRT 379823-379856 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15745-15778 7 0.794
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1171-1204 7 0.794
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 10-43 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157426-157459 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154738-154771 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154936-154969 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155134-155167 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155368-155401 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156130-156163 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156604-156637 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3397-3430 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1399-1432 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21034-21067 7 0.794
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15421-15454 7 0.794
NZ_CP012343_4 4.5|2564034|30|NZ_CP012343|CRISPRCasFinder,CRT 2564034-2564063 30 KC710998 Shigella phage pSf-1, complete genome 20581-20610 7 0.767
NZ_CP012343_4 4.10|2564364|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR 2564364-2564393 30 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 122962-122991 7 0.767
NZ_CP012343_4 4.15|2563968|27|NZ_CP012343|PILER-CR 2563968-2563994 27 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 574831-574857 7 0.741
NZ_CP012343_1 1.18|377003|40|NZ_CP012343|CRT 377003-377042 40 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1177-1216 8 0.8
NZ_CP012343_1 1.39|378329|34|NZ_CP012343|CRT 378329-378362 34 MH632120 Mycobacterium phage Thonko, complete genome 31504-31537 8 0.765
NZ_CP012343_1 1.55|379427|34|NZ_CP012343|CRT 379427-379460 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155746-155779 8 0.765
NZ_CP012343_1 1.66|380051|34|NZ_CP012343|CRT 380051-380084 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1216 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155188-155221 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155422-155455 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156322-156355 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2557-2590 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3043-3076 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3709-3742 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3745-3778 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21268-21301 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15529-15562 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15655-15688 8 0.765
NZ_CP012343_1 1.70|380273|34|NZ_CP012343|CRT 380273-380306 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15889-15922 8 0.765
NZ_CP012343_4 4.7|2564166|30|NZ_CP012343|CRISPRCasFinder,CRT 2564166-2564195 30 NC_009813 Listeria phage B054, complete genome 961-990 8 0.733
NZ_CP012343_4 4.8|2564232|30|NZ_CP012343|CRISPRCasFinder,CRT 2564232-2564261 30 NC_014502 Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence 258370-258399 8 0.733
NZ_CP012343_1 1.39|378329|34|NZ_CP012343|CRT 378329-378362 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-31 9 0.735
NZ_CP012343_1 1.46|378761|34|NZ_CP012343|CRT 378761-378794 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21448-21481 9 0.735
NZ_CP012343_1 1.61|379769|34|NZ_CP012343|CRT 379769-379802 34 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 20508-20541 9 0.735
NZ_CP012343_4 4.2|2563836|30|NZ_CP012343|CRISPRCasFinder,CRT 2563836-2563865 30 AP013437 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C100-MedDCM-OCT-S33-C20 10992-11021 9 0.7
NZ_CP012343_4 4.3|2563902|30|NZ_CP012343|CRISPRCasFinder,CRT 2563902-2563931 30 MN693472 Marine virus AFVG_25M86, complete genome 26478-26507 9 0.7
NZ_CP012343_4 4.4|2563968|30|NZ_CP012343|CRISPRCasFinder,CRT 2563968-2563997 30 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 574828-574857 9 0.7
NZ_CP012343_4 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT 2564298-2564327 30 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 78159-78188 9 0.7
NZ_CP012343_4 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT 2564298-2564327 30 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 12355-12384 9 0.7
NZ_CP012343_4 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT 2564298-2564327 30 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 2689-2718 9 0.7
NZ_CP012343_4 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT 2564298-2564327 30 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 260503-260532 9 0.7
NZ_CP012343_4 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT 2564298-2564327 30 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 129223-129252 9 0.7
NZ_CP012343_4 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT 2564298-2564327 30 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 246224-246253 9 0.7
NZ_CP012343_4 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT 2564298-2564327 30 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 129223-129252 9 0.7
NZ_CP012343_4 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT 2564298-2564327 30 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 128731-128760 9 0.7
NZ_CP012343_4 4.11|2564430|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR 2564430-2564459 30 KT264770 Gokushovirus WZ-2015a isolate 22Mky17, complete genome 3570-3599 9 0.7
NZ_CP012343_1 1.34|378005|34|NZ_CP012343|CRT 378005-378038 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 10006-10039 10 0.706
NZ_CP012343_1 1.69|380219|34|NZ_CP012343|CRT 380219-380252 34 KX557288 Rhodococcus phage ChewyVIII, complete genome 22862-22895 10 0.706
NZ_CP012343_1 1.31|377843|34|NZ_CP012343|CRT 377843-377876 34 MK448815 Streptococcus phage Javan585, complete genome 19702-19735 11 0.676
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 MT740729 Ralstonia phage Bakoly, complete genome 5325-5358 11 0.676
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 MT740747 Ralstonia phage Simangalove, complete genome 39437-39470 11 0.676
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 MT740744 Ralstonia phage Jenny, complete genome 38564-38597 11 0.676
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 MT740735 Ralstonia phage Elie, complete genome 39420-39453 11 0.676
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 MT740746 Ralstonia phage Sarlave, complete genome 5030-5063 11 0.676
NZ_CP012343_1 1.59|379661|34|NZ_CP012343|CRT 379661-379694 34 MT740725 Ralstonia phage Adzire, complete genome 39287-39320 11 0.676

1. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP035140 (Leuconostoc mesenteroides strain SRCM103356 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgaaattacaaaagaccgtcataagcgt	CRISPR spacer
gacgaaattacaaaagaccgtcataagcgt	Protospacer
******************************

2. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagtgattcagactcagac	Protospacer
************************ *********

3. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagtgattcagactcagac	Protospacer
************************ *********

4. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagtgattcagactcagac	Protospacer
************************ *********

5. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagtgattcagactcagac	Protospacer
************************ *********

6. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagtgattcagactcagac	Protospacer
************************ *********

7. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagtgattcagactcagac	Protospacer
************************ *********

8. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactcggacagcgattcggactctgac	Protospacer
****************************** ***

9. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattcggacagcgactcggattccgac	Protospacer
.*********************************

10. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattcggacagcgactcggattccgac	Protospacer
.*********************************

11. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattccgattcggacagcgactcggattccgac	Protospacer
****** ***************************

12. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattccgattcggacagcgactcggattccgac	Protospacer
****** ***************************

13. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattccgattcggacagcgactcggattccgac	Protospacer
****** ***************************

14. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattccgattcggacagcgactcggattccgac	Protospacer
****** ***************************

15. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattccgattcggacagcgactcggattccgac	Protospacer
****** ***************************

16. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP035749 (Leuconostoc mesenteroides strain SRCM103460 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

gacgaaattacaaaagaccgtcataagcgt	CRISPR spacer
gacgaaattacaaaagaccgtcacaagcgt	Protospacer
***********************.******

17. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP028257 (Leuconostoc mesenteroides strain SRCM102735 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

gacgaaattacaaaagaccgtcataagcgt	CRISPR spacer
gacgaaattacaaaagaccgtcacaagcgt	Protospacer
***********************.******

18. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NC_018699 (Leuconostoc carnosum JB16 plasmid pKLC4, complete sequence) position: , mismatch: 1, identity: 0.967

gacgaaattacaaaagaccgtcataagcgt	CRISPR spacer
gacgaaattaccaaagaccgtcataagcgt	Protospacer
*********** ******************

19. spacer 4.13|2564562|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025993 (Lactobacillus plantarum subsp. plantarum strain LB1-2 plasmid pLB1-2B, complete sequence) position: , mismatch: 1, identity: 0.967

aatgccagtcctttgtattcacttttgtta	CRISPR spacer
aatgccagtcctttatattcacttttgtta	Protospacer
**************.***************

20. spacer 1.18|377003|40|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.95

cgactccgattccgatagtgattcggactcggatagcgac	CRISPR spacer
cgactccgattccgacagtgattcggactcggacagcgac	Protospacer
***************.*****************.******

21. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
tgactcggactccgacagtgac	Protospacer
******.**************.

22. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactcggactccgacagtgat	Protospacer
.*****.***************

23. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactcggactccgacagtgat	Protospacer
.*****.***************

24. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactcggactccgacagtgat	Protospacer
.*****.***************

25. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactcggactccgacagtgat	Protospacer
.*****.***************

26. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
tgactcggactccgacagtgac	Protospacer
******.**************.

27. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactcggactccgacagtgat	Protospacer
.*****.***************

28. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactcggactccgacagtgat	Protospacer
.*****.***************

29. spacer 1.28|377699|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactcggactccgacagtgat	Protospacer
.*****.***************

30. spacer 1.28|377699|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactccgactccgacagtgat	Protospacer
.***** ***************

31. spacer 1.28|377699|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
tgactccgactccgacagtgac	Protospacer
****** **************.

32. spacer 1.28|377699|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

tgactcagactccgacagtgat	CRISPR spacer
cgactcggactccgacagtgat	Protospacer
.*****.***************

33. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

34. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

35. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

36. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

37. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

38. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

39. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

40. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

41. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactcagac	Protospacer
.*********************** *********

42. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagtgattcagattcagac	Protospacer
************************ **.******

43. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagtgattcagattcagac	Protospacer
************************ **.******

44. spacer 1.34|378005|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattccgactcggacagcgactcagactcagac	CRISPR spacer
cgattccgactcagacagcgactcggactcagac	Protospacer
************.***********.*********

45. spacer 1.34|378005|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

cgattccgactcggacagcgactcagactcagac	CRISPR spacer
cgattccgactccgacagcgactcagactccgac	Protospacer
************ ***************** ***

46. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattccgactctgatagcgactccgattccgac	CRISPR spacer
cgattccgactctgacagcgactccgattccgac	Protospacer
.**************.******************

47. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattccgactctgatagcgactccgattccgac	CRISPR spacer
tgattccgactctgacagcgactcggattccgac	Protospacer
***************.******** *********

48. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattccgactctgatagcgactccgattccgac	CRISPR spacer
tgattccgactctgacagcgactcggattccgac	Protospacer
***************.******** *********

49. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattccgactctgatagcgactccgattccgac	CRISPR spacer
tgattccgactctgacagcgactcggattccgac	Protospacer
***************.******** *********

50. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattccgactctgatagcgactccgattccgac	CRISPR spacer
tgattccgactctgacagcgactcggattccgac	Protospacer
***************.******** *********

51. spacer 1.44|378635|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattcagactcagacagtgattccgattccgac	CRISPR spacer
tgattccgactccgacagtgattccgattccgac	Protospacer
****** ***** *********************

52. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
agactcagatagcgacagcgattcagactcagat	Protospacer
 *****************************.***

53. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattcggacagcgattcggactcggac	Protospacer
.***** ***************************

54. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactcggattcggacagcgattcggactctgac	Protospacer
****** *********************** ***

55. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactccgattcggacagtgattcggattcggac	Protospacer
******************.********.******

56. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactccgattctgacagcgattcggactctgac	Protospacer
************ ***************** ***

57. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactccgattcggacagcgactcggattcggac	Protospacer
*********************.*****.******

58. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactccgattcggacagcgattccgactcagac	Protospacer
************************ *****.***

59. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactcggattcggacagtgattcggactcggac	Protospacer
****** ***********.***************

60. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgattccgattccgacagcgattcggactcggac	Protospacer
***.******** *********************

61. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactccgattcggacagcgactctgactcggac	Protospacer
*********************.** *********

62. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactcggattcggacagtgattcggactcggac	Protospacer
****** ***********.***************

63. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactccgattcggacagcgattcggattccgac	Protospacer
***************************.** ***

64. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactcggacagcgactcggattcggac	Protospacer
*********************.*****.******

65. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgactcggattcggacagcgattcggactcggac	Protospacer
***.*****.************************

66. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactccgacagcgattcggactccgac	Protospacer
************ ***************** ***

67. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactccgacagcgattcggactccgac	Protospacer
************ ***************** ***

68. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactctgacagcgattcggactccgac	Protospacer
************ ***************** ***

69. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactctgacagcgattcggactctgac	Protospacer
************ ***************** ***

70. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggattcggacagcgattcggactctgac	Protospacer
*********.******************** ***

71. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggattcggacagcgattcggattcggac	Protospacer
*********.*****************.******

72. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggattcggacagcgattcggactctgac	Protospacer
*********.******************** ***

73. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggattcggacagcgattcggactccgac	Protospacer
*********.******************** ***

74. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggattcggacagcgattcggactccgac	Protospacer
*********.******************** ***

75. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactcggacagcgactcggattcggac	Protospacer
*********************.*****.******

76. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactccgacagcgattcggactccgac	Protospacer
************ ***************** ***

77. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactctgacagcgattcggactccgac	Protospacer
************ ***************** ***

78. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactccgacagcgattcggactccgac	Protospacer
************ ***************** ***

79. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactctgacagcgattcggactccgac	Protospacer
************ ***************** ***

80. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactctgacagcgattcggactccgac	Protospacer
************ ***************** ***

81. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattccgacagtgactccgattcggat	Protospacer
*********************.*****.******

82. spacer 1.64|379931|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

cgattcggatagtgattcggactcggac	CRISPR spacer
ggattcggacagtgattcggactcggac	Protospacer
 ********.******************

83. spacer 1.64|379931|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

cgattcggatagtgattcggactcggac	CRISPR spacer
cgattcggacagtgattcggattcggac	Protospacer
*********.***********.******

84. spacer 1.64|379931|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

cgattcggatagtgattcggactcggac	CRISPR spacer
cgattccgacagtgattcggactcggac	Protospacer
****** **.******************

85. spacer 1.64|379931|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.929

cgattcggatagtgattcggactcggac	CRISPR spacer
ggattcggacagtgattcggactcggac	Protospacer
 ********.******************

86. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 2, identity: 0.909

cgactcggattccgactcggat	CRISPR spacer
ggactcggattccgtctcggat	Protospacer
 ************* *******

87. spacer 1.67|380105|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cgactcggattccgactcggat	CRISPR spacer
cgactcggattccgactctgac	Protospacer
****************** **.

88. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 2, identity: 0.909

cgactcggattccgactcggat	CRISPR spacer
ggactcggattccgtctcggat	Protospacer
 ************* *******

89. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 2, identity: 0.909

cgactcggattccgactcggat	CRISPR spacer
ggactcggattccgtctcggat	Protospacer
 ************* *******

90. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 2, identity: 0.909

cgactcggattccgactcggat	CRISPR spacer
ggactcggattccgtctcggat	Protospacer
 ************* *******

91. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.909

cgactcggattccgactcggat	CRISPR spacer
ggactcggattccgtctcggat	Protospacer
 ************* *******

92. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 2, identity: 0.909

cgactcggattccgactcggat	CRISPR spacer
ggactcggattccgtctcggat	Protospacer
 ************* *******

93. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 2, identity: 0.909

cgactcggattccgactcggat	CRISPR spacer
ggactcggattccgtctcggat	Protospacer
 ************* *******

94. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattcggacagcgactcggattcggac	Protospacer
.***************************** ***

95. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattcggacagcgactcggattctgac	Protospacer
.*****************************.***

96. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgactccgattcggacagcgactcggattccgac	Protospacer
***.** ***************************

97. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgactccgattcggacagcgactcggattccgac	Protospacer
***.** ***************************

98. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattcggattctgacagtgactcggattccgac	Protospacer
************ *****.***************

99. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattcggactcggacagcgactccgattccgac	Protospacer
*********.************** *********

100. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattcggattcggacagcgactccgactccgac	Protospacer
************************ **.******

101. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgactcggattccgacagcgactcggattccgac	Protospacer
***.******** *********************

102. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgattcggattcggacagcgactccgactccgac	Protospacer
************************ **.******

103. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_LN890333 (Leuconostoc gelidum subsp. gasicomitatum KG16-1 isolate LEKG1 plasmid III, complete sequence) position: , mismatch: 2, identity: 0.933

gacgaaattacaaaagaccgtcataagcgt	CRISPR spacer
gacgagattaccaaagaccgtcataagcgt	Protospacer
*****.***** ******************

104. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP028268 (Pediococcus pentosaceus strain SRCM102739 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933

gacgaaattacaaaagaccgtcataagcgt	CRISPR spacer
gacgaaattaccaaagaccgtcataatcgt	Protospacer
*********** ************** ***

105. spacer 1.27|377645|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

tgactcagattccgacagtgactcagactcagac	CRISPR spacer
cgactcagattcagacagcgactcagactcagac	Protospacer
.*********** *****.***************

106. spacer 1.27|377645|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

tgactcagattccgacagtgactcagactcagac	CRISPR spacer
cgactcagattcagacagcgactcagactcagac	Protospacer
.*********** *****.***************

107. spacer 1.27|377645|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

tgactcagattccgacagtgactcagactcagac	CRISPR spacer
cgactcagattcagacagcgactcagactcagac	Protospacer
.*********** *****.***************

108. spacer 1.27|377645|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912

tgactcagattccgacagtgactcagactcagac	CRISPR spacer
cgactcagattcagacagcgactcagactcagac	Protospacer
.*********** *****.***************

109. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactctgac	Protospacer
.*********************** ***** ***

110. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactctgac	Protospacer
.*********************** ***** ***

111. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactctgac	Protospacer
.*********************** ***** ***

112. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagtgattcagactctgac	Protospacer
.*********************** ***** ***

113. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
tgattcagattcagacagcgactcagattcagat	Protospacer
****** ***** ********************.

114. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
tgattcagattcagacagcgactcagattcagat	Protospacer
****** ***** ********************.

115. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
tgattcagattcagacagcgactcagattcagat	Protospacer
****** ***** ********************.

116. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
tgattcagattcagacagcgactcagattcagat	Protospacer
****** ***** ********************.

117. spacer 1.55|379427|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

tgattcagactctgacagtgattcggattccgat	CRISPR spacer
tgattcggactctgacagcgattcggattccgac	Protospacer
******.***********.**************.

118. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
agactcagatagcgatagcgattcagactcagat	Protospacer
 **************.**************.***

119. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagactctgac	Protospacer
***.************************** **.

120. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgactcagacagcgacagcgattcagactcagac	Protospacer
*********.********************.**.

121. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
agactcagacagcgacagcgattcagactcagat	Protospacer
 ********.********************.***

122. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattcggacagcgattcggactccgac	Protospacer
.***** *********************** ***

123. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattcggacagcgattcggactccgac	Protospacer
.***** *********************** ***

124. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattcggacagcgattcggattcggac	Protospacer
.***** ********************.******

125. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactccgattctgacagcgattcggactccgac	Protospacer
.*********** ***************** ***

126. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattcggacagcgattcggactctgac	Protospacer
.***** *********************** ***

127. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattcggacagcgattcggactctgac	Protospacer
.***** *********************** ***

128. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattctgacagcgattcggactcggac	Protospacer
.***** ***** *********************

129. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactccgattccgacagcgattcggactctgac	Protospacer
.*********** ***************** ***

130. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactccgattccgacagtgattcggactcggac	Protospacer
.*********** *****.***************

131. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
ggactccgattcggacagcgattcggattccgac	Protospacer
 **************************.** ***

132. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattcggactcggacagcgattccgactctgac	Protospacer
.*********************** ***** ***

133. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattcggactcggacagcgactcggactctgac	Protospacer
.********************.******** ***

134. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattcggactctgacagcgattcggactctgac	Protospacer
.*********** ***************** ***

135. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattcggactcggacagcgactctgactcggac	Protospacer
.********************.** *********

136. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattcggactctgacagcgattcggactccgac	Protospacer
.*********** ***************** ***

137. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattcggactcggacagcgattcggattctgac	Protospacer
.**************************.** ***

138. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattcggattctgacagcgattcggactcggac	Protospacer
.********.** *********************

139. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcagattctgacagtgattcggattcggat	CRISPR spacer
cgactcggattctgacagtgattccgattcggac	Protospacer
******.***************** ********.

140. spacer 1.60|379715|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

cgactcagattctgacagtgattcggattcggat	CRISPR spacer
cgactcggattctgacagtgattcggactcggac	Protospacer
******.********************.*****.

141. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattccgacagcgattccgactccgac	Protospacer
******************.*********** **.

142. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattccgacagcgattccgactccgac	Protospacer
******************.*********** **.

143. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattccgacagtgactccgattcggac	Protospacer
*********************.*****.*****.

144. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggactccgacagtgattccgattcggac	Protospacer
*********.*****************.*****.

145. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggactccgacagtgattccgattcggac	Protospacer
*********.*****************.*****.

146. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggactccgacagtgattccgattcggac	Protospacer
*********.*****************.*****.

147. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggactccgacagtgattccgattcggac	Protospacer
*********.*****************.*****.

148. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattccgacagcgattccgactctgac	Protospacer
******************.*********** **.

149. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattccgacagtgactccgattcggac	Protospacer
*********************.*****.*****.

150. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattccgacagcgattccgactctgac	Protospacer
******************.*********** **.

151. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattccgacagcgattccgactccgac	Protospacer
******************.*********** **.

152. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattctgacagtgattccgattcggac	Protospacer
************.**************.*****.

153. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactccgattccgacagtgattcggactcggac	Protospacer
****** ***************** ********.

154. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggactccgacagtgattcggactcggac	Protospacer
*********.************** ********.

155. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactcggattctgacagtgattcggactcggac	Protospacer
************.*********** ********.

156. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgattcggattccgacagtgattccgactctgac	Protospacer
***.************************** **.

157. spacer 1.64|379931|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

cgattcggatagtgattcggactcggac	CRISPR spacer
ggattcggacagcgattcggactcggac	Protospacer
 ********.**.***************

158. spacer 1.64|379931|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

cgattcggatagtgattcggactcggac	CRISPR spacer
ggattccgacagtgattcggactcggac	Protospacer
 ***** **.******************

159. spacer 1.64|379931|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

cgattcggatagtgattcggactcggac	CRISPR spacer
ggattctgacagtgattcggactcggac	Protospacer
 ***** **.******************

160. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggactcggacagcgactcggattcggac	Protospacer
.********.******************** ***

161. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattctgacagcgactcggattcggac	Protospacer
.*********** ***************** ***

162. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattcggacagcgactcggattcggac	Protospacer
.**.************************** ***

163. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattcggacagcgactcggattcggac	Protospacer
.**.************************** ***

164. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggactctgacagcgactcggattccgac	Protospacer
.********.** *********************

165. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattcggacagcgattcggattcggac	Protospacer
.********************.******** ***

166. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattccgacagcgactcggattccgac	Protospacer
.**.******** *********************

167. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattccgacagcgactcggattccgac	Protospacer
.**.******** *********************

168. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattccgacagcgactcggattccgac	Protospacer
.**.******** *********************

169. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattcggacagcgactcggactccgac	Protospacer
.**.***********************.******

170. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattcggacagcgattcggactccgac	Protospacer
.********************.*****.******

171. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattccgacagcgactcggattccgac	Protospacer
.**.******** *********************

172. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattcggacagcgattcggactccgac	Protospacer
.********************.*****.******

173. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattccgacagcgactcggattccgac	Protospacer
.**.******** *********************

174. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgactcggattcggacagcgactcggattcggac	Protospacer
.**.************************** ***

175. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggactcggacagcgactcggattcggac	Protospacer
.********.******************** ***

176. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggactccgacagcgactcggattccgac	Protospacer
.********.** *********************

177. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggactccgacagcgactcggattccgac	Protospacer
.********.** *********************

178. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattctgacagcgactcggactccgac	Protospacer
.*********** **************.******

179. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattctgacagcgactccgattccgac	Protospacer
.*********** *********** *********

180. spacer 1.29|377741|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattccgacagtgattcggactcggac	Protospacer
 ***************** *****.**.

181. spacer 1.29|377741|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattccgacagtgattcggactctgac	Protospacer
 ***************** ***** **.

182. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattcagacagtgattcagactcagac	Protospacer
 ***** *********** ********.

183. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattccgacagtgattcggactctgac	Protospacer
 ***************** ***** **.

184. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattcagacagtgattcagactcagac	Protospacer
 ***** *********** ********.

185. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattcagacagtgattcagactcagac	Protospacer
 ***** *********** ********.

186. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattcagacagtgattcagactcagac	Protospacer
 ***** *********** ********.

187. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
ggattccgacagtgattcggactcggac	Protospacer
.***************** *****.**.

188. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattccgacagcgattctgactctgac	Protospacer
 ***********.*********** **.

189. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattccgacagtgattcggactctgac	Protospacer
 ***************** ***** **.

190. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
ggattccgacagtgattccgactctgac	Protospacer
.*****************.***** **.

191. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattccgacagtgattcggactctgac	Protospacer
 ***************** ***** **.

192. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
ggattccgacagtgactctgactctgac	Protospacer
.**************.******** **.

193. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

agattccgacagtgattctgactcagat	CRISPR spacer
cgattcagacagtgattcagactcagac	Protospacer
 ***** *********** ********.

194. spacer 1.34|378005|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

cgattccgactcggacagcgactcagactcagac	CRISPR spacer
tgattccgattcagacagcgactcagactcagat	Protospacer
.********.**.********************.

195. spacer 1.44|378635|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.882

tgattcagactcagacagtgattccgattccgac	CRISPR spacer
cgattcagactcagatagtgattccgattcagat	Protospacer
.**************.************** **.

196. spacer 1.55|379427|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

tgattcagactctgacagtgattcggattccgat	CRISPR spacer
cgattccgactctgacagtgattcggactccgac	Protospacer
.***** ********************.*****.

197. spacer 1.55|379427|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

tgattcagactctgacagtgattcggattccgat	CRISPR spacer
cgattccgactctgacagtgattcggactccgac	Protospacer
.***** ********************.*****.

198. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.************************   ***

199. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.************************   ***

200. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.************************   ***

201. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.************************   ***

202. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.************************   ***

203. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactccgattcggacagcgattccgacagcgac	Protospacer
************************ ***   ***

204. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

cgactcagattctgacagtgattcggattcggat	CRISPR spacer
tgactccgattctgacagtgactcggattcggac	Protospacer
.***** **************.***********.

205. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

cgactcagattctgacagtgattcggattcggat	CRISPR spacer
tgactccgattcggacagtgattcggattcggac	Protospacer
.***** ***** ********************.

206. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
tgactcggattcggacagtgattcggactcggac	Protospacer
.*********** *********** ********.

207. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
tgattcggattccgacagtgattcggactcggac	Protospacer
.**.******************** ********.

208. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
tgactcggattcggacagtgattcggactcggac	Protospacer
.*********** *********** ********.

209. spacer 2.1|1769846|26|NZ_CP012343|PILER-CR matches to AP014283 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C59, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 4, identity: 0.846

cattcaatgttccaagcccattagta	CRISPR spacer
cattaaatgttccatgcccattaaaa	Protospacer
**** ********* ********. *

210. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP025208 (Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence) position: , mismatch: 4, identity: 0.867

gacgaaattacaaaagaccgtcataagcgt	CRISPR spacer
gacgaaattaccaaagaccgtcatactcgc	Protospacer
*********** *************  **.

211. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 5, identity: 0.853

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
tgattccgactctgacagcgattcggattctgac	Protospacer
************ *****.*********  .***

212. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattcggattcggacagcgattcggattcggac	Protospacer
******.***********.*********   ***

213. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattcggattctgacagtgattcggattctgac	Protospacer
******.***** ***************  .***

214. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.853

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattcggattccgacagtgattcggattctgac	Protospacer
******.***** ***************  .***

215. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.853

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattcggattccgacagtgattcggattctgac	Protospacer
******.***** ***************  .***

216. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.******************** ***  .***

217. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.******************** ***  .***

218. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.******************** ***  .***

219. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.******************** ***  .***

220. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgactcagacagcgacagcgattcagatagcgac	Protospacer
*********.************** ***  .***

221. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.******************** ***  .***

222. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
tgactctgattcggacagcgattcggatagcgac	Protospacer
******.********************.   ***

223. spacer 1.62|379823|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.853

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactccgactccgacagtgactccgattcggac	Protospacer
****** ***************** ***   ***

224. spacer 1.62|379823|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcggactccgacagtgactccgattcggac	Protospacer
******.***************** ***   ***

225. spacer 1.62|379823|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcggactccgacagtgactccgattcggac	Protospacer
******.***************** ***   ***

226. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.853

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagattcagac	Protospacer
************ *****.*********   ***

227. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.853

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagattcagac	Protospacer
************ *****.*********   ***

228. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagattcagac	Protospacer
************ *****.*********   ***

229. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.853

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagattcagac	Protospacer
************ *****.*********   ***

230. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.853

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagattcagac	Protospacer
************ *****.*********   ***

231. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP020413 (Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

gacgaaattacaaaagaccgtcataagcgt-	CRISPR spacer
gacgaaattacaaaagatcgttac-ggcgta	Protospacer
*****************.***.*. .**** 

232. spacer 4.16|2564034|27|NZ_CP012343|PILER-CR matches to KC710998 (Shigella phage pSf-1, complete genome) position: , mismatch: 5, identity: 0.815

acgctatgcgttcgtatgtagcaactc	CRISPR spacer
gcgctatgcgttcgtaagtagcacttt	Protospacer
.*************** ****** .*.

233. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

agattccgacagtgattctgactcagat	CRISPR spacer
tgattccgacagtgattcggacagcgac	Protospacer
 ***************** ***   **.

234. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac	Protospacer
******************.***** **.   ***

235. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac	Protospacer
******************.***** **.   ***

236. spacer 1.32|377897|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattccgactccgacagtgattcggactctgac	Protospacer
.*********** **************.  .***

237. spacer 1.32|377897|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattccgactctgacagcgattcggattcggac	Protospacer
.*********** *****.*********   ***

238. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactccgacagtgattcggattcggac	Protospacer
.***** ***** ***************   ***

239. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattccgactccgacagcgattcggattctgac	Protospacer
.*********** *****.*********  .***

240. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactccgacagtgattcggattcggac	Protospacer
.***** ***** ***************   ***

241. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactcagacagtgattcagattcagac	Protospacer
.***** *****************.***   ***

242. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactcagacagtgattcagattcagac	Protospacer
.***** *****************.***   ***

243. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactcagacagtgattcagattcagac	Protospacer
.***** *****************.***   ***

244. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactcagacagtgattcagattcagac	Protospacer
.***** *****************.***   ***

245. spacer 1.33|377951|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactccgacagtgattcggattcggac	Protospacer
.***** ***** ***************   ***

246. spacer 1.33|377951|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
cgattctgactctgacagtgactcggattctgac	Protospacer
.*********** ********.******  .***

247. spacer 1.33|377951|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactccgacagtgattcggattcggac	Protospacer
.***** ***** ***************   ***

248. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactcagacagtgattcagattcagac	Protospacer
.***** *****************.***   ***

249. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactcagacagtgattcagattcagac	Protospacer
.***** *****************.***   ***

250. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactcagacagtgattcagattcagac	Protospacer
.***** *****************.***   ***

251. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
cgattcggactcagacagtgattcagattcagac	Protospacer
.***** *****************.***   ***

252. spacer 1.34|378005|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

cgattccgactcggacagcgactcagactcagac	CRISPR spacer
cgacagtgactcggacagcgactccgactctgac	Protospacer
***.  .***************** ***** ***

253. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
tgactccgattcggacagtgattcggattcggac	Protospacer
.**.** *********************   ***

254. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattcggattcggacagcgattcggactctgac	Protospacer
******.***********.********.  .***

255. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattcggattcggacagcgattcggactctgac	Protospacer
******.***********.********.  .***

256. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattcggattctgacagtgattcggactctgac	Protospacer
******.***** **************.  .***

257. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattccgattccgacagtgattcggactctgac	Protospacer
****** ***** **************.  .***

258. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.824

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
cgattccgattccgacagtgattcggactctgac	Protospacer
****** ***** **************.  .***

259. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac	Protospacer
.**.******************** ***  .***

260. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac	Protospacer
.**.******************** ***  .***

261. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
agactcagacagcgacagcgattcagatagcgac	Protospacer
 ********.************** ***  .***

262. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MH752840 (Escherichia phage vB_EcoM-Pr121LW, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagctctgattccgacagctgctcagattcagac	Protospacer
 ...*************** .*************

263. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MH491969 (Escherichia phage LL12, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagctctgattccgacagctgctcagattcagac	Protospacer
 ...*************** .*************

264. spacer 1.46|378761|34|NZ_CP012343|CRT matches to KT001917 (Escherichia phage Murica, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagctctgattccgacagctgctcagattcagac	Protospacer
 ...*************** .*************

265. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MT884010 (Escherichia phage vb_EcoM_bov22_2, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

266. spacer 1.46|378761|34|NZ_CP012343|CRT matches to LR694610 (Escherichia phage rV5_ev168 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

267. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MT884008 (Escherichia phage vb_EcoM_bov10K2, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

268. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MT884009 (Escherichia phage vb_EcoM_bov11CS3, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

269. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MK962749 (Shigella phage CM1, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

270. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850597 (Escherichia phage isim, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

271. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850578 (Escherichia phage nomo, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

272. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MT884011 (Escherichia phage vb_EcoM_bov25_3, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

273. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850612 (Escherichia phage magaca, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

274. spacer 1.46|378761|34|NZ_CP012343|CRT matches to LR699804 (Escherichia phage rV5_ev146 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

275. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065635 (UNVERIFIED: Campylobacter phage C12, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

276. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MK373780 (Escherichia phage vB_EcoM_HdK5, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

277. spacer 1.46|378761|34|NZ_CP012343|CRT matches to LR694611 (Escherichia phage rV5_ev158 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

278. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065653 (UNVERIFIED: Campylobacter phage C14, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

279. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850627 (Escherichia phage pangalan, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

280. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850595 (Escherichia phage naswa, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

281. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850576 (Escherichia phage ime, complete genome) position: , mismatch: 6, identity: 0.824

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagttctgattccgacagctgctcagattcagcc	Protospacer
 ..**************** .*********** *

282. spacer 1.55|379427|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

tgattcagactctgacagtgattcggattccgat	CRISPR spacer
tgattccgactctgacagcgattcggatagtgac	Protospacer
****** ***********.*********  .**.

283. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.***********************.   **.

284. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.***********************.   **.

285. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.***********************.   **.

286. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.***********************.   **.

287. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgactcagacagcgacagcgattcagatagcgac	Protospacer
*********.*****************.   **.

288. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
***.***********************.   **.

289. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
agactcagatagcgactccgattcagacagtgat	Protospacer
 ***************  **********   ***

290. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
agactcagatagcgactccgattcagacagtgat	Protospacer
 ***************  **********   ***

291. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgactcggactctgacagcgattcggatagcgac	Protospacer
***.******** **************.   ***

292. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattccgactccgacagcgattcggatagtgac	Protospacer
****** ***** **************.   ***

293. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattccgactccgacagcgattcggatagtgac	Protospacer
****** ***** **************.   ***

294. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgacagtgactctgacagcgattcggactccgac	Protospacer
***.   ***** ***************** ***

295. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattcggattcggacagcgattccgacagcgac	Protospacer
.********.************** ***   ***

296. spacer 1.59|379661|34|NZ_CP012343|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
cgattcggactccgacagcgattcgtcgacggtc	Protospacer
************ ************    *** *

297. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgactcagattctgacagtgattcggattcggat	CRISPR spacer
cgactcggattctgacagcgattcggatagcgac	Protospacer
******.***********.*********   **.

298. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824

cgactcagattctgacagtgattcggattcggat	CRISPR spacer
cgactcggattctgacagcgattcggatagcgac	Protospacer
******.***********.*********   **.

299. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
cgactctgattccgacagtgattcggacagcgac	Protospacer
****** ***************** ***   **.

300. spacer 1.62|379823|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactccgactccgacagtgactcggactctgac	Protospacer
****** *****************.**.  .***

301. spacer 1.62|379823|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactccgacagcgactcggactctgac	Protospacer
******************.*****.**.  .***

302. spacer 1.62|379823|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactccgacagcgactctgactcggac	Protospacer
******************.***** **.   ***

303. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagactcagac	Protospacer
************ *****.********.   ***

304. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagactcagac	Protospacer
************ *****.********.   ***

305. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagactcagac	Protospacer
************ *****.********.   ***

306. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagactcagac	Protospacer
************ *****.********.   ***

307. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagactcagac	Protospacer
************ *****.********.   ***

308. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagactcagac	Protospacer
************ *****.********.   ***

309. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
.*****************.***** ***   **.

310. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
.*****************.***** ***   **.

311. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
.*****************.***** ***   **.

312. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
.*****************.***** ***   **.

313. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
.*****************.***** ***   **.

314. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
.*****************.***** **.   ***

315. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
.*****************.***** **.   ***

316. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
.*****************.***** **.   ***

317. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
.*****************.***** **.   ***

318. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgattcagatagcgacagtgattccgactcagac	CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac	Protospacer
.*****************.***** **.   ***

319. spacer 1.32|377897|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattccgactcagacagcgactcggactcagac	Protospacer
.*****************.**.*****.   ***

320. spacer 1.32|377897|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattccgactctgacagcgattcggactctgac	Protospacer
.*********** *****.********.  .***

321. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattccgattccgacagtgattcggactctgac	Protospacer
.********.** **************.  .***

322. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
cgattccgattccgacagtgattcggactctgac	Protospacer
.********.** **************.  .***

323. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

324. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

325. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

326. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

327. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 7, identity: 0.794

tgattccgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

328. spacer 1.33|377951|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
cgattccgactccgacagtgattcggactctgac	Protospacer
.*****.***** **************.  .***

329. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.794

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

330. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

331. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

332. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

333. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 7, identity: 0.794

tgattctgactcagacagtgattcggatagcgac	CRISPR spacer
tgattcagactcagacagtgattcagactcagat	Protospacer
****** *****************.**.   **.

334. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
tgactcggattcggacagtgattcggactcggac	Protospacer
.**.**.********************.   ***

335. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
tgattcggattccgacagtgattcggactcggac	Protospacer
.*****.***** **************.   ***

336. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

cgattcagattcggacagtgattcggatagcgac	CRISPR spacer
tgactcggattcggacagtgattcggactcggac	Protospacer
.**.**.********************.   ***

337. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.******************** **.  .**.

338. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.******************** **.  .**.

339. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.******************** **.  .**.

340. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.******************** **.  .**.

341. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattccgattctgac	CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat	Protospacer
***.******************** **.  .**.

342. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065644 (UNVERIFIED: Campylobacter phage A147, complete genome) position: , mismatch: 7, identity: 0.794

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagctctgattccgacagctgctcagattcagcc	Protospacer
 ...*************** .*********** *

343. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065647 (UNVERIFIED: Campylobacter phage D#, complete genome) position: , mismatch: 7, identity: 0.794

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagctctgattccgacagctgctcagattcagcc	Protospacer
 ...*************** .*********** *

344. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065646 (UNVERIFIED: Campylobacter phage D1, complete genome) position: , mismatch: 7, identity: 0.794

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagctctgattccgacagctgctcagattcagcc	Protospacer
 ...*************** .*********** *

345. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065690 (UNVERIFIED: Campylobacter phage A135, complete genome) position: , mismatch: 7, identity: 0.794

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
aagctctgattccgacagctgctcagattcagcc	Protospacer
 ...*************** .*********** *

346. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac	Protospacer
.**.***********************.   **.

347. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac	Protospacer
.**.***********************.   **.

348. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
agactcagacagcgacagcgattcagatagcgac	Protospacer
 ********.*****************.   **.

349. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgactcagacagcgatagcgattcagatagcgac	Protospacer
*********.*****.***********.   **.

350. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tgactcagatagcgacagcgattcagactcggat	CRISPR spacer
tgattcagacagcgacagcgattcagatagcgac	Protospacer
***.*****.*****************.   **.

351. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattctgacagcgattcggatagcgac	Protospacer
.***** ***** **************.   ***

352. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

tgactccgattcggacagcgattcggactcggac	CRISPR spacer
cgactcggattctgacagcgattcggatagcgac	Protospacer
.***** ***** **************.   ***

353. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgacagtgactctgacagcgattcggactctgac	Protospacer
.**.   ***** ***************** ***

354. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
tgattccgactctgacagcgattcggatagtgac	Protospacer
.***** ***** **************.   ***

355. spacer 1.60|379715|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

cgactcagattctgacagtgattcggattcggat	CRISPR spacer
cgactctgattccgacagtgattcggacagcgac	Protospacer
****** *****.**************.   **.

356. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
tgactcagactcagacagcgactcagactcagac	Protospacer
.*********** *****.********.   ***

357. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

cgactcagactccgacagtgactcagatagcgac	CRISPR spacer
cgactcagactcagacagcgactcagactcagat	Protospacer
************ *****.********.   **.

358. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgacagtgattcggacagcgactccgactccgac	Protospacer
.**.   ***************** **.******

359. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
cgattcggattctgacagcgactctgacagtgac	Protospacer
.*********** *********** **.  .***

360. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactccgacagtgattcggactcggac	Protospacer
******.***** ************.*.   ***

361. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactccgacagtgattccgattcggac	Protospacer
******.***** *********** .**   ***

362. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactccgacagtgattccgattcggac	Protospacer
******.***** *********** .**   ***

363. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactccgacagtgattccgattcggac	Protospacer
******.***** *********** .**   ***

364. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactccgacagtgattccgattcggac	Protospacer
******.***** *********** .**   ***

365. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactctgacagtgattccgattcagac	Protospacer
******.***** *********** .**   ***

366. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactccgacagtgattccgattcagac	Protospacer
******.***** *********** .**   ***

367. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactctgactcggacagtgattccgactctgac	Protospacer
****** ***************** .*.  .***

368. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactctgactcggacagcgattcggactctgac	Protospacer
****** ***********.******.*.  .***

369. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcagactcagatagtgattccgattcagac	Protospacer
************.**.******** .**   ***

370. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcagactcagatagtgattcagattcagac	Protospacer
************.**.********..**   ***

371. spacer 4.5|2564034|30|NZ_CP012343|CRISPRCasFinder,CRT matches to KC710998 (Shigella phage pSf-1, complete genome) position: , mismatch: 7, identity: 0.767

acgctatgcgttcgtatgtagcaactcata	CRISPR spacer
gcgctatgcgttcgtaagtagcactttttg	Protospacer
.*************** ****** .*. *.

372. spacer 4.10|2564364|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 7, identity: 0.767

ccggtcgccaccgggacaagcccacaaaga	CRISPR spacer
ccggtcgccaccgggccaagccacccgggc	Protospacer
*************** ******  * ..* 

373. spacer 4.15|2563968|27|NZ_CP012343|PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.741

aatgattatgtggacgaacataatcag	CRISPR spacer
ggagattatgtggacgatcataattcc	Protospacer
.. ************** ******.  

374. spacer 1.18|377003|40|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.8

cgactccgattccgatagtgattcggactcggatagcgac	CRISPR spacer
cgactctgattccgacagtgattcggacagcgactccgac	Protospacer
******.********.************   **.  ****

375. spacer 1.39|378329|34|NZ_CP012343|CRT matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 8, identity: 0.765

--tgattccgactctgatagcgactccgattccgac	CRISPR spacer
gccga--ccgagtctgatagcgacttcgattggggc	Protospacer
  .**  **** *************.*****  *.*

376. spacer 1.55|379427|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

tgattcagactctgacagtgattcggattccgat	CRISPR spacer
cgacagtgactctgacagcgattcggactccgac	Protospacer
.**.   ***********.********.*****.

377. spacer 1.66|380051|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765

cgactcagattctgacagtgattcgcattcggat	CRISPR spacer
cgactctgattccgacagtgattcggacagcgac	Protospacer
****** *****.************ *.   **.

378. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactctgacagtgattccgactctgac	Protospacer
******.***** *********** .*.  .***

379. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcggactctgacagtgattccgactctgac	Protospacer
******.***** *********** .*.  .***

380. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
tgactcggattcggacagtgattcggactcggac	Protospacer
.*****.**.***************.*.   ***

381. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactctgactcggacagcgattcggactctgat	Protospacer
****** ***********.******.*.  .**.

382. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
tgactcggattcggacagtgattcggactcggac	Protospacer
.*****.**.***************.*.   ***

383. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactccgattcggacagtgattccgactctgac	Protospacer
****** **.************** .*.  .***

384. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactccgactcggacagcgattctgactctgac	Protospacer
****** ***********.***** .*.  .***

385. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcagactcagacagcgattcagattcagat	Protospacer
************.*****.*****..**   **.

386. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcagactcagatagtgattccgattcagat	Protospacer
************.**.******** .**   **.

387. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcagactcagatagtgattccgattcagat	Protospacer
************.**.******** .**   **.

388. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

cgactcagactcggacagtgattcgaatagcgac	CRISPR spacer
cgactcagactcagacagcgattcagattcagat	Protospacer
************.*****.*****..**   **.

389. spacer 4.7|2564166|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 8, identity: 0.733

ccaccag-----ttatcgcgattacttaacttatt	CRISPR spacer
-----aacgttcttatcgcgattacgtgacttatt	Protospacer
     *.     ************* *.*******

390. spacer 4.8|2564232|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NC_014502 (Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence) position: , mismatch: 8, identity: 0.733

gcctaggtcaagaactaactaaagagttag	CRISPR spacer
accacaatcaagaactaattaaagagtttt	Protospacer
.**  ..***********.*********  

391. spacer 1.39|378329|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.735

tgattccgactctgatagcgactccgattccgac	CRISPR spacer
tgacagcgactctgacagtgactccgattct---	Protospacer
***.  *********.**.***********.   

392. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.735

tgattctgattccgacagcgactcagattcagac	CRISPR spacer
agaagatacatcagatagcgactcagattcagac	Protospacer
 **   *.  ** **.******************

393. spacer 1.61|379769|34|NZ_CP012343|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 9, identity: 0.735

cgactcggattccgacagtgattccgactcggat	CRISPR spacer
ttaccggtattccggcagtgattcagactcggta	Protospacer
. **. * ******.********* *******  

394. spacer 4.2|2563836|30|NZ_CP012343|CRISPRCasFinder,CRT matches to AP013437 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C100-MedDCM-OCT-S33-C20) position: , mismatch: 9, identity: 0.7

cggcaagtaatcagctaggaggttcgcgcc	CRISPR spacer
gagcaggtaatcagctaggaggatcagctg	Protospacer
 .***.**************** **.  . 

395. spacer 4.3|2563902|30|NZ_CP012343|CRISPRCasFinder,CRT matches to MN693472 (Marine virus AFVG_25M86, complete genome) position: , mismatch: 9, identity: 0.7

tatggaatgggtcaagtttttcactcaatc	CRISPR spacer
ggagatatgggtcatgtttttcactcatca	Protospacer
 . *. ******** ************ . 

396. spacer 4.4|2563968|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.7

aatgattatgtggacgaacataatcagatg	CRISPR spacer
ggagattatgtggacgatcataattccacc	Protospacer
.. ************** ******.  *. 

397. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 9, identity: 0.7

tgtcactttctaatgaacttgcaaccatca	CRISPR spacer
cttcaatttctactgaacttgcaacttctt	Protospacer
. *** ****** ************. .. 

398. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.7

tgtcactttctaatgaacttgcaaccatca	CRISPR spacer
cttcaatttctactgaacttgcaacttctt	Protospacer
. *** ****** ************. .. 

399. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

tgtcactttctaatgaacttgcaaccatca	CRISPR spacer
cttcaatttctactgaacttgcaacttctt	Protospacer
. *** ****** ************. .. 

400. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7

tgtcactttctaatgaacttgcaaccatca	CRISPR spacer
cttcaatttctactgaacttgcaacttctt	Protospacer
. *** ****** ************. .. 

401. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 9, identity: 0.7

tgtcactttctaatgaacttgcaaccatca	CRISPR spacer
cttcaatttctactgaacttgcaacttctt	Protospacer
. *** ****** ************. .. 

402. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7

tgtcactttctaatgaacttgcaaccatca	CRISPR spacer
cttcaatttctactgaacttgcaacttctt	Protospacer
. *** ****** ************. .. 

403. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.7

tgtcactttctaatgaacttgcaaccatca	CRISPR spacer
cttcaatttctactgaacttgcaacttctt	Protospacer
. *** ****** ************. .. 

404. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7

tgtcactttctaatgaacttgcaaccatca	CRISPR spacer
cttcaatttctactgaacttgcaacttctt	Protospacer
. *** ****** ************. .. 

405. spacer 4.11|2564430|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR matches to KT264770 (Gokushovirus WZ-2015a isolate 22Mky17, complete genome) position: , mismatch: 9, identity: 0.7

acattgatgactatttcggcaaagaatatt	CRISPR spacer
tatctgatgacgaattcggcaaagaattga	Protospacer
   .******* * *************   

406. spacer 1.34|378005|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 10, identity: 0.706

cgattccgactcggacagcgactcagactcagac	CRISPR spacer
agaagatacatcagatagcgactcagactcagac	Protospacer
 **   ..  **.**.******************

407. spacer 1.69|380219|34|NZ_CP012343|CRT matches to KX557288 (Rhodococcus phage ChewyVIII, complete genome) position: , mismatch: 10, identity: 0.706

tgattcggattcggacagcgactcggattccgac	CRISPR spacer
tgcgaaacgctcggacaacgactcggatgccgac	Protospacer
**    . ..*******.********** *****

408. spacer 1.31|377843|34|NZ_CP012343|CRT matches to MK448815 (Streptococcus phage Javan585, complete genome) position: , mismatch: 11, identity: 0.676

cgattcggattcggatagtgattcagattccgac	CRISPR spacer
actttctgattcggatactgattcagaaacgctt	Protospacer
   *** ********** *********  *   .

409. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740729 (Ralstonia phage Bakoly, complete genome) position: , mismatch: 11, identity: 0.676

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca	Protospacer
 *  .  .************* ***.******  

410. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 11, identity: 0.676

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca	Protospacer
 *  .  .************* ***.******  

411. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740744 (Ralstonia phage Jenny, complete genome) position: , mismatch: 11, identity: 0.676

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca	Protospacer
 *  .  .************* ***.******  

412. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 11, identity: 0.676

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca	Protospacer
 *  .  .************* ***.******  

413. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 11, identity: 0.676

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca	Protospacer
 *  .  .************* ***.******  

414. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 11, identity: 0.676

cgattcggactcggacagcgattcggactcggac	CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca	Protospacer
 *  .  .************* ***.******  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 470090 : 479108 9 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_2 1347050 : 1384178 50 Lactobacillus_phage(60.0%) capsid,terminase,holin,tail,portal NA
DBSCAN-SWA_3 1591751 : 1600262 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 2787262 : 2898949 107 Tupanvirus(18.18%) protease,bacteriocin,tRNA NA
DBSCAN-SWA_5 3030187 : 3038811 11 Streptococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage