1. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP035140 (Leuconostoc mesenteroides strain SRCM103356 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gacgaaattacaaaagaccgtcataagcgt CRISPR spacer
gacgaaattacaaaagaccgtcataagcgt Protospacer
******************************
2. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagtgattcagactcagac Protospacer
************************ *********
3. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagtgattcagactcagac Protospacer
************************ *********
4. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagtgattcagactcagac Protospacer
************************ *********
5. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagtgattcagactcagac Protospacer
************************ *********
6. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagtgattcagactcagac Protospacer
************************ *********
7. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagtgattcagactcagac Protospacer
************************ *********
8. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactcggacagcgattcggactctgac Protospacer
****************************** ***
9. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattcggacagcgactcggattccgac Protospacer
.*********************************
10. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattcggacagcgactcggattccgac Protospacer
.*********************************
11. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattccgattcggacagcgactcggattccgac Protospacer
****** ***************************
12. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattccgattcggacagcgactcggattccgac Protospacer
****** ***************************
13. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattccgattcggacagcgactcggattccgac Protospacer
****** ***************************
14. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattccgattcggacagcgactcggattccgac Protospacer
****** ***************************
15. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.971
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattccgattcggacagcgactcggattccgac Protospacer
****** ***************************
16. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP035749 (Leuconostoc mesenteroides strain SRCM103460 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967
gacgaaattacaaaagaccgtcataagcgt CRISPR spacer
gacgaaattacaaaagaccgtcacaagcgt Protospacer
***********************.******
17. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP028257 (Leuconostoc mesenteroides strain SRCM102735 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967
gacgaaattacaaaagaccgtcataagcgt CRISPR spacer
gacgaaattacaaaagaccgtcacaagcgt Protospacer
***********************.******
18. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NC_018699 (Leuconostoc carnosum JB16 plasmid pKLC4, complete sequence) position: , mismatch: 1, identity: 0.967
gacgaaattacaaaagaccgtcataagcgt CRISPR spacer
gacgaaattaccaaagaccgtcataagcgt Protospacer
*********** ******************
19. spacer 4.13|2564562|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025993 (Lactobacillus plantarum subsp. plantarum strain LB1-2 plasmid pLB1-2B, complete sequence) position: , mismatch: 1, identity: 0.967
aatgccagtcctttgtattcacttttgtta CRISPR spacer
aatgccagtcctttatattcacttttgtta Protospacer
**************.***************
20. spacer 1.18|377003|40|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.95
cgactccgattccgatagtgattcggactcggatagcgac CRISPR spacer
cgactccgattccgacagtgattcggactcggacagcgac Protospacer
***************.*****************.******
21. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
tgactcggactccgacagtgac Protospacer
******.**************.
22. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactcggactccgacagtgat Protospacer
.*****.***************
23. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactcggactccgacagtgat Protospacer
.*****.***************
24. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactcggactccgacagtgat Protospacer
.*****.***************
25. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactcggactccgacagtgat Protospacer
.*****.***************
26. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
tgactcggactccgacagtgac Protospacer
******.**************.
27. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactcggactccgacagtgat Protospacer
.*****.***************
28. spacer 1.28|377699|22|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactcggactccgacagtgat Protospacer
.*****.***************
29. spacer 1.28|377699|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactcggactccgacagtgat Protospacer
.*****.***************
30. spacer 1.28|377699|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactccgactccgacagtgat Protospacer
.***** ***************
31. spacer 1.28|377699|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
tgactccgactccgacagtgac Protospacer
****** **************.
32. spacer 1.28|377699|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909
tgactcagactccgacagtgat CRISPR spacer
cgactcggactccgacagtgat Protospacer
.*****.***************
33. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
34. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
35. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
36. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
37. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
38. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
39. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
40. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
41. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactcagac Protospacer
.*********************** *********
42. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagtgattcagattcagac Protospacer
************************ **.******
43. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagtgattcagattcagac Protospacer
************************ **.******
44. spacer 1.34|378005|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattccgactcggacagcgactcagactcagac CRISPR spacer
cgattccgactcagacagcgactcggactcagac Protospacer
************.***********.*********
45. spacer 1.34|378005|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941
cgattccgactcggacagcgactcagactcagac CRISPR spacer
cgattccgactccgacagcgactcagactccgac Protospacer
************ ***************** ***
46. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattccgactctgatagcgactccgattccgac CRISPR spacer
cgattccgactctgacagcgactccgattccgac Protospacer
.**************.******************
47. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattccgactctgatagcgactccgattccgac CRISPR spacer
tgattccgactctgacagcgactcggattccgac Protospacer
***************.******** *********
48. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattccgactctgatagcgactccgattccgac CRISPR spacer
tgattccgactctgacagcgactcggattccgac Protospacer
***************.******** *********
49. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattccgactctgatagcgactccgattccgac CRISPR spacer
tgattccgactctgacagcgactcggattccgac Protospacer
***************.******** *********
50. spacer 1.39|378329|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattccgactctgatagcgactccgattccgac CRISPR spacer
tgattccgactctgacagcgactcggattccgac Protospacer
***************.******** *********
51. spacer 1.44|378635|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattcagactcagacagtgattccgattccgac CRISPR spacer
tgattccgactccgacagtgattccgattccgac Protospacer
****** ***** *********************
52. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
agactcagatagcgacagcgattcagactcagat Protospacer
*****************************.***
53. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattcggacagcgattcggactcggac Protospacer
.***** ***************************
54. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactcggattcggacagcgattcggactctgac Protospacer
****** *********************** ***
55. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactccgattcggacagtgattcggattcggac Protospacer
******************.********.******
56. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactccgattctgacagcgattcggactctgac Protospacer
************ ***************** ***
57. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactccgattcggacagcgactcggattcggac Protospacer
*********************.*****.******
58. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactccgattcggacagcgattccgactcagac Protospacer
************************ *****.***
59. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactcggattcggacagtgattcggactcggac Protospacer
****** ***********.***************
60. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgattccgattccgacagcgattcggactcggac Protospacer
***.******** *********************
61. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactccgattcggacagcgactctgactcggac Protospacer
*********************.** *********
62. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactcggattcggacagtgattcggactcggac Protospacer
****** ***********.***************
63. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactccgattcggacagcgattcggattccgac Protospacer
***************************.** ***
64. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactcggacagcgactcggattcggac Protospacer
*********************.*****.******
65. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgactcggattcggacagcgattcggactcggac Protospacer
***.*****.************************
66. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactccgacagcgattcggactccgac Protospacer
************ ***************** ***
67. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactccgacagcgattcggactccgac Protospacer
************ ***************** ***
68. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactctgacagcgattcggactccgac Protospacer
************ ***************** ***
69. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactctgacagcgattcggactctgac Protospacer
************ ***************** ***
70. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggattcggacagcgattcggactctgac Protospacer
*********.******************** ***
71. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggattcggacagcgattcggattcggac Protospacer
*********.*****************.******
72. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggattcggacagcgattcggactctgac Protospacer
*********.******************** ***
73. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggattcggacagcgattcggactccgac Protospacer
*********.******************** ***
74. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggattcggacagcgattcggactccgac Protospacer
*********.******************** ***
75. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactcggacagcgactcggattcggac Protospacer
*********************.*****.******
76. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactccgacagcgattcggactccgac Protospacer
************ ***************** ***
77. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactctgacagcgattcggactccgac Protospacer
************ ***************** ***
78. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactccgacagcgattcggactccgac Protospacer
************ ***************** ***
79. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactctgacagcgattcggactccgac Protospacer
************ ***************** ***
80. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactctgacagcgattcggactccgac Protospacer
************ ***************** ***
81. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattccgacagtgactccgattcggat Protospacer
*********************.*****.******
82. spacer 1.64|379931|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929
cgattcggatagtgattcggactcggac CRISPR spacer
ggattcggacagtgattcggactcggac Protospacer
********.******************
83. spacer 1.64|379931|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929
cgattcggatagtgattcggactcggac CRISPR spacer
cgattcggacagtgattcggattcggac Protospacer
*********.***********.******
84. spacer 1.64|379931|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929
cgattcggatagtgattcggactcggac CRISPR spacer
cgattccgacagtgattcggactcggac Protospacer
****** **.******************
85. spacer 1.64|379931|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.929
cgattcggatagtgattcggactcggac CRISPR spacer
ggattcggacagtgattcggactcggac Protospacer
********.******************
86. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 2, identity: 0.909
cgactcggattccgactcggat CRISPR spacer
ggactcggattccgtctcggat Protospacer
************* *******
87. spacer 1.67|380105|22|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909
cgactcggattccgactcggat CRISPR spacer
cgactcggattccgactctgac Protospacer
****************** **.
88. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 2, identity: 0.909
cgactcggattccgactcggat CRISPR spacer
ggactcggattccgtctcggat Protospacer
************* *******
89. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 2, identity: 0.909
cgactcggattccgactcggat CRISPR spacer
ggactcggattccgtctcggat Protospacer
************* *******
90. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 2, identity: 0.909
cgactcggattccgactcggat CRISPR spacer
ggactcggattccgtctcggat Protospacer
************* *******
91. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.909
cgactcggattccgactcggat CRISPR spacer
ggactcggattccgtctcggat Protospacer
************* *******
92. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 2, identity: 0.909
cgactcggattccgactcggat CRISPR spacer
ggactcggattccgtctcggat Protospacer
************* *******
93. spacer 1.67|380105|22|NZ_CP012343|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 2, identity: 0.909
cgactcggattccgactcggat CRISPR spacer
ggactcggattccgtctcggat Protospacer
************* *******
94. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattcggacagcgactcggattcggac Protospacer
.***************************** ***
95. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattcggacagcgactcggattctgac Protospacer
.*****************************.***
96. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgactccgattcggacagcgactcggattccgac Protospacer
***.** ***************************
97. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgactccgattcggacagcgactcggattccgac Protospacer
***.** ***************************
98. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattcggattctgacagtgactcggattccgac Protospacer
************ *****.***************
99. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattcggactcggacagcgactccgattccgac Protospacer
*********.************** *********
100. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattcggattcggacagcgactccgactccgac Protospacer
************************ **.******
101. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgactcggattccgacagcgactcggattccgac Protospacer
***.******** *********************
102. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.941
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgattcggattcggacagcgactccgactccgac Protospacer
************************ **.******
103. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_LN890333 (Leuconostoc gelidum subsp. gasicomitatum KG16-1 isolate LEKG1 plasmid III, complete sequence) position: , mismatch: 2, identity: 0.933
gacgaaattacaaaagaccgtcataagcgt CRISPR spacer
gacgagattaccaaagaccgtcataagcgt Protospacer
*****.***** ******************
104. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP028268 (Pediococcus pentosaceus strain SRCM102739 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933
gacgaaattacaaaagaccgtcataagcgt CRISPR spacer
gacgaaattaccaaagaccgtcataatcgt Protospacer
*********** ************** ***
105. spacer 1.27|377645|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
tgactcagattccgacagtgactcagactcagac CRISPR spacer
cgactcagattcagacagcgactcagactcagac Protospacer
.*********** *****.***************
106. spacer 1.27|377645|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
tgactcagattccgacagtgactcagactcagac CRISPR spacer
cgactcagattcagacagcgactcagactcagac Protospacer
.*********** *****.***************
107. spacer 1.27|377645|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
tgactcagattccgacagtgactcagactcagac CRISPR spacer
cgactcagattcagacagcgactcagactcagac Protospacer
.*********** *****.***************
108. spacer 1.27|377645|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912
tgactcagattccgacagtgactcagactcagac CRISPR spacer
cgactcagattcagacagcgactcagactcagac Protospacer
.*********** *****.***************
109. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactctgac Protospacer
.*********************** ***** ***
110. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactctgac Protospacer
.*********************** ***** ***
111. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactctgac Protospacer
.*********************** ***** ***
112. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagtgattcagactctgac Protospacer
.*********************** ***** ***
113. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
tgattctgattccgacagcgactcagattcagac CRISPR spacer
tgattcagattcagacagcgactcagattcagat Protospacer
****** ***** ********************.
114. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
tgattctgattccgacagcgactcagattcagac CRISPR spacer
tgattcagattcagacagcgactcagattcagat Protospacer
****** ***** ********************.
115. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912
tgattctgattccgacagcgactcagattcagac CRISPR spacer
tgattcagattcagacagcgactcagattcagat Protospacer
****** ***** ********************.
116. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912
tgattctgattccgacagcgactcagattcagac CRISPR spacer
tgattcagattcagacagcgactcagattcagat Protospacer
****** ***** ********************.
117. spacer 1.55|379427|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
tgattcagactctgacagtgattcggattccgat CRISPR spacer
tgattcggactctgacagcgattcggattccgac Protospacer
******.***********.**************.
118. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
agactcagatagcgatagcgattcagactcagat Protospacer
**************.**************.***
119. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagactctgac Protospacer
***.************************** **.
120. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgactcagacagcgacagcgattcagactcagac Protospacer
*********.********************.**.
121. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
agactcagacagcgacagcgattcagactcagat Protospacer
********.********************.***
122. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattcggacagcgattcggactccgac Protospacer
.***** *********************** ***
123. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattcggacagcgattcggactccgac Protospacer
.***** *********************** ***
124. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattcggacagcgattcggattcggac Protospacer
.***** ********************.******
125. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactccgattctgacagcgattcggactccgac Protospacer
.*********** ***************** ***
126. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattcggacagcgattcggactctgac Protospacer
.***** *********************** ***
127. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattcggacagcgattcggactctgac Protospacer
.***** *********************** ***
128. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattctgacagcgattcggactcggac Protospacer
.***** ***** *********************
129. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactccgattccgacagcgattcggactctgac Protospacer
.*********** ***************** ***
130. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactccgattccgacagtgattcggactcggac Protospacer
.*********** *****.***************
131. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
tgactccgattcggacagcgattcggactcggac CRISPR spacer
ggactccgattcggacagcgattcggattccgac Protospacer
**************************.** ***
132. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattcggactcggacagcgattccgactctgac Protospacer
.*********************** ***** ***
133. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattcggactcggacagcgactcggactctgac Protospacer
.********************.******** ***
134. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattcggactctgacagcgattcggactctgac Protospacer
.*********** ***************** ***
135. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattcggactcggacagcgactctgactcggac Protospacer
.********************.** *********
136. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattcggactctgacagcgattcggactccgac Protospacer
.*********** ***************** ***
137. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattcggactcggacagcgattcggattctgac Protospacer
.**************************.** ***
138. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattcggattctgacagcgattcggactcggac Protospacer
.********.** *********************
139. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcagattctgacagtgattcggattcggat CRISPR spacer
cgactcggattctgacagtgattccgattcggac Protospacer
******.***************** ********.
140. spacer 1.60|379715|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
cgactcagattctgacagtgattcggattcggat CRISPR spacer
cgactcggattctgacagtgattcggactcggac Protospacer
******.********************.*****.
141. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattccgacagcgattccgactccgac Protospacer
******************.*********** **.
142. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattccgacagcgattccgactccgac Protospacer
******************.*********** **.
143. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattccgacagtgactccgattcggac Protospacer
*********************.*****.*****.
144. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggactccgacagtgattccgattcggac Protospacer
*********.*****************.*****.
145. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggactccgacagtgattccgattcggac Protospacer
*********.*****************.*****.
146. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggactccgacagtgattccgattcggac Protospacer
*********.*****************.*****.
147. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggactccgacagtgattccgattcggac Protospacer
*********.*****************.*****.
148. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattccgacagcgattccgactctgac Protospacer
******************.*********** **.
149. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattccgacagtgactccgattcggac Protospacer
*********************.*****.*****.
150. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattccgacagcgattccgactctgac Protospacer
******************.*********** **.
151. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattccgacagcgattccgactccgac Protospacer
******************.*********** **.
152. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattctgacagtgattccgattcggac Protospacer
************.**************.*****.
153. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactccgattccgacagtgattcggactcggac Protospacer
****** ***************** ********.
154. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggactccgacagtgattcggactcggac Protospacer
*********.************** ********.
155. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactcggattctgacagtgattcggactcggac Protospacer
************.*********** ********.
156. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgattcggattccgacagtgattccgactctgac Protospacer
***.************************** **.
157. spacer 1.64|379931|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
cgattcggatagtgattcggactcggac CRISPR spacer
ggattcggacagcgattcggactcggac Protospacer
********.**.***************
158. spacer 1.64|379931|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893
cgattcggatagtgattcggactcggac CRISPR spacer
ggattccgacagtgattcggactcggac Protospacer
***** **.******************
159. spacer 1.64|379931|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893
cgattcggatagtgattcggactcggac CRISPR spacer
ggattctgacagtgattcggactcggac Protospacer
***** **.******************
160. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggactcggacagcgactcggattcggac Protospacer
.********.******************** ***
161. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattctgacagcgactcggattcggac Protospacer
.*********** ***************** ***
162. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattcggacagcgactcggattcggac Protospacer
.**.************************** ***
163. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattcggacagcgactcggattcggac Protospacer
.**.************************** ***
164. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggactctgacagcgactcggattccgac Protospacer
.********.** *********************
165. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattcggacagcgattcggattcggac Protospacer
.********************.******** ***
166. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattccgacagcgactcggattccgac Protospacer
.**.******** *********************
167. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattccgacagcgactcggattccgac Protospacer
.**.******** *********************
168. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattccgacagcgactcggattccgac Protospacer
.**.******** *********************
169. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattcggacagcgactcggactccgac Protospacer
.**.***********************.******
170. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattcggacagcgattcggactccgac Protospacer
.********************.*****.******
171. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattccgacagcgactcggattccgac Protospacer
.**.******** *********************
172. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattcggacagcgattcggactccgac Protospacer
.********************.*****.******
173. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattccgacagcgactcggattccgac Protospacer
.**.******** *********************
174. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgactcggattcggacagcgactcggattcggac Protospacer
.**.************************** ***
175. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggactcggacagcgactcggattcggac Protospacer
.********.******************** ***
176. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggactccgacagcgactcggattccgac Protospacer
.********.** *********************
177. spacer 1.69|380219|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggactccgacagcgactcggattccgac Protospacer
.********.** *********************
178. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattctgacagcgactcggactccgac Protospacer
.*********** **************.******
179. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.912
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattctgacagcgactccgattccgac Protospacer
.*********** *********** *********
180. spacer 1.29|377741|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattccgacagtgattcggactcggac Protospacer
***************** *****.**.
181. spacer 1.29|377741|28|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattccgacagtgattcggactctgac Protospacer
***************** ***** **.
182. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattcagacagtgattcagactcagac Protospacer
***** *********** ********.
183. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattccgacagtgattcggactctgac Protospacer
***************** ***** **.
184. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattcagacagtgattcagactcagac Protospacer
***** *********** ********.
185. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattcagacagtgattcagactcagac Protospacer
***** *********** ********.
186. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattcagacagtgattcagactcagac Protospacer
***** *********** ********.
187. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
ggattccgacagtgattcggactcggac Protospacer
.***************** *****.**.
188. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattccgacagcgattctgactctgac Protospacer
***********.*********** **.
189. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattccgacagtgattcggactctgac Protospacer
***************** ***** **.
190. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
ggattccgacagtgattccgactctgac Protospacer
.*****************.***** **.
191. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattccgacagtgattcggactctgac Protospacer
***************** ***** **.
192. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
ggattccgacagtgactctgactctgac Protospacer
.**************.******** **.
193. spacer 1.29|377741|28|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
agattccgacagtgattctgactcagat CRISPR spacer
cgattcagacagtgattcagactcagac Protospacer
***** *********** ********.
194. spacer 1.34|378005|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882
cgattccgactcggacagcgactcagactcagac CRISPR spacer
tgattccgattcagacagcgactcagactcagat Protospacer
.********.**.********************.
195. spacer 1.44|378635|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.882
tgattcagactcagacagtgattccgattccgac CRISPR spacer
cgattcagactcagatagtgattccgattcagat Protospacer
.**************.************** **.
196. spacer 1.55|379427|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882
tgattcagactctgacagtgattcggattccgat CRISPR spacer
cgattccgactctgacagtgattcggactccgac Protospacer
.***** ********************.*****.
197. spacer 1.55|379427|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882
tgattcagactctgacagtgattcggattccgat CRISPR spacer
cgattccgactctgacagtgattcggactccgac Protospacer
.***** ********************.*****.
198. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.************************ ***
199. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.************************ ***
200. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.************************ ***
201. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.************************ ***
202. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.************************ ***
203. spacer 1.58|379607|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactccgattcggacagcgattccgacagcgac Protospacer
************************ *** ***
204. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882
cgactcagattctgacagtgattcggattcggat CRISPR spacer
tgactccgattctgacagtgactcggattcggac Protospacer
.***** **************.***********.
205. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882
cgactcagattctgacagtgattcggattcggat CRISPR spacer
tgactccgattcggacagtgattcggattcggac Protospacer
.***** ***** ********************.
206. spacer 1.61|379769|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.882
cgactcggattccgacagtgattccgactcggat CRISPR spacer
tgactcggattcggacagtgattcggactcggac Protospacer
.*********** *********** ********.
207. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882
cgactcggattccgacagtgattccgactcggat CRISPR spacer
tgattcggattccgacagtgattcggactcggac Protospacer
.**.******************** ********.
208. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.882
cgactcggattccgacagtgattccgactcggat CRISPR spacer
tgactcggattcggacagtgattcggactcggac Protospacer
.*********** *********** ********.
209. spacer 2.1|1769846|26|NZ_CP012343|PILER-CR matches to AP014283 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C59, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 4, identity: 0.846
cattcaatgttccaagcccattagta CRISPR spacer
cattaaatgttccatgcccattaaaa Protospacer
**** ********* ********. *
210. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP025208 (Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence) position: , mismatch: 4, identity: 0.867
gacgaaattacaaaagaccgtcataagcgt CRISPR spacer
gacgaaattaccaaagaccgtcatactcgc Protospacer
*********** ************* **.
211. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 5, identity: 0.853
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
tgattccgactctgacagcgattcggattctgac Protospacer
************ *****.********* .***
212. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattcggattcggacagcgattcggattcggac Protospacer
******.***********.********* ***
213. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattcggattctgacagtgattcggattctgac Protospacer
******.***** *************** .***
214. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.853
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattcggattccgacagtgattcggattctgac Protospacer
******.***** *************** .***
215. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.853
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattcggattccgacagtgattcggattctgac Protospacer
******.***** *************** .***
216. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.******************** *** .***
217. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.******************** *** .***
218. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.******************** *** .***
219. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.******************** *** .***
220. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgactcagacagcgacagcgattcagatagcgac Protospacer
*********.************** *** .***
221. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.******************** *** .***
222. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853
tgactccgattcggacagcgattcggactcggac CRISPR spacer
tgactctgattcggacagcgattcggatagcgac Protospacer
******.********************. ***
223. spacer 1.62|379823|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.853
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactccgactccgacagtgactccgattcggac Protospacer
****** ***************** *** ***
224. spacer 1.62|379823|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcggactccgacagtgactccgattcggac Protospacer
******.***************** *** ***
225. spacer 1.62|379823|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.853
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcggactccgacagtgactccgattcggac Protospacer
******.***************** *** ***
226. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.853
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagattcagac Protospacer
************ *****.********* ***
227. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.853
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagattcagac Protospacer
************ *****.********* ***
228. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagattcagac Protospacer
************ *****.********* ***
229. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.853
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagattcagac Protospacer
************ *****.********* ***
230. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.853
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagattcagac Protospacer
************ *****.********* ***
231. spacer 4.1|2563770|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP020413 (Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
gacgaaattacaaaagaccgtcataagcgt- CRISPR spacer
gacgaaattacaaaagatcgttac-ggcgta Protospacer
*****************.***.*. .****
232. spacer 4.16|2564034|27|NZ_CP012343|PILER-CR matches to KC710998 (Shigella phage pSf-1, complete genome) position: , mismatch: 5, identity: 0.815
acgctatgcgttcgtatgtagcaactc CRISPR spacer
gcgctatgcgttcgtaagtagcacttt Protospacer
.*************** ****** .*.
233. spacer 1.29|377741|28|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
agattccgacagtgattctgactcagat CRISPR spacer
tgattccgacagtgattcggacagcgac Protospacer
***************** *** **.
234. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac Protospacer
******************.***** **. ***
235. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac Protospacer
******************.***** **. ***
236. spacer 1.32|377897|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattccgactccgacagtgattcggactctgac Protospacer
.*********** **************. .***
237. spacer 1.32|377897|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattccgactctgacagcgattcggattcggac Protospacer
.*********** *****.********* ***
238. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactccgacagtgattcggattcggac Protospacer
.***** ***** *************** ***
239. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattccgactccgacagcgattcggattctgac Protospacer
.*********** *****.********* .***
240. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactccgacagtgattcggattcggac Protospacer
.***** ***** *************** ***
241. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactcagacagtgattcagattcagac Protospacer
.***** *****************.*** ***
242. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactcagacagtgattcagattcagac Protospacer
.***** *****************.*** ***
243. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactcagacagtgattcagattcagac Protospacer
.***** *****************.*** ***
244. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactcagacagtgattcagattcagac Protospacer
.***** *****************.*** ***
245. spacer 1.33|377951|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactccgacagtgattcggattcggac Protospacer
.***** ***** *************** ***
246. spacer 1.33|377951|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
cgattctgactctgacagtgactcggattctgac Protospacer
.*********** ********.****** .***
247. spacer 1.33|377951|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactccgacagtgattcggattcggac Protospacer
.***** ***** *************** ***
248. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactcagacagtgattcagattcagac Protospacer
.***** *****************.*** ***
249. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactcagacagtgattcagattcagac Protospacer
.***** *****************.*** ***
250. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactcagacagtgattcagattcagac Protospacer
.***** *****************.*** ***
251. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
cgattcggactcagacagtgattcagattcagac Protospacer
.***** *****************.*** ***
252. spacer 1.34|378005|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
cgattccgactcggacagcgactcagactcagac CRISPR spacer
cgacagtgactcggacagcgactccgactctgac Protospacer
***. .***************** ***** ***
253. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
tgactccgattcggacagtgattcggattcggac Protospacer
.**.** ********************* ***
254. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattcggattcggacagcgattcggactctgac Protospacer
******.***********.********. .***
255. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattcggattcggacagcgattcggactctgac Protospacer
******.***********.********. .***
256. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattcggattctgacagtgattcggactctgac Protospacer
******.***** **************. .***
257. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattccgattccgacagtgattcggactctgac Protospacer
****** ***** **************. .***
258. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.824
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
cgattccgattccgacagtgattcggactctgac Protospacer
****** ***** **************. .***
259. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac Protospacer
.**.******************** *** .***
260. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac Protospacer
.**.******************** *** .***
261. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
agactcagacagcgacagcgattcagatagcgac Protospacer
********.************** *** .***
262. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MH752840 (Escherichia phage vB_EcoM-Pr121LW, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagctctgattccgacagctgctcagattcagac Protospacer
...*************** .*************
263. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MH491969 (Escherichia phage LL12, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagctctgattccgacagctgctcagattcagac Protospacer
...*************** .*************
264. spacer 1.46|378761|34|NZ_CP012343|CRT matches to KT001917 (Escherichia phage Murica, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagctctgattccgacagctgctcagattcagac Protospacer
...*************** .*************
265. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MT884010 (Escherichia phage vb_EcoM_bov22_2, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
266. spacer 1.46|378761|34|NZ_CP012343|CRT matches to LR694610 (Escherichia phage rV5_ev168 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
267. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MT884008 (Escherichia phage vb_EcoM_bov10K2, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
268. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MT884009 (Escherichia phage vb_EcoM_bov11CS3, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
269. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MK962749 (Shigella phage CM1, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
270. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850597 (Escherichia phage isim, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
271. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850578 (Escherichia phage nomo, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
272. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MT884011 (Escherichia phage vb_EcoM_bov25_3, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
273. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850612 (Escherichia phage magaca, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
274. spacer 1.46|378761|34|NZ_CP012343|CRT matches to LR699804 (Escherichia phage rV5_ev146 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
275. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065635 (UNVERIFIED: Campylobacter phage C12, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
276. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MK373780 (Escherichia phage vB_EcoM_HdK5, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
277. spacer 1.46|378761|34|NZ_CP012343|CRT matches to LR694611 (Escherichia phage rV5_ev158 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
278. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065653 (UNVERIFIED: Campylobacter phage C14, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
279. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850627 (Escherichia phage pangalan, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
280. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850595 (Escherichia phage naswa, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
281. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MN850576 (Escherichia phage ime, complete genome) position: , mismatch: 6, identity: 0.824
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagttctgattccgacagctgctcagattcagcc Protospacer
..**************** .*********** *
282. spacer 1.55|379427|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
tgattcagactctgacagtgattcggattccgat CRISPR spacer
tgattccgactctgacagcgattcggatagtgac Protospacer
****** ***********.********* .**.
283. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.***********************. **.
284. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.***********************. **.
285. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.***********************. **.
286. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.***********************. **.
287. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgactcagacagcgacagcgattcagatagcgac Protospacer
*********.*****************. **.
288. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
***.***********************. **.
289. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
agactcagatagcgactccgattcagacagtgat Protospacer
*************** ********** ***
290. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
agactcagatagcgactccgattcagacagtgat Protospacer
*************** ********** ***
291. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgactcggactctgacagcgattcggatagcgac Protospacer
***.******** **************. ***
292. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattccgactccgacagcgattcggatagtgac Protospacer
****** ***** **************. ***
293. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattccgactccgacagcgattcggatagtgac Protospacer
****** ***** **************. ***
294. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgacagtgactctgacagcgattcggactccgac Protospacer
***. ***** ***************** ***
295. spacer 1.59|379661|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattcggattcggacagcgattccgacagcgac Protospacer
.********.************** *** ***
296. spacer 1.59|379661|34|NZ_CP012343|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
cgattcggactcggacagcgattcggactcggac CRISPR spacer
cgattcggactccgacagcgattcgtcgacggtc Protospacer
************ ************ *** *
297. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgactcagattctgacagtgattcggattcggat CRISPR spacer
cgactcggattctgacagcgattcggatagcgac Protospacer
******.***********.********* **.
298. spacer 1.60|379715|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.824
cgactcagattctgacagtgattcggattcggat CRISPR spacer
cgactcggattctgacagcgattcggatagcgac Protospacer
******.***********.********* **.
299. spacer 1.61|379769|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
cgactcggattccgacagtgattccgactcggat CRISPR spacer
cgactctgattccgacagtgattcggacagcgac Protospacer
****** ***************** *** **.
300. spacer 1.62|379823|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactccgactccgacagtgactcggactctgac Protospacer
****** *****************.**. .***
301. spacer 1.62|379823|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactccgacagcgactcggactctgac Protospacer
******************.*****.**. .***
302. spacer 1.62|379823|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactccgacagcgactctgactcggac Protospacer
******************.***** **. ***
303. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagactcagac Protospacer
************ *****.********. ***
304. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagactcagac Protospacer
************ *****.********. ***
305. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagactcagac Protospacer
************ *****.********. ***
306. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagactcagac Protospacer
************ *****.********. ***
307. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagactcagac Protospacer
************ *****.********. ***
308. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.824
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagactcagac Protospacer
************ *****.********. ***
309. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
.*****************.***** *** **.
310. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
.*****************.***** *** **.
311. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
.*****************.***** *** **.
312. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
.*****************.***** *** **.
313. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
.*****************.***** *** **.
314. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
.*****************.***** **. ***
315. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
.*****************.***** **. ***
316. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
.*****************.***** **. ***
317. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
.*****************.***** **. ***
318. spacer 1.30|377789|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgattcagatagcgacagtgattccgactcagac CRISPR spacer
tgattcagatagcgacagcgattcagatagcgac Protospacer
.*****************.***** **. ***
319. spacer 1.32|377897|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattccgactcagacagcgactcggactcagac Protospacer
.*****************.**.*****. ***
320. spacer 1.32|377897|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattccgactctgacagcgattcggactctgac Protospacer
.*********** *****.********. .***
321. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattccgattccgacagtgattcggactctgac Protospacer
.********.** **************. .***
322. spacer 1.32|377897|34|NZ_CP012343|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
cgattccgattccgacagtgattcggactctgac Protospacer
.********.** **************. .***
323. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
324. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
325. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
326. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
327. spacer 1.32|377897|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 7, identity: 0.794
tgattccgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
328. spacer 1.33|377951|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
cgattccgactccgacagtgattcggactctgac Protospacer
.*****.***** **************. .***
329. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.794
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
330. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
331. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
332. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
333. spacer 1.33|377951|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 7, identity: 0.794
tgattctgactcagacagtgattcggatagcgac CRISPR spacer
tgattcagactcagacagtgattcagactcagat Protospacer
****** *****************.**. **.
334. spacer 1.42|378527|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
tgactcggattcggacagtgattcggactcggac Protospacer
.**.**.********************. ***
335. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
tgattcggattccgacagtgattcggactcggac Protospacer
.*****.***** **************. ***
336. spacer 1.42|378527|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
cgattcagattcggacagtgattcggatagcgac CRISPR spacer
tgactcggattcggacagtgattcggactcggac Protospacer
.**.**.********************. ***
337. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.******************** **. .**.
338. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.******************** **. .**.
339. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.******************** **. .**.
340. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.******************** **. .**.
341. spacer 1.43|378581|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattccgattctgac CRISPR spacer
tgattcagatagcgacagcgattcagacagcgat Protospacer
***.******************** **. .**.
342. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065644 (UNVERIFIED: Campylobacter phage A147, complete genome) position: , mismatch: 7, identity: 0.794
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagctctgattccgacagctgctcagattcagcc Protospacer
...*************** .*********** *
343. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065647 (UNVERIFIED: Campylobacter phage D#, complete genome) position: , mismatch: 7, identity: 0.794
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagctctgattccgacagctgctcagattcagcc Protospacer
...*************** .*********** *
344. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065646 (UNVERIFIED: Campylobacter phage D1, complete genome) position: , mismatch: 7, identity: 0.794
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagctctgattccgacagctgctcagattcagcc Protospacer
...*************** .*********** *
345. spacer 1.46|378761|34|NZ_CP012343|CRT matches to MG065690 (UNVERIFIED: Campylobacter phage A135, complete genome) position: , mismatch: 7, identity: 0.794
tgattctgattccgacagcgactcagattcagac CRISPR spacer
aagctctgattccgacagctgctcagattcagcc Protospacer
...*************** .*********** *
346. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac Protospacer
.**.***********************. **.
347. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
cgattcagatagcgacagcgattcagatagcgac Protospacer
.**.***********************. **.
348. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
agactcagacagcgacagcgattcagatagcgac Protospacer
********.*****************. **.
349. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgactcagacagcgatagcgattcagatagcgac Protospacer
*********.*****.***********. **.
350. spacer 1.56|379481|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tgactcagatagcgacagcgattcagactcggat CRISPR spacer
tgattcagacagcgacagcgattcagatagcgac Protospacer
***.*****.*****************. **.
351. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattctgacagcgattcggatagcgac Protospacer
.***** ***** **************. ***
352. spacer 1.58|379607|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
tgactccgattcggacagcgattcggactcggac CRISPR spacer
cgactcggattctgacagcgattcggatagcgac Protospacer
.***** ***** **************. ***
353. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgacagtgactctgacagcgattcggactctgac Protospacer
.**. ***** ***************** ***
354. spacer 1.59|379661|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgattcggactcggacagcgattcggactcggac CRISPR spacer
tgattccgactctgacagcgattcggatagtgac Protospacer
.***** ***** **************. ***
355. spacer 1.60|379715|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
cgactcagattctgacagtgattcggattcggat CRISPR spacer
cgactctgattccgacagtgattcggacagcgac Protospacer
****** *****.**************. **.
356. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
tgactcagactcagacagcgactcagactcagac Protospacer
.*********** *****.********. ***
357. spacer 1.62|379823|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
cgactcagactccgacagtgactcagatagcgac CRISPR spacer
cgactcagactcagacagcgactcagactcagat Protospacer
************ *****.********. **.
358. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgacagtgattcggacagcgactccgactccgac Protospacer
.**. ***************** **.******
359. spacer 1.69|380219|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
tgattcggattcggacagcgactcggattccgac CRISPR spacer
cgattcggattctgacagcgactctgacagtgac Protospacer
.*********** *********** **. .***
360. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactccgacagtgattcggactcggac Protospacer
******.***** ************.*. ***
361. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactccgacagtgattccgattcggac Protospacer
******.***** *********** .** ***
362. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactccgacagtgattccgattcggac Protospacer
******.***** *********** .** ***
363. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactccgacagtgattccgattcggac Protospacer
******.***** *********** .** ***
364. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactccgacagtgattccgattcggac Protospacer
******.***** *********** .** ***
365. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactctgacagtgattccgattcagac Protospacer
******.***** *********** .** ***
366. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactccgacagtgattccgattcagac Protospacer
******.***** *********** .** ***
367. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactctgactcggacagtgattccgactctgac Protospacer
****** ***************** .*. .***
368. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactctgactcggacagcgattcggactctgac Protospacer
****** ***********.******.*. .***
369. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcagactcagatagtgattccgattcagac Protospacer
************.**.******** .** ***
370. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcagactcagatagtgattcagattcagac Protospacer
************.**.********..** ***
371. spacer 4.5|2564034|30|NZ_CP012343|CRISPRCasFinder,CRT matches to KC710998 (Shigella phage pSf-1, complete genome) position: , mismatch: 7, identity: 0.767
acgctatgcgttcgtatgtagcaactcata CRISPR spacer
gcgctatgcgttcgtaagtagcactttttg Protospacer
.*************** ****** .*. *.
372. spacer 4.10|2564364|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 7, identity: 0.767
ccggtcgccaccgggacaagcccacaaaga CRISPR spacer
ccggtcgccaccgggccaagccacccgggc Protospacer
*************** ****** * ..*
373. spacer 4.15|2563968|27|NZ_CP012343|PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.741
aatgattatgtggacgaacataatcag CRISPR spacer
ggagattatgtggacgatcataattcc Protospacer
.. ************** ******.
374. spacer 1.18|377003|40|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.8
cgactccgattccgatagtgattcggactcggatagcgac CRISPR spacer
cgactctgattccgacagtgattcggacagcgactccgac Protospacer
******.********.************ **. ****
375. spacer 1.39|378329|34|NZ_CP012343|CRT matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 8, identity: 0.765
--tgattccgactctgatagcgactccgattccgac CRISPR spacer
gccga--ccgagtctgatagcgacttcgattggggc Protospacer
.** **** *************.***** *.*
376. spacer 1.55|379427|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765
tgattcagactctgacagtgattcggattccgat CRISPR spacer
cgacagtgactctgacagcgattcggactccgac Protospacer
.**. ***********.********.*****.
377. spacer 1.66|380051|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765
cgactcagattctgacagtgattcgcattcggat CRISPR spacer
cgactctgattccgacagtgattcggacagcgac Protospacer
****** *****.************ *. **.
378. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactctgacagtgattccgactctgac Protospacer
******.***** *********** .*. .***
379. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcggactctgacagtgattccgactctgac Protospacer
******.***** *********** .*. .***
380. spacer 1.70|380273|34|NZ_CP012343|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
tgactcggattcggacagtgattcggactcggac Protospacer
.*****.**.***************.*. ***
381. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactctgactcggacagcgattcggactctgat Protospacer
****** ***********.******.*. .**.
382. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
tgactcggattcggacagtgattcggactcggac Protospacer
.*****.**.***************.*. ***
383. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactccgattcggacagtgattccgactctgac Protospacer
****** **.************** .*. .***
384. spacer 1.70|380273|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactccgactcggacagcgattctgactctgac Protospacer
****** ***********.***** .*. .***
385. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcagactcagacagcgattcagattcagat Protospacer
************.*****.*****..** **.
386. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcagactcagatagtgattccgattcagat Protospacer
************.**.******** .** **.
387. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcagactcagatagtgattccgattcagat Protospacer
************.**.******** .** **.
388. spacer 1.70|380273|34|NZ_CP012343|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
cgactcagactcggacagtgattcgaatagcgac CRISPR spacer
cgactcagactcagacagcgattcagattcagat Protospacer
************.*****.*****..** **.
389. spacer 4.7|2564166|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 8, identity: 0.733
ccaccag-----ttatcgcgattacttaacttatt CRISPR spacer
-----aacgttcttatcgcgattacgtgacttatt Protospacer
*. ************* *.*******
390. spacer 4.8|2564232|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NC_014502 (Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence) position: , mismatch: 8, identity: 0.733
gcctaggtcaagaactaactaaagagttag CRISPR spacer
accacaatcaagaactaattaaagagtttt Protospacer
.** ..***********.*********
391. spacer 1.39|378329|34|NZ_CP012343|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.735
tgattccgactctgatagcgactccgattccgac CRISPR spacer
tgacagcgactctgacagtgactccgattct--- Protospacer
***. *********.**.***********.
392. spacer 1.46|378761|34|NZ_CP012343|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 9, identity: 0.735
tgattctgattccgacagcgactcagattcagac CRISPR spacer
agaagatacatcagatagcgactcagattcagac Protospacer
** *. ** **.******************
393. spacer 1.61|379769|34|NZ_CP012343|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 9, identity: 0.735
cgactcggattccgacagtgattccgactcggat CRISPR spacer
ttaccggtattccggcagtgattcagactcggta Protospacer
. **. * ******.********* *******
394. spacer 4.2|2563836|30|NZ_CP012343|CRISPRCasFinder,CRT matches to AP013437 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C100-MedDCM-OCT-S33-C20) position: , mismatch: 9, identity: 0.7
cggcaagtaatcagctaggaggttcgcgcc CRISPR spacer
gagcaggtaatcagctaggaggatcagctg Protospacer
.***.**************** **. .
395. spacer 4.3|2563902|30|NZ_CP012343|CRISPRCasFinder,CRT matches to MN693472 (Marine virus AFVG_25M86, complete genome) position: , mismatch: 9, identity: 0.7
tatggaatgggtcaagtttttcactcaatc CRISPR spacer
ggagatatgggtcatgtttttcactcatca Protospacer
. *. ******** ************ .
396. spacer 4.4|2563968|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.7
aatgattatgtggacgaacataatcagatg CRISPR spacer
ggagattatgtggacgatcataattccacc Protospacer
.. ************** ******. *.
397. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 9, identity: 0.7
tgtcactttctaatgaacttgcaaccatca CRISPR spacer
cttcaatttctactgaacttgcaacttctt Protospacer
. *** ****** ************. ..
398. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.7
tgtcactttctaatgaacttgcaaccatca CRISPR spacer
cttcaatttctactgaacttgcaacttctt Protospacer
. *** ****** ************. ..
399. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
tgtcactttctaatgaacttgcaaccatca CRISPR spacer
cttcaatttctactgaacttgcaacttctt Protospacer
. *** ****** ************. ..
400. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
tgtcactttctaatgaacttgcaaccatca CRISPR spacer
cttcaatttctactgaacttgcaacttctt Protospacer
. *** ****** ************. ..
401. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 9, identity: 0.7
tgtcactttctaatgaacttgcaaccatca CRISPR spacer
cttcaatttctactgaacttgcaacttctt Protospacer
. *** ****** ************. ..
402. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7
tgtcactttctaatgaacttgcaaccatca CRISPR spacer
cttcaatttctactgaacttgcaacttctt Protospacer
. *** ****** ************. ..
403. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.7
tgtcactttctaatgaacttgcaaccatca CRISPR spacer
cttcaatttctactgaacttgcaacttctt Protospacer
. *** ****** ************. ..
404. spacer 4.9|2564298|30|NZ_CP012343|CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7
tgtcactttctaatgaacttgcaaccatca CRISPR spacer
cttcaatttctactgaacttgcaacttctt Protospacer
. *** ****** ************. ..
405. spacer 4.11|2564430|30|NZ_CP012343|CRISPRCasFinder,CRT,PILER-CR matches to KT264770 (Gokushovirus WZ-2015a isolate 22Mky17, complete genome) position: , mismatch: 9, identity: 0.7
acattgatgactatttcggcaaagaatatt CRISPR spacer
tatctgatgacgaattcggcaaagaattga Protospacer
.******* * *************
406. spacer 1.34|378005|34|NZ_CP012343|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 10, identity: 0.706
cgattccgactcggacagcgactcagactcagac CRISPR spacer
agaagatacatcagatagcgactcagactcagac Protospacer
** .. **.**.******************
407. spacer 1.69|380219|34|NZ_CP012343|CRT matches to KX557288 (Rhodococcus phage ChewyVIII, complete genome) position: , mismatch: 10, identity: 0.706
tgattcggattcggacagcgactcggattccgac CRISPR spacer
tgcgaaacgctcggacaacgactcggatgccgac Protospacer
** . ..*******.********** *****
408. spacer 1.31|377843|34|NZ_CP012343|CRT matches to MK448815 (Streptococcus phage Javan585, complete genome) position: , mismatch: 11, identity: 0.676
cgattcggattcggatagtgattcagattccgac CRISPR spacer
actttctgattcggatactgattcagaaacgctt Protospacer
*** ********** ********* * .
409. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740729 (Ralstonia phage Bakoly, complete genome) position: , mismatch: 11, identity: 0.676
cgattcggactcggacagcgattcggactcggac CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca Protospacer
* . .************* ***.******
410. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 11, identity: 0.676
cgattcggactcggacagcgattcggactcggac CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca Protospacer
* . .************* ***.******
411. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740744 (Ralstonia phage Jenny, complete genome) position: , mismatch: 11, identity: 0.676
cgattcggactcggacagcgattcggactcggac CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca Protospacer
* . .************* ***.******
412. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 11, identity: 0.676
cgattcggactcggacagcgattcggactcggac CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca Protospacer
* . .************* ***.******
413. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 11, identity: 0.676
cgattcggactcggacagcgattcggactcggac CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca Protospacer
* . .************* ***.******
414. spacer 1.59|379661|34|NZ_CP012343|CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 11, identity: 0.676
cgattcggactcggacagcgattcggactcggac CRISPR spacer
agcgcgcaactcggacagcgagtcgaactcggca Protospacer
* . .************* ***.******