Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012193 Burkholderia sp. HB1, complete sequence 1 crisprs csa3,DinG,cas3 0 1 0 0
NZ_CP012192 Burkholderia sp. HB1 chromosome 1, complete sequence 2 crisprs WYL,cas3,csa3,DinG,DEDDh 0 2 3 0

Results visualization

1. NZ_CP012193
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012193_1 2027440-2027586 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1258625-1258649 1 0.96
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1258673-1258697 1 0.96
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1258720-1258744 1 0.96
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1263294-1263318 1 0.96
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1263342-1263366 1 0.96
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1263389-1263413 1 0.96
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1258767-1258791 2 0.92
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1263436-1263460 2 0.92
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1258811-1258835 3 0.88
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1263480-1263504 3 0.88
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 445467-445491 4 0.84
NZ_CP012193_1 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder 2027463-2027487 25 NC_018696 Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence 676437-676461 4 0.84

1. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 1, identity: 0.96

gagctttgcatgggaccggagtaag	CRISPR spacer
gagctttgcatgggatcggagtaag	Protospacer
***************.*********

2. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 1, identity: 0.96

gagctttgcatgggaccggagtaag	CRISPR spacer
gagctttgcatgggatcggagtaag	Protospacer
***************.*********

3. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 1, identity: 0.96

gagctttgcatgggaccggagtaag	CRISPR spacer
gagctttgcatgggaccggactaag	Protospacer
******************** ****

4. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 1, identity: 0.96

gagctttgcatgggaccggagtaag	CRISPR spacer
gagctttgcatgggatcggagtaag	Protospacer
***************.*********

5. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 1, identity: 0.96

gagctttgcatgggaccggagtaag	CRISPR spacer
gagctttgcatgggatcggagtaag	Protospacer
***************.*********

6. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 1, identity: 0.96

gagctttgcatgggaccggagtaag	CRISPR spacer
gagctttgcatgggaccggactaag	Protospacer
******************** ****

7. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 2, identity: 0.92

gagctttgcatgggaccggagtaag	CRISPR spacer
gagccttgcatgggaccggactaag	Protospacer
****.*************** ****

8. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 2, identity: 0.92

gagctttgcatgggaccggagtaag	CRISPR spacer
gagccttgcatgggaccggactaag	Protospacer
****.*************** ****

9. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.88

gagctttgcatgggaccggagtaag	CRISPR spacer
tagctgtgcataggaccggagtaag	Protospacer
 **** *****.*************

10. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.88

gagctttgcatgggaccggagtaag	CRISPR spacer
tagctgtgcataggaccggagtaag	Protospacer
 **** *****.*************

11. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

gagctttgcatgggaccggagtaag	CRISPR spacer
aggctttgcatgggacgtgagtaag	Protospacer
..**************  *******

12. spacer 1.1|2027463|25|NZ_CP012193|CRISPRCasFinder matches to NC_018696 (Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence) position: , mismatch: 4, identity: 0.84

gagctttgcatgggaccggagtaag	CRISPR spacer
ctgctctgcatgggacgggagtaag	Protospacer
  ***.********** ********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP012192
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012192_1 2698090-2698239 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012192_2 3437377-3437463 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 91986-92015 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 91360-91389 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 91377-91406 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1896378-1896407 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 91360-91389 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 130412-130441 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1872768-1872797 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 106842-106871 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 106842-106871 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1900045-1900074 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 106816-106845 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 106814-106843 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 61746-61775 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 51152-51181 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 557657-557686 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 556893-556922 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1863996-1864025 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 849079-849108 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 338369-338398 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 310425-310454 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1936878-1936907 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1011745-1011774 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 151260-151289 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 71389-71418 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 94757-94786 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 72691-72720 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 130398-130427 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 231441-231470 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1801203-1801232 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 72372-72401 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 689577-689606 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1111356-1111385 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 304058-304087 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 74015-74044 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 76475-76504 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 71453-71482 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 71458-71487 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 72341-72370 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 71439-71468 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 74033-74062 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 89992-90021 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 72389-72418 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 74188-74217 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 89992-90021 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 72389-72418 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 89992-90021 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 74188-74217 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 89992-90021 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 72389-72418 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 72389-72418 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 72389-72418 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 73908-73937 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 74188-74217 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 76476-76505 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 76472-76501 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 73910-73939 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 74816-74845 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 71211-71240 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 74188-74217 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 89992-90021 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 74188-74217 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 74188-74217 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 72389-72418 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 72764-72793 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 87436-87465 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 72764-72793 4 0.867
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_024957 Methylibium sp. T29 plasmid pT29A, complete sequence 18961-18990 5 0.833
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_024958 Methylibium sp. T29-B plasmid pT29B, complete sequence 18956-18985 5 0.833
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP015043 Rhodovulum sp. P5 plasmid pRGUI04, complete sequence 49953-49982 5 0.833
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 253663-253692 6 0.8
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 901568-901597 6 0.8
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP039643 Azospirillum sp. TSA2s plasmid p3 15179-15208 6 0.8
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 284122-284151 6 0.8
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 27581-27610 6 0.8
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NC_028969 Brevibacillus phage Osiris, complete genome 42075-42104 6 0.8
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 KT151958 Brevibacillus phage Powder, complete genome 42112-42141 6 0.8
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NC_029029 Brevibacillus phage Abouo, complete genome 34160-34189 6 0.8
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NC_022980 Brevibacillus phage Davies, complete genome 35303-35332 6 0.8
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 MN317029 Aeromonas phage vB_AhyS-A18P4, complete genome 27244-27273 6 0.8
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 776610-776639 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 285126-285155 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 786226-786255 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 495031-495060 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 786227-786256 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 495085-495114 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 598624-598653 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 786233-786262 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 495040-495069 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 762883-762912 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 329044-329073 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 590597-590626 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1102212-1102241 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1102334-1102363 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1295818-1295847 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1102008-1102037 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1101954-1101983 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 802289-802318 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 494833-494862 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 471936-471965 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 361471-361500 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_KX839207 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-1, complete sequence 178769-178798 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP039920 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626c, complete sequence 115182-115211 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 53226-53255 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 366766-366795 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1673039-1673068 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 239152-239181 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 300573-300602 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 650906-650935 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 148242-148271 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 122845-122874 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 96217-96246 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 59742-59771 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 411596-411625 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 157387-157416 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 815268-815297 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP038639 Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence 304378-304407 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 31001-31030 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP026369 Klebsiella quasipneumoniae strain A708 plasmid pA708-1, complete sequence 155670-155699 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 58235-58264 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1807748-1807777 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 264493-264522 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 24929-24958 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 284884-284913 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP048637 Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence 133260-133289 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 MN175387 Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence 113307-113336 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 267614-267643 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 328985-329014 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 421050-421079 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1995450-1995479 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 268559-268588 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 879697-879726 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1257635-1257664 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 44691-44720 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 268873-268902 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 275908-275937 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 265655-265684 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 455461-455490 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 264738-264767 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 261937-261966 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 265902-265931 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 268890-268919 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 283349-283378 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 267642-267671 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 281681-281710 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 260508-260537 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 283349-283378 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 267642-267671 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 283349-283378 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 352826-352855 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 260511-260540 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 283349-283378 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 267642-267671 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 267642-267671 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 267642-267671 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1828993-1829022 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 260511-260540 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 275891-275920 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 275862-275891 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 272493-272522 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 270620-270649 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 266153-266182 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 260511-260540 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 283349-283378 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_MN101850 Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence 113270-113299 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_MN101853 Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence 113269-113298 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 281676-281705 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 260511-260540 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 260511-260540 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 267642-267671 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1811040-1811069 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 281682-281711 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1811040-1811069 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_MH011352 Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence 117336-117365 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_MH001166 Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence 116246-116275 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_MF344567 Klebsiella pneumoniae strain A708 plasmid pA708-IMP, complete sequence 204040-204069 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_MH892479 Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence 116246-116275 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_MF072965 Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence 86198-86227 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 274983-275012 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 268527-268556 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 279174-279203 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 216680-216709 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP021184 Sphingomonas wittichii DC-6 plasmid pDC03, complete sequence 23194-23223 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 262567-262596 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_000958 Deinococcus radiodurans R1 plasmid MP1, complete sequence 112777-112806 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP017427 Methylobacterium sp. XJLW plasmid unnamed1, complete sequence 76049-76078 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP053024 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence 12208-12237 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 279174-279203 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 272395-272424 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 272384-272413 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 279186-279215 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 279207-279236 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 279173-279202 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 616844-616873 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 275003-275032 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 706701-706730 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 198995-199024 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 275002-275031 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 207794-207823 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 392376-392405 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP047220 Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence 62772-62801 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 274998-275027 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP050118 Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence 89163-89192 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP050122 Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence 33665-33694 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 31513-31542 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 354028-354057 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP031502 Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence 44220-44249 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 868355-868384 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 196952-196981 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 91020-91049 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 97610-97639 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 99133-99162 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 91425-91454 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 98249-98278 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 48613-48642 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 119098-119127 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 803384-803413 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 89509-89538 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 400514-400543 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NC_015057 Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence 417370-417399 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 420350-420379 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 65766-65795 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 277508-277537 7 0.767
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NC_021347 Rhodococcus phage E3, complete genome 13731-13760 7 0.767
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 405176-405205 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 279091-279120 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 57456-57485 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 908481-908510 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 128843-128872 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP021405 Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence 102501-102530 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 386772-386801 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 520325-520354 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 176471-176500 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 37057-37086 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP019227 Xanthomonas oryzae pv. oryzae strain IX-280 plasmid pXOO43, complete sequence 30759-30788 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 166588-166617 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 728632-728661 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP013632 Rhizobium sp. N324 plasmid pRspN324b, complete sequence 330620-330649 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP020948 Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence 132957-132986 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 319756-319785 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3219791-3219820 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 360761-360790 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 371383-371412 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 2700-2729 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP032678 Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence 320870-320899 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 100264-100293 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 280499-280528 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NC_011371 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence 244295-244324 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 155993-156022 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 31186-31215 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 1400049-1400078 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 103731-103760 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 558990-559019 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 401945-401974 8 0.733
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP029051 Miniimonas sp. S16 plasmid pS16-2, complete sequence 10000-10029 8 0.733
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 588536-588565 8 0.733
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 222846-222875 8 0.733
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 727228-727257 8 0.733
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP027794 Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence 18107-18136 8 0.733
NZ_CP012192_1 1.3|2698192|30|NZ_CP012192|CRT 2698192-2698221 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 552489-552518 8 0.733
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1184809-1184838 9 0.7
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 679748-679777 9 0.7
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP017943 Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence 248648-248677 9 0.7
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 402641-402670 9 0.7
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP048631 Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence 63872-63901 9 0.7
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 676198-676227 9 0.7
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 405382-405411 9 0.7
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 871961-871990 9 0.7
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 137051-137080 10 0.667
NZ_CP012192_1 1.1|2698108|30|NZ_CP012192|CRT 2698108-2698137 30 NZ_CP026745 Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence 117764-117793 10 0.667

1. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

2. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

3. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

4. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

5. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

6. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

7. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

8. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

9. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

10. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

11. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

12. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

13. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

14. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

15. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

16. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

17. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

18. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

19. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

20. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

21. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

22. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

23. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

24. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

25. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

26. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

27. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

28. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

29. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

30. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

31. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

32. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

33. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

34. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

35. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

36. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

37. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

38. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

39. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

40. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

41. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

42. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

43. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

44. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

45. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

46. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

47. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

48. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

49. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

50. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

51. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

52. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

53. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

54. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

55. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

56. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

57. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

58. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

59. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

60. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

61. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

62. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

63. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

64. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

65. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

66. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

67. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

68. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

69. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

70. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

71. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

72. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

73. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

74. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

75. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

76. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867

ttcggtgcgctggtcgatgcgctg--gtcgat	CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg--	Protospacer
***** ****** ***********  ****  

77. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_024957 (Methylibium sp. T29 plasmid pT29A, complete sequence) position: , mismatch: 5, identity: 0.833

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
cccgatgcgctggtcgatgcgctgctcgac	Protospacer
..**.******************* ****.

78. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_024958 (Methylibium sp. T29-B plasmid pT29B, complete sequence) position: , mismatch: 5, identity: 0.833

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
cccgatgcgctggtcgatgcgctgctcgac	Protospacer
..**.******************* ****.

79. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 5, identity: 0.833

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ttcaccgcgctggtcgaggcgctggacgat	Protospacer
***. .*********** ******* ****

80. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
aacgatgcgcgggtcgatgcgctggtggct	Protospacer
  **.***** *************** * *

81. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.8

--ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gattc--cgcgcaggtcgatgcgctggtcgcc	Protospacer
  ***  .**** ***************** .

82. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039643 (Azospirillum sp. TSA2s plasmid p3) position: , mismatch: 6, identity: 0.8

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgcgccgctggtcgatgcgccggccgat	Protospacer
 ***   ***************.**.****

83. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 6, identity: 0.8

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaatggc	Protospacer
 **********************   **..

84. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 6, identity: 0.8

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaatggc	Protospacer
 **********************   **..

85. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_028969 (Brevibacillus phage Osiris, complete genome) position: , mismatch: 6, identity: 0.8

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ttcggtgcgctgttcggtgcgttgttacct	Protospacer
 *********** ******** ****   *

86. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to KT151958 (Brevibacillus phage Powder, complete genome) position: , mismatch: 6, identity: 0.8

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ttcggtgcgctgttcggtgcgttgttacct	Protospacer
 *********** ******** ****   *

87. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_029029 (Brevibacillus phage Abouo, complete genome) position: , mismatch: 6, identity: 0.8

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ttcggtgcgctgttcggtgcgttgttacct	Protospacer
 *********** ******** ****   *

88. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_022980 (Brevibacillus phage Davies, complete genome) position: , mismatch: 6, identity: 0.8

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ttcggtgcgctgttcggtgcgttgttacct	Protospacer
 *********** ******** ****   *

89. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to MN317029 (Aeromonas phage vB_AhyS-A18P4, complete genome) position: , mismatch: 6, identity: 0.8

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
gtcggtgcgcgggtcggtgccgtcgatgtt	Protospacer
********** ********* **   ** *

90. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

91. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

92. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

93. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

94. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

95. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

96. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

97. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

98. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

99. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

100. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

101. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

102. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

103. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

104. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

105. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

106. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

107. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacctgctggtcgatgcgctggccgag	Protospacer
 ***.. .*****************.*** 

108. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

109. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

110. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

111. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_KX839207 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

112. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039920 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626c, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
acctctgccgtggtcgatgcgctggtcgac	Protospacer
 .*  ***  *******************.

113. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ccccgcgcgcaggtcgatgcgctggtcgcc	Protospacer
..* *.**** ***************** .

114. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

115. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

116. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
acctctgccgtggtcgatgcgctggtcgac	Protospacer
 .*  ***  *******************.

117. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ccccgcgcgcaggtcgatgcgctggtcgcc	Protospacer
..* *.**** ***************** .

118. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

119. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

120. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

121. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gctggtgcgctggacgatgcgctggcggac	Protospacer
 ..********** ***********. **.

122. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gctggtgcgctggacgatgcgctggcggac	Protospacer
 ..********** ***********. **.

123. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
accccggccctggtcgatgcgctggtcaat	Protospacer
 .*   ** ******************.**

124. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

125. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

126. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gctggtgcgctggacgatgcgctggcggac	Protospacer
 ..********** ***********. **.

127. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
acctctgccgtggtcgatgcgctggtcgac	Protospacer
 .*  ***  *******************.

128. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026369 (Klebsiella quasipneumoniae strain A708 plasmid pA708-1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

129. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

130. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

131. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

132. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

133. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

134. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
acctctgccgtggtcgatgcgctggtcgac	Protospacer
 .*  ***  *******************.

135. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

136. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

137. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

138. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

139. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

140. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

141. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

142. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

143. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

144. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

145. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

146. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

147. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

148. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

149. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

150. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

151. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

152. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

153. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

154. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

155. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

156. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

157. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

158. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

159. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

160. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

161. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

162. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

163. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

164. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

165. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

166. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

167. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

168. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

169. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

170. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

171. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

172. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

173. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

174. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

175. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

176. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

177. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

178. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

179. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

180. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

181. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MN101853 (Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

182. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

183. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

184. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

185. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

186. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

187. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

188. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

189. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

190. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

191. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MH011352 (Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

192. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MH001166 (Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

193. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MF344567 (Klebsiella pneumoniae strain A708 plasmid pA708-IMP, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

194. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MH892479 (Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

195. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MF072965 (Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct	Protospacer
* .  .********.************* *

196. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

197. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

198. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

199. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgc----gctggtcgatgcgctggtcgat	CRISPR spacer
----gagccggggctgatcgatgcgctggtcgag	Protospacer
    * **    ****.**************** 

200. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP021184 (Sphingomonas wittichii DC-6 plasmid pDC03, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgcatgacgctggccgatgcgctggtctat	Protospacer
* *.  .******.************* **

201. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

202. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_000958 (Deinococcus radiodurans R1 plasmid MP1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gccgacgcgctggtggatgcgctggccgac	Protospacer
 .**..******** **********.***.

203. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gtgcgagcggtggtcgatgcgcaggtcgag	Protospacer
 *  * *** ************ ****** 

204. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP053024 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgcatgacgctggccgatgcgctggtctat	Protospacer
* *.  .******.************* **

205. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

206. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

207. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

208. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

209. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

210. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

211. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gacgcgccgctggtcgatgcgcgggccgat	Protospacer
  **   *************** **.****

212. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

213. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ttcggtgcgctggtcgatccggctctggaa	Protospacer
****************** ** .  * ** 

214. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gtgcgagcggtggtcgatgcgcaggtcgag	Protospacer
 *  * *** ************ ****** 

215. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

216. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgatgcgccggtcgatgcgctgcgtgtt	Protospacer
 ***.*****.*************  .* *

217. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

218. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tgcatgacgctggccgatgcgctggtctat	Protospacer
* *.  .******.************* **

219. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctg------gtcgatgcgctggtcgat	CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat	Protospacer
      *.****      ******************

220. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP050118 (Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gccgacgcgctggtggatgcgctggccgac	Protospacer
 .**..******** **********.***.

221. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP050122 (Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gccgacgcgctggtggatgcgctggccgac	Protospacer
 .**..******** **********.***.

222. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggcgaggggctggtcgacgcgctggtcgac	Protospacer
  **. * *********.***********.

223. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcaacgcgctggtcgatgcgctgtccgac	Protospacer
 **...****************** .***.

224. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP031502 (Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence) position: , mismatch: 7, identity: 0.767

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gccgacgcgctggtggatgcgctggccgac	Protospacer
 .**..******** **********.***.

225. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

226. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

227. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

228. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

229. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

230. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

231. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

232. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

233. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

234. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

235. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

236. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc	Protospacer
 **********************   .*..

237. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
gtcggtgcgctgatcggtgcggtttgctcc	Protospacer
************.********** * .  .

238. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggcccgctggtcggtgcggtgcgcgag	Protospacer
 ****. *****************. .** 

239. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat---	CRISPR spacer
gtcagcgcgctggtcggtgcgg---tcgagacg	Protospacer
***.*.****************   *.**    

240. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
atcggcgcgctggtcggtgccgtgatgggg	Protospacer
.****.************** *** * *. 

241. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 7, identity: 0.767

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgcttgccggtgcggtggtcgta	Protospacer
 ********** *.********** *.*  

242. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggcggtgcggtggtcgatgcgctgtgcttc	Protospacer
  ******* **************  *  .

243. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggcaagcggctggtcgacgcgctggtcgat	Protospacer
  *..   *********.************

244. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
cgacgtgcgcaggttgatgcgctggtcggc	Protospacer
.   ****** ***.*************..

245. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggcaagcggctggtcgacgcgctggtcgat	Protospacer
  *..   *********.************

246. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggcaagcggctggtggatgcgctggtcgat	Protospacer
  *..   ****** ***************

247. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gcgtttgcgctgatcgacgcgctggtcgaa	Protospacer
 .   *******.****.*********** 

248. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gatgtcccgctggttgatgcgctggtcgct	Protospacer
  .* . *******.************* *

249. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggcaagcggctggtcgacgcgctggtcgat	Protospacer
  *..   *********.************

250. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ctaagtgcgctggttgatgcgctggcttct	Protospacer
.* .**********.**********..  *

251. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gacgatgcgctggtcgattcgctggcgcag	Protospacer
  **.************* ******.  * 

252. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP019227 (Xanthomonas oryzae pv. oryzae strain IX-280 plasmid pXOO43, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ctcggtgcgctgctcgatgcgcctggtttt	Protospacer
.*********** *********. * .  *

253. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gagagggtcctggtcgatgcgctggccgat	Protospacer
   .* *. ****************.****

254. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
tccggtgcgctgatcgaagcgctggagacc	Protospacer
*.**********.**** *******  . .

255. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgatgcgccggtcgatgcgctgcatatt	Protospacer
 ***.*****.*************  .. *

256. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP020948 (Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgatgcgccggtcgatgcgctgcatatt	Protospacer
 ***.*****.*************  .. *

257. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ttcggggcgctggtcgatgcggcccgcaag	Protospacer
***** *************** .   *.* 

258. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gagtgcgcgctgggcgatgcgctcgtcgac	Protospacer
    *.******* ********* *****.

259. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ctaagtgcgctggttgatgcgctggcttct	Protospacer
.* .**********.**********..  *

260. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gccctgccgccggtcgatgcgctggtccat	Protospacer
 .*    ***.**************** **

261. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gtctatgcgctggccgatgcgctggtgcgg	Protospacer
 ** .********.************  . 

262. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
cccaccccgcaggtcgaggcgctggtcgat	Protospacer
..*. . *** ****** ************

263. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

---ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
aaatcc---acgctggtcaatgcgctggtcggg	Protospacer
   *.*   .********.************. 

264. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggcagtgcgccggtcgatgggctggtctgg	Protospacer
  *.******.******** ******* . 

265. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgatgcgccggtcgatgcgctgcgtatt	Protospacer
 ***.*****.*************  .. *

266. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgacgcgctggtcgatgcgctgaatgcc	Protospacer
 ***..******************. .* .

267. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
atcgatgcgccggtcgatgcgctgcatatt	Protospacer
 ***.*****.*************  .. *

268. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ctaagtgcgctggttgatgcgctggcttct	Protospacer
.* .**********.**********..  *

269. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ctttcggcgctcgtcgaggcgctggtcgac	Protospacer
.*.   ***** ***** ***********.

270. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggctttgcgctggtcggtgcggtggtcggc	Protospacer
  *  ***********.**** ******..

271. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 8, identity: 0.733

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gtctatgcgctggccgatgcgctggtgcgg	Protospacer
 ** .********.************  . 

272. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP029051 (Miniimonas sp. S16 plasmid pS16-2, complete sequence) position: , mismatch: 8, identity: 0.733

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
cgcggtgcggtggtcggtgcggtgtcgacg	Protospacer
  ******* ***************. .  

273. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.733

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggcgcgctggtcggtgcggtcaacggc	Protospacer
 ****.*****************   .*..

274. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 8, identity: 0.733

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggtgcgctggtcggtgcagtcaacggc	Protospacer
 *******************.**   .*..

275. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.733

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ctcggcgcgctggtcggtgcggtcaacggc	Protospacer
 ****.*****************   .*..

276. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP027794 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.733

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ttcggtgcgctggacggtgcggccgtggcg	Protospacer
 ************ ********.  * *  

277. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gtcggtgcgctggtcggtgcggtgtttgat	CRISPR spacer
ttcggtgcgctggtcgttgcggcggtgttg	Protospacer
 *************** *****.* *    

278. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.7

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
ggcaagcggctggtggatgcgctggtcgac	Protospacer
  *..   ****** **************.

279. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gcgattgcgctggtcggtgcgctgctcgtc	Protospacer
 . . ***********.******* *** .

280. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
cttacccggctggtcgaagcgctggtcgaa	Protospacer
.*.. .  ********* *********** 

281. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 9, identity: 0.7

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
cgtgatgcgctgctcgatgcgctggtgccg	Protospacer
. .*.******* *************    

282. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP048631 (Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence) position: , mismatch: 9, identity: 0.7

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gctttcgcgctgctcgatgcgctggacgag	Protospacer
 ..  .****** ************ *** 

283. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 9, identity: 0.7

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gcaggtgcgctggacgatccgctggtgctg	Protospacer
 . ********** **** *******    

284. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gacggggcgctggtcgaggcgctggcgcgc	Protospacer
  *** *********** *******.  ..

285. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gccaaccaactggtcaatgcgctggtcgat	Protospacer
 .*...  .******.**************

286. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 10, identity: 0.667

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
cagcagaagctggtcgatgcgctcgtcgag	Protospacer
.   . . *************** ***** 

287. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026745 (Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence) position: , mismatch: 10, identity: 0.667

ttcggtgcgctggtcgatgcgctggtcgat	CRISPR spacer
gagcgtgcgctggccgatgcgctggcgacc	Protospacer
    *********.***********. . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 573035 : 582107 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 2543884 : 2674619 113 Stx2-converting_phage(22.22%) tRNA,protease,integrase,transposase attL 2591205:2591222|attR 2635957:2635974
DBSCAN-SWA_3 3277521 : 3294043 18 Ralstonia_virus(16.67%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage