Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012479 Arthrobacter sp. ERGS1:01 isolate water chromosome, complete genome 6 crisprs cas3,RT,DinG,csa3,WYL,DEDDh 0 5 3 0
NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 2 crisprs csa3 0 2 1 0
NZ_CP012478 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP012479
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012479_1 167876-167956 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012479_2 272797-272936 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012479_3 727871-728012 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012479_4 2372467-2372784 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012479_5 3579612-3579700 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012479_6 3733842-3733941 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012479_1 1.1|167901|31|NZ_CP012479|CRISPRCasFinder 167901-167931 31 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 465604-465634 4 0.871
NZ_CP012479_4 4.7|2372737|30|NZ_CP012479|CRT 2372737-2372766 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1124639-1124668 5 0.833
NZ_CP012479_4 4.7|2372737|30|NZ_CP012479|CRT 2372737-2372766 30 MN103533 Mycobacterium phage Weirdo19, complete genome 51285-51314 5 0.833
NZ_CP012479_1 1.1|167901|31|NZ_CP012479|CRISPRCasFinder 167901-167931 31 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 397109-397139 6 0.806
NZ_CP012479_4 4.1|2372485|30|NZ_CP012479|CRT 2372485-2372514 30 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 168143-168172 6 0.8
NZ_CP012479_4 4.7|2372737|30|NZ_CP012479|CRT 2372737-2372766 30 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 38596-38625 6 0.8
NZ_CP012479_4 4.7|2372737|30|NZ_CP012479|CRT 2372737-2372766 30 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 11347-11376 6 0.8
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MN703405 Mycobacterium phage Aneem, complete genome 28285-28314 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MH338237 Mycobacterium phage Joselito, complete genome 28285-28314 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MK524507 Mycobacterium phage Orange, complete genome 27834-27863 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MK524514 Mycobacterium phage Bud, complete genome 27847-27876 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MN310547 Mycobacterium phage Hutc2, complete genome 27839-27868 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 NC_031257 Mycobacterium phage Mulciber, complete genome 27836-27865 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MH338236 Mycobacterium phage Ebony, complete genome 28247-28276 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MK494130 Mycobacterium phage Fibonacci, complete genome 27839-27868 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MK524511 Mycobacterium phage Bowtie, complete genome 28292-28321 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MK524519 Mycobacterium phage Salz, complete genome 28195-28224 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MK524513 Mycobacterium phage Munch, complete genome 28285-28314 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MF140410 Mycobacterium phage Et2Brutus, complete genome 28207-28236 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MH536828 Mycobacterium phage Snape, complete genome 27838-27867 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 KY471460 Mycobacterium phage Jabith, complete genome 28345-28374 7 0.767
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 MN892487 Mycobacterium phage Mabel, complete genome 28257-28286 7 0.767
NZ_CP012479_4 4.5|2372653|30|NZ_CP012479|CRT 2372653-2372682 30 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 268406-268435 7 0.767
NZ_CP012479_4 4.5|2372653|30|NZ_CP012479|CRT 2372653-2372682 30 NZ_CP016821 Rhodococcus sp. p52 plasmid pDF01, complete sequence 143329-143358 7 0.767
NZ_CP012479_4 4.1|2372485|30|NZ_CP012479|CRT 2372485-2372514 30 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 164007-164036 8 0.733
NZ_CP012479_4 4.1|2372485|30|NZ_CP012479|CRT 2372485-2372514 30 NC_007491 Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence 131520-131549 8 0.733
NZ_CP012479_4 4.1|2372485|30|NZ_CP012479|CRT 2372485-2372514 30 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 24479-24508 8 0.733
NZ_CP012479_4 4.1|2372485|30|NZ_CP012479|CRT 2372485-2372514 30 NZ_CP017303 Rhodococcus sp. YL-1 plasmid pYLL1 sequence 366042-366071 8 0.733
NZ_CP012479_4 4.1|2372485|30|NZ_CP012479|CRT 2372485-2372514 30 NZ_CP017304 Rhodococcus sp. YL-1 plasmid pYLL2 sequence 312452-312481 8 0.733
NZ_CP012479_4 4.1|2372485|30|NZ_CP012479|CRT 2372485-2372514 30 NZ_CP050125 Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence 26346-26375 8 0.733
NZ_CP012479_4 4.1|2372485|30|NZ_CP012479|CRT 2372485-2372514 30 NC_005073 Rhodococcus erythropolis linear plasmid pBD2, complete sequence 119503-119532 8 0.733
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 741535-741564 8 0.733
NZ_CP012479_4 4.3|2372569|30|NZ_CP012479|CRT 2372569-2372598 30 NZ_CP041197 Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence 16652-16681 8 0.733
NZ_CP012479_4 4.5|2372653|30|NZ_CP012479|CRT 2372653-2372682 30 NZ_CP041197 Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence 16652-16681 8 0.733
NZ_CP012479_1 1.1|167901|31|NZ_CP012479|CRISPRCasFinder 167901-167931 31 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 164173-164203 9 0.71
NZ_CP012479_1 1.1|167901|31|NZ_CP012479|CRISPRCasFinder 167901-167931 31 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 524521-524551 9 0.71
NZ_CP012479_4 4.5|2372653|30|NZ_CP012479|CRT 2372653-2372682 30 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 741535-741564 9 0.7

1. spacer 1.1|167901|31|NZ_CP012479|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.871

tcggtcggggcccctcgcggtcgtggcccca	CRISPR spacer
ccggccggggcccctcgcgggcgtggccccg	Protospacer
.***.*************** *********.

2. spacer 4.7|2372737|30|NZ_CP012479|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.833

--cgctgcggtgttcaccgaagtgttggcagc	CRISPR spacer
gtcgct--ggtcttcaccggagtgttggcagt	Protospacer
  ****  *** *******.***********.

3. spacer 4.7|2372737|30|NZ_CP012479|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.833

-cgctgcggtgttcaccgaagtgttggcagc	CRISPR spacer
acgc-gcggtgttccccgaagtgtgggccga	Protospacer
 *** ********* ********* *** * 

4. spacer 1.1|167901|31|NZ_CP012479|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

tcggtcggggcccctcgcggtcgtggcccca	CRISPR spacer
tcgcagcgggtccctcgcggccgtggcccca	Protospacer
***    ***.*********.**********

5. spacer 4.1|2372485|30|NZ_CP012479|CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8

ggttgccgaattcaccgaggtgttggcggc	CRISPR spacer
gcgtgccgggttcaccgaggtgttggtgac	Protospacer
*  *****..****************.*.*

6. spacer 4.7|2372737|30|NZ_CP012479|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 6, identity: 0.8

cgctgcggtgttcaccgaagtgttg-gcagc	CRISPR spacer
cgctgcggtgtccaccgcagtgtcatgccg-	Protospacer
***********.***** *****.. ** * 

7. spacer 4.7|2372737|30|NZ_CP012479|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cgctgcggtgttcaccgaagtgttg-gcagc	CRISPR spacer
cgctgcggtgtccaccgcagtgtcatgccg-	Protospacer
***********.***** *****.. ** * 

8. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MN703405 (Mycobacterium phage Aneem, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

9. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MH338237 (Mycobacterium phage Joselito, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

10. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MK524507 (Mycobacterium phage Orange, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

11. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MK524514 (Mycobacterium phage Bud, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

12. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MN310547 (Mycobacterium phage Hutc2, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

13. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to NC_031257 (Mycobacterium phage Mulciber, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

14. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MH338236 (Mycobacterium phage Ebony, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

15. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MK494130 (Mycobacterium phage Fibonacci, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

16. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MK524511 (Mycobacterium phage Bowtie, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

17. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MK524519 (Mycobacterium phage Salz, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

18. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MK524513 (Mycobacterium phage Munch, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

19. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MF140410 (Mycobacterium phage Et2Brutus, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

20. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MH536828 (Mycobacterium phage Snape, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

21. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to KY471460 (Mycobacterium phage Jabith, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

22. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to MN892487 (Mycobacterium phage Mabel, complete genome) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cgactacgtggtcaccgaggtgttcgcggc	Protospacer
 *    **** *******.***********

23. spacer 4.5|2372653|30|NZ_CP012479|CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgccgc	CRISPR spacer
cgcgcacgtgttcaccgacgtgttcggcgt	Protospacer
 **.  ************ ******* **.

24. spacer 4.5|2372653|30|NZ_CP012479|CRT matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 7, identity: 0.767

ggcagccgtgttcaccgaagtgttcgccgc	CRISPR spacer
cgcgcacgtgttcaccgacgtgttcggcgt	Protospacer
 **.  ************ ******* **.

25. spacer 4.1|2372485|30|NZ_CP012479|CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 8, identity: 0.733

ggttgccgaattcaccgaggtgttggcggc	CRISPR spacer
cgttgccggattcaccgtggtgttcgttct	Protospacer
 *******.******** ****** *.  .

26. spacer 4.1|2372485|30|NZ_CP012479|CRT matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 8, identity: 0.733

ggttgccgaattcaccgaggtgttggcggc	CRISPR spacer
cgttgccggattcaccgtggtgttcgttct	Protospacer
 *******.******** ****** *.  .

27. spacer 4.1|2372485|30|NZ_CP012479|CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.733

ggttgccgaattcaccgaggtgttggcggc	CRISPR spacer
cgttgccggattcaccgtggtgttcgttct	Protospacer
 *******.******** ****** *.  .

28. spacer 4.1|2372485|30|NZ_CP012479|CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 8, identity: 0.733

ggttgccgaattcaccgaggtgttggcggc	CRISPR spacer
cgttgccggattcaccgtggtgttcgttct	Protospacer
 *******.******** ****** *.  .

29. spacer 4.1|2372485|30|NZ_CP012479|CRT matches to NZ_CP017304 (Rhodococcus sp. YL-1 plasmid pYLL2 sequence) position: , mismatch: 8, identity: 0.733

ggttgccgaattcaccgaggtgttggcggc	CRISPR spacer
cgttgccggattcaccgtggtgttcgttct	Protospacer
 *******.******** ****** *.  .

30. spacer 4.1|2372485|30|NZ_CP012479|CRT matches to NZ_CP050125 (Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.733

ggttgccgaattcaccgaggtgttggcggc	CRISPR spacer
cgttgccggattcaccgtggtgttcgttct	Protospacer
 *******.******** ****** *.  .

31. spacer 4.1|2372485|30|NZ_CP012479|CRT matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 8, identity: 0.733

ggttgccgaattcaccgaggtgttggcggc	CRISPR spacer
cgttgccggattcaccgtggtgttcgttct	Protospacer
 *******.******** ****** *.  .

32. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
acgcgccctgttcaccgatgtgttcgcgat	Protospacer
.   *** ********** *********..

33. spacer 4.3|2372569|30|NZ_CP012479|CRT matches to NZ_CP041197 (Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence) position: , mismatch: 8, identity: 0.733

ggcagccgtgttcaccgaagtgttcgcggc	CRISPR spacer
cccagccgtgttcaccgatgagttccatcc	Protospacer
  **************** * ****    *

34. spacer 4.5|2372653|30|NZ_CP012479|CRT matches to NZ_CP041197 (Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence) position: , mismatch: 8, identity: 0.733

ggcagccgtgttcaccgaagtgttcgccgc	CRISPR spacer
cccagccgtgttcaccgatgagttccatcc	Protospacer
  **************** * ****  . *

35. spacer 1.1|167901|31|NZ_CP012479|CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.71

tcggtcggggcccctcgcggtcgtggcccca	CRISPR spacer
cggacgcgggcgcctcgcggtcgtggcccgc	Protospacer
. *..  **** *****************  

36. spacer 1.1|167901|31|NZ_CP012479|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.71

tcggtcggggcccctcgcggtcgtggcccca	CRISPR spacer
cggacgcgggcgcctcgcggtcgtggcccgt	Protospacer
. *..  **** *****************  

37. spacer 4.5|2372653|30|NZ_CP012479|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7

ggcagccgtgttcaccgaagtgttcgccgc	CRISPR spacer
acgcgccctgttcaccgatgtgttcgcgat	Protospacer
.   *** ********** ******** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1025060 : 1037691 14 Arthrobacter_phage(50.0%) portal,capsid,protease,head NA
DBSCAN-SWA_2 2383288 : 2447102 56 Bacillus_phage(22.22%) tail,plate,protease NA
DBSCAN-SWA_3 3182781 : 3190905 6 uncultured_virus(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP012477
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012477_1 4210-4433 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012477_2 175967-176073 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012477_2 2.1|175991|59|NZ_CP012477|CRISPRCasFinder 175991-176049 59 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 175991-176049 0 1.0
NZ_CP012477_1 1.1|4265|114|NZ_CP012477|CRISPRCasFinder 4265-4378 114 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 4265-4378 54 0.526

1. spacer 2.1|175991|59|NZ_CP012477|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcaccctcccaacactcgcaagctcgtgtcgggtccctcgggcgcgtgggcccaaag	CRISPR spacer
ccgcaccctcccaacactcgcaagctcgtgtcgggtccctcgggcgcgtgggcccaaag	Protospacer
***********************************************************

2. spacer 1.1|4265|114|NZ_CP012477|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 54, identity: 0.526

acaaacacaccacaccaccaaaacccaggccccacacacggggccgctcctgtttaacag	CRISPR spacer
acaaacacaccacaccaccaaaacccaggccccacacacggggccgctcctgtttaacag	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 640526 : 711505 57 Enterobacteria_phage(27.27%) transposase,integrase attL 662673:662687|attR 708613:708627
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage