Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016271 Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 0 crisprs csa3 0 0 1 0
NZ_CP016270 Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 chromosome, complete genome 2 crisprs DEDDh,cas3,csa3,RT,WYL,cas9,cas1,cas2,csn2,DinG 2 26 6 0
NZ_CP016272 Lactiplantibacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP016271
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6567 : 62667 53 Staphylococcus_phage(25.0%) integrase,transposase attL 33397:33418|attR 57721:57742
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP016270
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016270_1 320315-323619 Orphan NA
48 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016270_2 2455301-2455931 TypeII NA
9 spacers
csn2,cas2,cas1,cas9,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP016270_1 1.32|322564|31|NZ_CP016270|CRT 322564-322594 31 NZ_CP016270.1 320302-320332 1 0.968
NZ_CP016270_1 1.21|321940|31|NZ_CP016270|CRT 321940-321970 31 NZ_CP016270.1 323602-323632 2 0.935

1. spacer 1.32|322564|31|NZ_CP016270|CRT matches to position: 320302-320332, mismatch: 1, identity: 0.968

ttcggatagcgacagtgattccgattctgac	CRISPR spacer
ttcggatagcgacagtgattccgactctgac	Protospacer
************************.******

2. spacer 1.21|321940|31|NZ_CP016270|CRT matches to position: 323602-323632, mismatch: 2, identity: 0.935

ttcggattccgatagtgattcggactcagac	CRISPR spacer
ttcggattccgacagtgactcggactcagac	Protospacer
************.*****.************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016270_1 1.33|322618|19|NZ_CP016270|CRT 322618-322636 19 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19655-19673 0 1.0
NZ_CP016270_1 1.33|322618|19|NZ_CP016270|CRT 322618-322636 19 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20117-20135 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP032752 Lactobacillus plantarum subsp. argentoratensis strain DSM 16365 plasmid unnamed1, complete sequence 44248-44277 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP021472 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence 22320-22349 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP017356 Lactobacillus plantarum strain TMW 1.25 plasmid pL125-2, complete sequence 554-583 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP017366 Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-3, complete sequence 3851-3880 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP017381 Lactobacillus plantarum strain TMW 1.1623 plasmid pL11623-2, complete sequence 5167-5196 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP018868 Lactobacillus alimentarius DSM 20249 plasmid pLDW-11, complete sequence 44155-44184 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP028231 Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence 7973-8002 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP035557 Lactobacillus plantarum strain SRCM103297 plasmid unnamed1 6645-6674 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP035557 Lactobacillus plantarum strain SRCM103297 plasmid unnamed1 48912-48941 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP021933 Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence 52769-52798 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP016492 Lactobacillus pentosus strain BGM48 plasmid pBGM48-1, complete sequence 20119-20148 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NC_022114 Lactobacillus paracasei subsp. paracasei 8700:2 plasmid 1, complete sequence 11474-11503 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_AP014682 Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence 11051-11080 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NC_016608 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence 10937-10966 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP028242 Lactobacillus plantarum strain SRCM101518 plasmid unnamed1, complete sequence 8123-8152 0 1.0
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 43974-44003 0 1.0
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157606-157636 1 0.968
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156412-156442 1 0.968
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156412-156442 1 0.968
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156412-156442 1 0.968
NZ_CP016270_2 2.2|2455403|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455403-2455432 30 AY682195 Lactobacillus plantarum bacteriophage LP65, complete genome 8592-8621 1 0.967
NZ_CP016270_2 2.2|2455403|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455403-2455432 30 NC_006565 Lactobacillus phage LP65, complete genome 8592-8621 1 0.967
NZ_CP016270_2 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455734-2455763 30 NZ_CP046657 Lactobacillus plantarum strain 123-17 plasmid p123-18.1, complete sequence 10801-10830 1 0.967
NZ_CP016270_1 1.11|321238|31|NZ_CP016270|CRT 321238-321268 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154468-154498 2 0.935
NZ_CP016270_1 1.11|321238|31|NZ_CP016270|CRT 321238-321268 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1849-1879 2 0.935
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153616-153646 2 0.935
NZ_CP016270_1 1.21|321940|31|NZ_CP016270|CRT 321940-321970 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1543-1573 2 0.935
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21088-21118 2 0.935
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15475-15505 2 0.935
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15583-15613 2 0.935
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15709-15739 2 0.935
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9646-9676 2 0.935
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154774-154804 2 0.935
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155170-155200 2 0.935
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155224-155254 2 0.935
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155404-155434 2 0.935
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156430-156460 2 0.935
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156430-156460 2 0.935
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156430-156460 2 0.935
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153064-153094 2 0.935
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153934-153964 2 0.935
NZ_CP016270_2 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455668-2455697 30 AY682195 Lactobacillus plantarum bacteriophage LP65, complete genome 347-376 2 0.933
NZ_CP016270_2 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455668-2455697 30 NC_006565 Lactobacillus phage LP65, complete genome 347-376 2 0.933
NZ_CP016270_1 1.11|321238|31|NZ_CP016270|CRT 321238-321268 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1561-1591 3 0.903
NZ_CP016270_1 1.11|321238|31|NZ_CP016270|CRT 321238-321268 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2767-2797 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151843-151873 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154666-154696 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154882-154912 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155080-155110 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155314-155344 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151621-151651 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154648-154678 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157498-157528 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2653-2683 3 0.903
NZ_CP016270_1 1.24|322090|31|NZ_CP016270|CRT 322090-322120 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2785-2815 3 0.903
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21070-21100 3 0.903
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15457-15487 3 0.903
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15565-15595 3 0.903
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15691-15721 3 0.903
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9628-9658 3 0.903
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157318-157348 3 0.903
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1345-1375 3 0.903
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151639-151669 3 0.903
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151693-151723 3 0.903
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157354-157384 3 0.903
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157516-157546 3 0.903
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1561-1591 3 0.903
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151639-151669 3 0.903
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151693-151723 3 0.903
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157354-157384 3 0.903
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157516-157546 3 0.903
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1561-1591 3 0.903
NZ_CP016270_1 1.40|323026|31|NZ_CP016270|CRT 323026-323056 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1543-1573 3 0.903
NZ_CP016270_1 1.40|323026|31|NZ_CP016270|CRT 323026-323056 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2275-2305 3 0.903
NZ_CP016270_1 1.40|323026|31|NZ_CP016270|CRT 323026-323056 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3043-3073 3 0.903
NZ_CP016270_1 1.40|323026|31|NZ_CP016270|CRT 323026-323056 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156322-156352 3 0.903
NZ_CP016270_1 1.40|323026|31|NZ_CP016270|CRT 323026-323056 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157300-157330 3 0.903
NZ_CP016270_1 1.40|323026|31|NZ_CP016270|CRT 323026-323056 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157426-157456 3 0.903
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151639-151669 3 0.903
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151693-151723 3 0.903
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157354-157384 3 0.903
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157516-157546 3 0.903
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1561-1591 3 0.903
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151459-151489 3 0.903
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156322-156352 3 0.903
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156340-156370 3 0.903
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156358-156388 3 0.903
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3043-3073 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151531-151561 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151567-151597 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154042-154072 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154738-154768 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154936-154966 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155134-155164 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155368-155398 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155848-155878 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155902-155932 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156322-156352 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156790-156820 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156958-156988 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157192-157222 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157300-157330 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157426-157456 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1543-1573 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3133-3163 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2275-2305 3 0.903
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3043-3073 3 0.903
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151459-151489 4 0.871
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151969-151999 4 0.871
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153208-153238 4 0.871
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21070-21100 4 0.871
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15457-15487 4 0.871
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15565-15595 4 0.871
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15691-15721 4 0.871
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9628-9658 4 0.871
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156430-156460 4 0.871
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1003-1033 4 0.871
NZ_CP016270_1 1.46|323440|49|NZ_CP016270|CRT 323440-323488 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155008-155056 4 0.918
NZ_CP016270_1 1.46|323440|49|NZ_CP016270|CRT 323440-323488 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155188-155236 4 0.918
NZ_CP016270_1 1.46|323440|49|NZ_CP016270|CRT 323440-323488 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155242-155290 4 0.918
NZ_CP016270_1 1.46|323440|49|NZ_CP016270|CRT 323440-323488 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151351-151399 4 0.918
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154648-154678 4 0.871
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151879-151909 4 0.871
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2635-2665 4 0.871
NZ_CP016270_2 2.8|2455800|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455800-2455829 30 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 284024-284053 4 0.867
NZ_CP016270_1 1.11|321238|31|NZ_CP016270|CRT 321238-321268 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153826-153856 5 0.839
NZ_CP016270_1 1.11|321238|31|NZ_CP016270|CRT 321238-321268 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156100-156130 5 0.839
NZ_CP016270_1 1.11|321238|31|NZ_CP016270|CRT 321238-321268 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156574-156604 5 0.839
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21142-21172 5 0.839
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21340-21370 5 0.839
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15943-15973 5 0.839
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9700-9730 5 0.839
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9844-9874 5 0.839
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154096-154126 6 0.806
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154132-154162 6 0.806
NZ_CP016270_1 1.21|321940|31|NZ_CP016270|CRT 321940-321970 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1213 6 0.806
NZ_CP016270_1 1.24|322090|31|NZ_CP016270|CRT 322090-322120 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154276-154306 6 0.806
NZ_CP016270_1 1.24|322090|31|NZ_CP016270|CRT 322090-322120 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155458-155488 6 0.806
NZ_CP016270_1 1.24|322090|31|NZ_CP016270|CRT 322090-322120 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156238-156268 6 0.806
NZ_CP016270_1 1.24|322090|31|NZ_CP016270|CRT 322090-322120 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1165-1195 6 0.806
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155458-155488 6 0.806
NZ_CP016270_1 1.26|322216|31|NZ_CP016270|CRT 322216-322246 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156238-156268 6 0.806
NZ_CP016270_1 1.28|322342|31|NZ_CP016270|CRT 322342-322372 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155458-155488 6 0.806
NZ_CP016270_1 1.28|322342|31|NZ_CP016270|CRT 322342-322372 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156238-156268 6 0.806
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21286-21316 6 0.806
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21304-21334 6 0.806
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21358-21388 6 0.806
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15763-15793 6 0.806
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15907-15937 6 0.806
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9988-10018 6 0.806
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18575-18605 6 0.806
NZ_CP016270_1 1.40|323026|31|NZ_CP016270|CRT 323026-323056 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1213 6 0.806
NZ_CP016270_1 1.43|323218|49|NZ_CP016270|CRT 323218-323266 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1903-1951 6 0.878
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154558-154588 6 0.806
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1213 6 0.806
NZ_CP016270_2 2.4|2455535|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455535-2455564 30 NZ_CP032366 Bacillus wiedmannii strain SR52 plasmid unnamed1, complete sequence 46601-46630 6 0.8
NZ_CP016270_2 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455668-2455697 30 NZ_KX258624 Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence 33713-33742 6 0.8
NZ_CP016270_2 2.8|2455800|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455800-2455829 30 AB981169 Ralstonia phage RSY1 DNA, complete genome 19536-19565 6 0.8
NZ_CP016270_2 2.8|2455800|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455800-2455829 30 NC_049432 Ralstonia phage RsoM1USA, complete genome 13669-13698 6 0.8
NZ_CP016270_2 2.8|2455800|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455800-2455829 30 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1133280-1133309 6 0.8
NZ_CP016270_1 1.11|321238|31|NZ_CP016270|CRT 321238-321268 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2131-2161 7 0.774
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153826-153856 7 0.774
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156100-156130 7 0.774
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156574-156604 7 0.774
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154558-154588 7 0.774
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154828-154858 7 0.774
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155794-155824 7 0.774
NZ_CP016270_1 1.27|322270|49|NZ_CP016270|CRT 322270-322318 49 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17339-17387 7 0.857
NZ_CP016270_1 1.27|322270|49|NZ_CP016270|CRT 322270-322318 49 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18653-18701 7 0.857
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154288-154318 7 0.774
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 MH632120 Mycobacterium phage Thonko, complete genome 31507-31537 7 0.774
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15745-15775 7 0.774
NZ_CP016270_1 1.44|323290|55|NZ_CP016270|CRT 323290-323344 55 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157552-157606 7 0.873
NZ_CP016270_1 1.44|323290|55|NZ_CP016270|CRT 323290-323344 55 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151765-151819 7 0.873
NZ_CP016270_1 1.47|323512|31|NZ_CP016270|CRT 323512-323542 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1213 7 0.774
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3079-3109 7 0.774
NZ_CP016270_1 1.48|323566|31|NZ_CP016270|CRT 323566-323596 31 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 20508-20538 7 0.774
NZ_CP016270_1 1.20|321886|31|NZ_CP016270|CRT 321886-321916 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1213 8 0.742
NZ_CP016270_1 1.22|321994|31|NZ_CP016270|CRT 321994-322024 31 LC576631 Staphylococcus phage vB_SauH_DELF3 DNA, complete sequence 61670-61700 8 0.742
NZ_CP016270_1 1.24|322090|31|NZ_CP016270|CRT 322090-322120 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-28 8 0.742
NZ_CP016270_1 1.24|322090|31|NZ_CP016270|CRT 322090-322120 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157693-157723 8 0.742
NZ_CP016270_1 1.27|322270|49|NZ_CP016270|CRT 322270-322318 49 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16049-16097 8 0.837
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21070-21100 8 0.742
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15457-15487 8 0.742
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15565-15595 8 0.742
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15691-15721 8 0.742
NZ_CP016270_1 1.35|322714|31|NZ_CP016270|CRT 322714-322744 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9628-9658 8 0.742
NZ_CP016270_1 1.44|323290|55|NZ_CP016270|CRT 323290-323344 55 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1057-1111 8 0.855
NZ_CP016270_1 1.44|323290|55|NZ_CP016270|CRT 323290-323344 55 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1735-1789 8 0.855
NZ_CP016270_1 1.44|323290|55|NZ_CP016270|CRT 323290-323344 55 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3361-3415 8 0.855
NZ_CP016270_1 1.29|322396|31|NZ_CP016270|CRT 322396-322426 31 MT773554 Myoviridae sp. isolate BML_2 genomic sequence 115519-115549 9 0.71
NZ_CP016270_1 1.30|322450|31|NZ_CP016270|CRT 322450-322480 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-28 9 0.71
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-28 9 0.71
NZ_CP016270_1 1.36|322768|31|NZ_CP016270|CRT 322768-322798 31 JQ067084 Pseudomonas phage PaMx25, complete genome 24081-24111 9 0.71
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-28 9 0.71
NZ_CP016270_1 1.37|322822|31|NZ_CP016270|CRT 322822-322852 31 JQ067084 Pseudomonas phage PaMx25, complete genome 24081-24111 9 0.71
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-28 9 0.71
NZ_CP016270_1 1.42|323164|31|NZ_CP016270|CRT 323164-323194 31 JQ067084 Pseudomonas phage PaMx25, complete genome 24081-24111 9 0.71
NZ_CP016270_1 1.43|323218|49|NZ_CP016270|CRT 323218-323266 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2101-2149 9 0.816
NZ_CP016270_2 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455668-2455697 30 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 881825-881854 9 0.7
NZ_CP016270_2 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455668-2455697 30 NZ_CP047429 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence 16481-16510 9 0.7
NZ_CP016270_2 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455668-2455697 30 NC_010182 Bacillus mycoides KBAB4 plasmid pBWB403, complete sequence 58269-58298 9 0.7
NZ_CP016270_2 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455668-2455697 30 NZ_CP046373 Spiroplasma citri strain LB 319 plasmid pScpLB319-2, complete sequence 19849-19878 9 0.7
NZ_CP016270_2 2.4|2455535|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT 2455535-2455564 30 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 68555-68584 10 0.667
NZ_CP016270_1 1.44|323290|55|NZ_CP016270|CRT 323290-323344 55 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154204-154258 11 0.8
NZ_CP016270_1 1.44|323290|55|NZ_CP016270|CRT 323290-323344 55 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156556-156610 11 0.8
NZ_CP016270_1 1.44|323290|55|NZ_CP016270|CRT 323290-323344 55 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154168-154222 12 0.782

1. spacer 1.33|322618|19|NZ_CP016270|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cagcgattcagactcagat	CRISPR spacer
cagcgattcagactcagat	Protospacer
*******************

2. spacer 1.33|322618|19|NZ_CP016270|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cagcgattcagactcagat	CRISPR spacer
cagcgattcagactcagat	Protospacer
*******************

3. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032752 (Lactobacillus plantarum subsp. argentoratensis strain DSM 16365 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

4. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021472 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

5. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017356 (Lactobacillus plantarum strain TMW 1.25 plasmid pL125-2, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

6. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017366 (Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-3, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

7. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017381 (Lactobacillus plantarum strain TMW 1.1623 plasmid pL11623-2, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

8. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018868 (Lactobacillus alimentarius DSM 20249 plasmid pLDW-11, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

9. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028231 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

10. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035557 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

11. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035557 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

12. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021933 (Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

13. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016492 (Lactobacillus pentosus strain BGM48 plasmid pBGM48-1, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

14. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NC_022114 (Lactobacillus paracasei subsp. paracasei 8700:2 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

15. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014682 (Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

16. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NC_016608 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

17. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028242 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

18. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaagtactgtctttcgaatat	Protospacer
******************************

19. spacer 1.30|322450|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

ttccgactctgatagcgactccgattccgac	CRISPR spacer
ttccgactctgacagcgactccgattccgac	Protospacer
************.******************

20. spacer 1.36|322768|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ttccgactccgacagtgattccgattccgac	Protospacer
********* *********************

21. spacer 1.37|322822|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ttccgactccgacagtgattccgattccgac	Protospacer
********* *********************

22. spacer 1.42|323164|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ttccgactccgacagtgattccgattccgac	Protospacer
********* *********************

23. spacer 2.2|2455403|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to AY682195 (Lactobacillus plantarum bacteriophage LP65, complete genome) position: , mismatch: 1, identity: 0.967

tcaaattaagaatgccgtagccacaattac	CRISPR spacer
tcaaattaagaataccgtagccacaattac	Protospacer
*************.****************

24. spacer 2.2|2455403|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NC_006565 (Lactobacillus phage LP65, complete genome) position: , mismatch: 1, identity: 0.967

tcaaattaagaatgccgtagccacaattac	CRISPR spacer
tcaaattaagaataccgtagccacaattac	Protospacer
*************.****************

25. spacer 2.7|2455734|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046657 (Lactobacillus plantarum strain 123-17 plasmid p123-18.1, complete sequence) position: , mismatch: 1, identity: 0.967

gattaaatgcaagtactgtctttcgaatat	CRISPR spacer
gattaaatgcaggtactgtctttcgaatat	Protospacer
***********.******************

26. spacer 1.11|321238|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttccgactccgatagtgattcggattctgac	CRISPR spacer
ttccgactccgacagtgattcggactctgac	Protospacer
************.***********.******

27. spacer 1.11|321238|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

ttccgactccgatagtgattcggattctgac	CRISPR spacer
ttccgactccgacagcgattcggattctgac	Protospacer
************.**.***************

28. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ttcggattccgacagcgattcggattcggac	Protospacer
***.**************************.

29. spacer 1.21|321940|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

ttcggattccgatagtgattcggactcagac	CRISPR spacer
ttcggattccgacagtgattcggactcggac	Protospacer
************.**************.***

30. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.935

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ctccgattcagacagtgattcagactcagac	Protospacer
*** ***************** *********

31. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ctccgattcagacagtgattcagactcagac	Protospacer
*** ***************** *********

32. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ctccgattcagacagtgattcagactcagac	Protospacer
*** ***************** *********

33. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ctccgattcagacagtgattcagactcagac	Protospacer
*** ***************** *********

34. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.935

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ctccgattcagacagtgattcagactcagac	Protospacer
*** ***************** *********

35. spacer 1.30|322450|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttccgactctgatagcgactccgattccgac	CRISPR spacer
ttccgactctgacagcgactcggattccgac	Protospacer
************.******** *********

36. spacer 1.30|322450|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttccgactctgatagcgactccgattccgac	CRISPR spacer
ttccgactctgacagcgactcggattccgac	Protospacer
************.******** *********

37. spacer 1.30|322450|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttccgactctgatagcgactccgattccgac	CRISPR spacer
ttccgactctgacagcgactcggattccgac	Protospacer
************.******** *********

38. spacer 1.30|322450|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttccgactctgatagcgactccgattccgac	CRISPR spacer
ttccgactctgacagcgactcggattccgac	Protospacer
************.******** *********

39. spacer 1.36|322768|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ttccgactccgacagtgattccgactccgac	Protospacer
********* **************.******

40. spacer 1.37|322822|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ttccgactccgacagtgattccgactccgac	Protospacer
********* **************.******

41. spacer 1.42|323164|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ttccgactccgacagtgattccgactccgac	Protospacer
********* **************.******

42. spacer 1.47|323512|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ctccgattcggacagtgattcggattcggac	Protospacer
*** **************************.

43. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagtgactccgattcggat	Protospacer
******************.*****.******

44. spacer 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to AY682195 (Lactobacillus plantarum bacteriophage LP65, complete genome) position: , mismatch: 2, identity: 0.933

gctatactataaacatatataaggaaagga	CRISPR spacer
ggtatactataaacatagataaggaaagga	Protospacer
* *************** ************

45. spacer 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NC_006565 (Lactobacillus phage LP65, complete genome) position: , mismatch: 2, identity: 0.933

gctatactataaacatatataaggaaagga	CRISPR spacer
ggtatactataaacatagataaggaaagga	Protospacer
* *************** ************

46. spacer 1.11|321238|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ttccgactccgatagtgattcggattctgac	CRISPR spacer
ctccgactccgacagtgattcggattccgac	Protospacer
.***********.**************.***

47. spacer 1.11|321238|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ttccgactccgatagtgattcggattctgac	CRISPR spacer
ctccgactccgacagcgattcggattctgac	Protospacer
.***********.**.***************

48. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattccgacagcgattcggattcggac	Protospacer
.**.**************************.

49. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattccgacagcgattcggattcggac	Protospacer
.**.**************************.

50. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattccgacagcgattcggattcggac	Protospacer
.**.**************************.

51. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattccgacagcgattcggattcggac	Protospacer
.**.**************************.

52. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattccgacagcgattcggattcggac	Protospacer
.**.**************************.

53. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ttccgattccgacagcgactcggattcggac	Protospacer
*** **************.***********.

54. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ttcggattcggacagcgattcggattcggac	Protospacer
***.***** ********************.

55. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ttccgattccgacagcgattcggactcggac	Protospacer
*** ********************.*****.

56. spacer 1.20|321886|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ttccgattccgacagcgattcggattccgac	Protospacer
*** *********************** **.

57. spacer 1.24|322090|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ttccgactctgatagtgactccgactctgat	CRISPR spacer
ttccgactctgacagtgactccgactccgac	Protospacer
************.**************.**.

58. spacer 1.26|322216|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.903

ctcagactcagacagtgattccgactccgat	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.******************** ***** ***

59. spacer 1.26|322216|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

ctcagactcagacagtgattccgactccgat	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.******************** ***** ***

60. spacer 1.26|322216|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

ctcagactcagacagtgattccgactccgat	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.******************** ***** ***

61. spacer 1.26|322216|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

ctcagactcagacagtgattccgactccgat	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.******************** ***** ***

62. spacer 1.26|322216|31|NZ_CP016270|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.903

ctcagactcagacagtgattccgactccgat	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.******************** ***** ***

63. spacer 1.30|322450|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactctgatagcgactccgattccgac	CRISPR spacer
ctcggactctgacagcgactccgattccgac	Protospacer
.** ********.******************

64. spacer 1.30|322450|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ttccgactctgatagcgactccgattccgac	CRISPR spacer
ctctgactctgacagcgactccgattccgac	Protospacer
.**.********.******************

65. spacer 1.36|322768|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

66. spacer 1.36|322768|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

67. spacer 1.36|322768|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

68. spacer 1.36|322768|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

69. spacer 1.36|322768|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctccgactccgacagtgattcggattccgac	Protospacer
.******** *********** *********

70. spacer 1.37|322822|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

71. spacer 1.37|322822|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

72. spacer 1.37|322822|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

73. spacer 1.37|322822|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

74. spacer 1.37|322822|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctccgactccgacagtgattcggattccgac	Protospacer
.******** *********** *********

75. spacer 1.40|323026|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ctcggattccgatagtgattcggactcggat	CRISPR spacer
ttcggattccgacagtgattcggactcggac	Protospacer
.***********.*****************.

76. spacer 1.40|323026|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ctcggattccgatagtgattcggactcggat	CRISPR spacer
ctcggattctgacagtgattcggactcggac	Protospacer
*********.**.*****************.

77. spacer 1.40|323026|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ctcggattccgatagtgattcggactcggat	CRISPR spacer
ctcggattcggacagtgattcggactcggac	Protospacer
********* **.*****************.

78. spacer 1.40|323026|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgatagtgattcggactcggat	CRISPR spacer
ctcggattcggacagtgattcggactcggac	Protospacer
********* **.*****************.

79. spacer 1.40|323026|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgatagtgattcggactcggat	CRISPR spacer
ctccgattccgacagtgattcggactcggac	Protospacer
*** ********.*****************.

80. spacer 1.40|323026|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgatagtgattcggactcggat	CRISPR spacer
ctcggactccgacagtgattcggactcggac	Protospacer
******.*****.*****************.

81. spacer 1.42|323164|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

82. spacer 1.42|323164|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

83. spacer 1.42|323164|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

84. spacer 1.42|323164|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctcggactctgacagtgattccgattccgac	Protospacer
.** ***** *********************

85. spacer 1.42|323164|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctccgactccgacagtgattcggattccgac	Protospacer
.******** *********** *********

86. spacer 1.47|323512|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ctcggattcggacagcgattcggattcggac	Protospacer
***.***********.**************.

87. spacer 1.47|323512|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ctcggattcggacagtgattcggactcggac	Protospacer
***.********************.*****.

88. spacer 1.47|323512|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ctcggattcggacagtgactcggattcggac	Protospacer
***.**************.***********.

89. spacer 1.47|323512|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ctccgattcggacagtgactcggattcggac	Protospacer
*** **************.***********.

90. spacer 1.47|323512|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ctcggattcggacagtgattcggactcggac	Protospacer
***.********************.*****.

91. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagcgattccgactccgac	Protospacer
***************.*********** **.

92. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagcgattccgactccgac	Protospacer
***************.*********** **.

93. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagtgactccgattcggac	Protospacer
******************.*****.*****.

94. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggactccgacagtgattccgattcggac	Protospacer
******.*****************.*****.

95. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggactccgacagtgattccgattcggac	Protospacer
******.*****************.*****.

96. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggactccgacagtgattccgattcggac	Protospacer
******.*****************.*****.

97. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggactccgacagtgattccgattcggac	Protospacer
******.*****************.*****.

98. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagcgattccgactctgac	Protospacer
***************.*********** **.

99. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagtgactccgattcggac	Protospacer
******************.*****.*****.

100. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattcggacagtgattcggactcggac	Protospacer
********* *********** ********.

101. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagcgattccgactctgac	Protospacer
***************.*********** **.

102. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagcgattccgactccgac	Protospacer
***************.*********** **.

103. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattctgacagtgattccgattcggac	Protospacer
*********.**************.*****.

104. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctccgattccgacagtgattcggactcggac	Protospacer
*** ***************** ********.

105. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggactccgacagtgattcggactcggac	Protospacer
******.************** ********.

106. spacer 1.48|323566|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ttcggattccgacagtgattcggactcggac	Protospacer
.******************** ********.

107. spacer 1.48|323566|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ttcggattccgacagtgattccgactctgac	Protospacer
.************************** **.

108. spacer 1.48|323566|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattctgacagtgattcggactcggac	Protospacer
*********.*********** ********.

109. spacer 1.48|323566|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctcggattcggacagtgattcggactcggac	Protospacer
********* *********** ********.

110. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattcggacagcgattcggattcggac	Protospacer
.**.***** ********************.

111. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattccgacagcgattcggattctgac	Protospacer
.**.*********************** **.

112. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggactccgacagcgattcggattcggac	Protospacer
.**.**.***********************.

113. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.871

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.*****.************** ********.

114. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.*****.************** ********.

115. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.*****.************** ********.

116. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.*****.************** ********.

117. spacer 1.22|321994|31|NZ_CP016270|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.871

ctcagattcagacagtgattctgactcagac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.*****.************** ********.

118. spacer 1.26|322216|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ctcagactcagacagtgattccgactccgat	CRISPR spacer
ttccgactccgacagtgattccgactccgac	Protospacer
.** ***** ********************.

119. spacer 1.26|322216|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

ctcagactcagacagtgattccgactccgat	CRISPR spacer
ttcagactctgacagcgattccgactccgac	Protospacer
.******** *****.**************.

120. spacer 1.46|323440|49|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

ttcggattccgacagcgattcggactctgacagtgattccgactcggat	CRISPR spacer
ctcggattctgacagcgattcggactctgacagtgattccgactctgac	Protospacer
.********.*********************************** **.

121. spacer 1.46|323440|49|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

ttcggattccgacagcgattcggactctgacagtgattccgactcggat	CRISPR spacer
ctcggattccgacagcgactcggactctgacagtgattccgactctgac	Protospacer
.*****************.************************** **.

122. spacer 1.46|323440|49|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

ttcggattccgacagcgattcggactctgacagtgattccgactcggat	CRISPR spacer
ctcggattctgacagcgattcggactctgacagtgattccgactctgac	Protospacer
.********.*********************************** **.

123. spacer 1.46|323440|49|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

ttcggattccgacagcgattcggactctgacagt-gattccgactcggat	CRISPR spacer
ttcggactccgacagcgactcggactctgacagtggattctgactcgga-	Protospacer
******.***********.*************** *****.******** 

124. spacer 1.47|323512|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ttcggattcggacagcgattcggattcggac	Protospacer
.**.***********.**************.

125. spacer 1.48|323566|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ttcggactccgacagtgattccgattcggac	Protospacer
.*****.*****************.*****.

126. spacer 1.48|323566|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ttcggattccgacagtgactccgactccgac	Protospacer
.*****************.******** **.

127. spacer 2.8|2455800|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.867

acgtcggcgaaatcttcacca----cgccgatta	CRISPR spacer
acgtcggcgaaatcttcaccaacaccgccg----	Protospacer
*********************    *****    

128. spacer 1.11|321238|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

ttccgactccgatagtgattcggattctgac	CRISPR spacer
cagcgactccgacagcgattcggattctgac	Protospacer
.  *********.**.***************

129. spacer 1.11|321238|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

ttccgactccgatagtgattcggattctgac	CRISPR spacer
cagcgactccgacagcgattcggattctgac	Protospacer
.  *********.**.***************

130. spacer 1.11|321238|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

ttccgactccgatagtgattcggattctgac	CRISPR spacer
cagcgactccgacagcgattcggattctgac	Protospacer
.  *********.**.***************

131. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.839

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagattcagac	Protospacer
*********.*****.*********   ***

132. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.839

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagattcagac	Protospacer
*********.*****.*********   ***

133. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagattcagac	Protospacer
*********.*****.*********   ***

134. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.839

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagattcagac	Protospacer
*********.*****.*********   ***

135. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.839

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagattcagac	Protospacer
*********.*****.*********   ***

136. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ttccgactccgacagcgattcggatagtgac	Protospacer
*** **.******************   **.

137. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ttccgactccgacagcgattcggatagtgac	Protospacer
*** **.******************   **.

138. spacer 1.21|321940|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

ttcggattccgatagtgattcggactcagac	CRISPR spacer
ctctgattccgacagtgattcggacagcgac	Protospacer
.** ********.************   ***

139. spacer 1.24|322090|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ttccgactctgatagtgactccgactctgat	CRISPR spacer
cagcgactccgacagtgactccgactctgac	Protospacer
.  ******.**.*****************.

140. spacer 1.24|322090|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ttccgactctgatagtgactccgactctgat	CRISPR spacer
cagcgactctgacagtgattccgactctgac	Protospacer
.  *********.*****.***********.

141. spacer 1.24|322090|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ttccgactctgatagtgactccgactctgat	CRISPR spacer
cagcgactctgacagtgattccgactctgac	Protospacer
.  *********.*****.***********.

142. spacer 1.24|322090|31|NZ_CP016270|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.806

ttccgactctgatagtgactccgactctgat	CRISPR spacer
cagcgactctgacagtgactccgattctgac	Protospacer
.  *********.***********.*****.

143. spacer 1.26|322216|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ctcagactcagacagtgattccgactccgat	CRISPR spacer
cagcgactctgacagtgattccgactctgac	Protospacer
*   ***** *****************.**.

144. spacer 1.26|322216|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ctcagactcagacagtgattccgactccgat	CRISPR spacer
cagcgactctgacagtgattccgactctgac	Protospacer
*   ***** *****************.**.

145. spacer 1.28|322342|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ttctgactctgatagtgattccgactccgac	CRISPR spacer
cagcgactctgacagtgattccgactctgac	Protospacer
.  .********.**************.***

146. spacer 1.28|322342|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ttctgactctgatagtgattccgactccgac	CRISPR spacer
cagcgactctgacagtgattccgactctgac	Protospacer
.  .********.**************.***

147. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.806

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagactcagac	Protospacer
*********.*****.********.   ***

148. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.806

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagactcagac	Protospacer
*********.*****.********.   ***

149. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.806

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagactcagac	Protospacer
*********.*****.********.   ***

150. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagactcagac	Protospacer
*********.*****.********.   ***

151. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagactcagac	Protospacer
*********.*****.********.   ***

152. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.806

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagactcagac	Protospacer
*********.*****.********.   ***

153. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagactcagac	Protospacer
*********.*****.********.   ***

154. spacer 1.40|323026|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

ctcggattccgatagtgattcggactcggat	CRISPR spacer
ctctgattccgacagtgattcggacagcgac	Protospacer
*** ********.************   **.

155. spacer 1.43|323218|49|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.878

ttccgactcggacagcgactcagactctgacagtgattcggatagcgac	CRISPR spacer
ctccgactcggacagcgactcggactctgacagcgattcggattctgac	Protospacer
.********************.***********.*********  .***

156. spacer 1.47|323512|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ctctgattcggacagcgattcggatagcgac	Protospacer
*** ***********.*********   **.

157. spacer 1.48|323566|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ctctgattccgacagtgattcggacagcgac	Protospacer
*** ***************** ***   **.

158. spacer 2.4|2455535|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032366 (Bacillus wiedmannii strain SR52 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

agaacggtacgtatgagttaacacctaaat	CRISPR spacer
agttgggtaagtatgagttaacacctaaga	Protospacer
**   **** ******************. 

159. spacer 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 6, identity: 0.8

gctatactataaacatatataaggaaagga	CRISPR spacer
ccaaaactataaacatataaaaggaattga	Protospacer
 * * ************** ******  **

160. spacer 2.8|2455800|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 6, identity: 0.8

acgtcggcgaaatcttcaccacgccgatta	CRISPR spacer
ccatcggcgacatcctcaccacgccgatcg	Protospacer
 *.******* ***.*************..

161. spacer 2.8|2455800|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NC_049432 (Ralstonia phage RsoM1USA, complete genome) position: , mismatch: 6, identity: 0.8

acgtcggcgaaatcttcaccacgccgatta	CRISPR spacer
ccatgggcgacatcctcaccacgccgattg	Protospacer
 *.* ***** ***.**************.

162. spacer 2.8|2455800|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

acgtcgg-cgaaatcttcaccacgccgatta	CRISPR spacer
-ggtcagtcgaaatattcaccacgccgatag	Protospacer
  ***.* ****** ************** .

163. spacer 1.11|321238|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

ttccgactccgatagtgattcggattctgac	CRISPR spacer
ctccgactccgacagtgactcggacagcgac	Protospacer
.***********.*****.*****.  .***

164. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

ttcagattccgacagcgattcggattcggat	CRISPR spacer
cagcgactccgacagcgattcggattctgac	Protospacer
.   **.******************** **.

165. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

ttcagattccgacagcgattcggattcggat	CRISPR spacer
cagcgactccgacagcgattcggattctgac	Protospacer
.   **.******************** **.

166. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

ttcagattccgacagcgattcggattcggat	CRISPR spacer
cagcgactccgacagcgattcggattctgac	Protospacer
.   **.******************** **.

167. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctctgattcggacagcgattcggatagcgac	Protospacer
.** ***** ***************   **.

168. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattctgacagcgattcggatagcgac	Protospacer
.**.*****.***************   **.

169. spacer 1.20|321886|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctcggattctgacagcgattcggatagcgac	Protospacer
.**.*****.***************   **.

170. spacer 1.27|322270|49|NZ_CP016270|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.857

ttcggattccgacagcgattcagatagcgacagtgattccgactccgac	CRISPR spacer
ctcagacagcgacagcgattcagatagcgacagtgattcagactcagac	Protospacer
.**.**.  ****************************** ***** ***

171. spacer 1.27|322270|49|NZ_CP016270|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.857

ttcggattccgacagcgattcagatagcgacagtgattccgactccgac	CRISPR spacer
ctcagacagcgacagcgattcagatagcgacagtgattcagactcagac	Protospacer
.**.**.  ****************************** ***** ***

172. spacer 1.30|322450|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

ttccgactctgatagcgactccgattccgac	CRISPR spacer
ctcggactctgacagcgactccgacagtgac	Protospacer
.** ********.***********.  .***

173. spacer 1.30|322450|31|NZ_CP016270|CRT matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 7, identity: 0.774

ttccgactctgatagcgactccgattccgac	CRISPR spacer
gaccgagtctgatagcgacttcgattggggc	Protospacer
  **** *************.*****  *.*

174. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ctcagactcagacagcgactcagactcagat	Protospacer
*********.*****.********.   **.

175. spacer 1.44|323290|55|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.873

ctccgattcggactctgacagcgattcggactctgacagtgattcggatagcgac	CRISPR spacer
cagtgattcggactctgacagcgattcggactctgacagcgattcggattctgac	Protospacer
*  .***********************************.*********  .***

176. spacer 1.44|323290|55|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.873

ctccgattcggactctgacagcgattcggactctgacagtgattcggatagcgac	CRISPR spacer
cagcgattcggactctgacagcgattcggattctgacagcgattcggattctgac	Protospacer
*  ***************************.********.*********  .***

177. spacer 1.47|323512|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

ctcagattcggacagtgattcggattcggat	CRISPR spacer
ctctgattccgacagtgattcggacagcgac	Protospacer
*** ***** **************.   **.

178. spacer 1.48|323566|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ttcggattcggacagcgattccgacagcgac	Protospacer
.******** *****.*********   **.

179. spacer 1.48|323566|31|NZ_CP016270|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.774

ctcggattccgacagtgattccgactcggat	CRISPR spacer
ccggtattccggcagtgattcagactcggta	Protospacer
*. * ******.********* *******  

180. spacer 1.20|321886|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.742

ttcagattccgacagcgattcggattcggat	CRISPR spacer
ctctgattccgacagtgattcggacagcgac	Protospacer
.** ***********.********.   **.

181. spacer 1.22|321994|31|NZ_CP016270|CRT matches to LC576631 (Staphylococcus phage vB_SauH_DELF3 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

ctcaga---ttcagacagtgattctgactcagac	CRISPR spacer
---aggcctttcagacagtagttctgactcaggt	Protospacer
   **.   **********..***********..

182. spacer 1.24|322090|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.742

ttccgactctgatagtgactccgactctgat	CRISPR spacer
cagcgactctgacagtgactccgattct---	Protospacer
.  *********.***********.***   

183. spacer 1.24|322090|31|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.742

ttccgactctgatagtgactccgactctgat	CRISPR spacer
ctcggactctgacagtgactccgatcttggc	Protospacer
.** ********.***********...**..

184. spacer 1.27|322270|49|NZ_CP016270|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.837

ttcggattccgacagcgattcagatagcgacagtgattccgactccgac	CRISPR spacer
ctttgatgaagacagcgattcagatagcgacagtgattcagactcagac	Protospacer
.*. ***   ***************************** ***** ***

185. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 8, identity: 0.742

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.********.********.*****.   **.

186. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.********.********.*****.   **.

187. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.********.********.*****.   **.

188. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.********.********.*****.   **.

189. spacer 1.35|322714|31|NZ_CP016270|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 8, identity: 0.742

ctcagactcggacagtgactcagatagcgac	CRISPR spacer
ttcagactcagacagtgattcagactcagat	Protospacer
.********.********.*****.   **.

190. spacer 1.44|323290|55|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.855

ctccgattcggactctgacagcgattcggactctgacagtgattcggatagcgac	CRISPR spacer
cagcgactcggactctgacagcgattcggattctgacagtgattcggactctgac	Protospacer
*  ***.***********************.*****************.  .***

191. spacer 1.44|323290|55|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.855

ctccgattcggactctgacagcgattcggactctgacagtgattcggatagcgac	CRISPR spacer
cagtgattcggactctgacagcgattcggactccgacagcgattcggatgctgac	Protospacer
*  .*****************************.*****.*********. .***

192. spacer 1.44|323290|55|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.855

ctccgattcggactctgacagcgattcggactctgacagtgattcggatagcgac	CRISPR spacer
cagtgattccgactctgacagcgattcggactccgacagtgattcggattcggac	Protospacer
*  .***** ***********************.***************   ***

193. spacer 1.29|322396|31|NZ_CP016270|CRT matches to MT773554 (Myoviridae sp. isolate BML_2 genomic sequence) position: , mismatch: 9, identity: 0.71

ttctgactctgatagtgattcagattccgac	CRISPR spacer
ttctgattctgatattgattcaggcggaagc	Protospacer
******.******* ********..   ..*

194. spacer 1.30|322450|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.71

ttccgactctgatagcgactccgattccgac	CRISPR spacer
cagcgactctgacagtgactccgattct---	Protospacer
.  *********.**.***********.   

195. spacer 1.36|322768|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.71

ttccgactcagacagtgattccgattccgac	CRISPR spacer
cagcgactctgacagtgactccgattct---	Protospacer
.  ****** ********.********.   

196. spacer 1.36|322768|31|NZ_CP016270|CRT matches to JQ067084 (Pseudomonas phage PaMx25, complete genome) position: , mismatch: 9, identity: 0.71

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctccgaaccagacagtgattccgatcagcgg	Protospacer
.***** .*****************.   . 

197. spacer 1.37|322822|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.71

ttccgactcagacagtgattccgattccgac	CRISPR spacer
cagcgactctgacagtgactccgattct---	Protospacer
.  ****** ********.********.   

198. spacer 1.37|322822|31|NZ_CP016270|CRT matches to JQ067084 (Pseudomonas phage PaMx25, complete genome) position: , mismatch: 9, identity: 0.71

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctccgaaccagacagtgattccgatcagcgg	Protospacer
.***** .*****************.   . 

199. spacer 1.42|323164|31|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.71

ttccgactcagacagtgattccgattccgac	CRISPR spacer
cagcgactctgacagtgactccgattct---	Protospacer
.  ****** ********.********.   

200. spacer 1.42|323164|31|NZ_CP016270|CRT matches to JQ067084 (Pseudomonas phage PaMx25, complete genome) position: , mismatch: 9, identity: 0.71

ttccgactcagacagtgattccgattccgac	CRISPR spacer
ctccgaaccagacagtgattccgatcagcgg	Protospacer
.***** .*****************.   . 

201. spacer 1.43|323218|49|NZ_CP016270|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.816

ttccgactcggacagcgactcagactctgacagtgattcggatagcgac	CRISPR spacer
cagtgactcggacagcgactccgactctgacagtgactcggattctgac	Protospacer
.  .***************** **************.******  .***

202. spacer 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 9, identity: 0.7

gctatactataaacatatataaggaaagga	CRISPR spacer
atggtacaataaacaaatataaggaaattt	Protospacer
.. .*** ******* ***********   

203. spacer 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047429 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence) position: , mismatch: 9, identity: 0.7

gctatactataaacatatataaggaaagga	CRISPR spacer
ataatactagaaacatatataatgaatctg	Protospacer
.. ****** ************ ***   .

204. spacer 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NC_010182 (Bacillus mycoides KBAB4 plasmid pBWB403, complete sequence) position: , mismatch: 9, identity: 0.7

gctatactataaacatatataaggaaagga	CRISPR spacer
gctatactatacacatatatacgcctttag	Protospacer
*********** ********* *     ..

205. spacer 2.6|2455668|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046373 (Spiroplasma citri strain LB 319 plasmid pScpLB319-2, complete sequence) position: , mismatch: 9, identity: 0.7

gctatactataaacatatataaggaaagga	CRISPR spacer
ataatactagaaacatatataatgaatctg	Protospacer
.. ****** ************ ***   .

206. spacer 2.4|2455535|30|NZ_CP016270|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

agaacggtacgtatgagttaacacctaaat	CRISPR spacer
ctgctggtatgtatgagttaacacctctga	Protospacer
  . .****.****************  . 

207. spacer 1.44|323290|55|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 11, identity: 0.8

ctccgattcggactctgacagcgattcggactctgacagtgattcggatagcgac	CRISPR spacer
cagcgattcggactctgacagcgattcggactccgacagtgacagtgactctgac	Protospacer
*  ******************************.********.   **.  .***

208. spacer 1.44|323290|55|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 11, identity: 0.8

ctccgattcggactctgacagcgattcggactctgacagtgattcggatagcgac	CRISPR spacer
ttcagacagcgactccgacagcgattcggattctgacagtgattcggattctgac	Protospacer
.** **.   *****.**************.******************  .***

209. spacer 1.44|323290|55|NZ_CP016270|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 12, identity: 0.782

ctccgattcggactctgacagcgattcggactctgacagtgattcggatagcgac	CRISPR spacer
cagtgacagtgactctgacagcgattcggactctgacagcgactcggattcggac	Protospacer
*  .**.   *****************************.**.******   ***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 419613 : 426974 7 Lactobacillus_phage(83.33%) NA NA
DBSCAN-SWA_2 932071 : 1020061 92 Lactobacillus_phage(69.57%) protease,tRNA,capsid,terminase,portal,integrase,head,tail attL 957654:957671|attR 1026995:1027012
DBSCAN-SWA_3 1309342 : 1372237 77 Lactobacillus_phage(68.63%) holin,capsid,head,terminase,integrase,portal,tail attL 1358575:1358596|attR 1372415:1372436
DBSCAN-SWA_4 1566401 : 1574912 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2674501 : 2727413 51 Bacillus_virus(33.33%) protease,bacteriocin NA
DBSCAN-SWA_6 2925059 : 2933684 11 Streptococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage