Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012366 Enterococcus durans strain KLDS 6.0933 chromosome, complete genome 2 crisprs csa3,cas3,cas14j,cas1,cas2,csn2,DEDDh 0 0 9 0
NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 1 crisprs NA 0 2 2 0
NZ_CP012368 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 2, complete sequence 0 crisprs RT 0 0 0 0

Results visualization

1. NZ_CP012366
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012366_1 271054-271132 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012366_2 2015519-2015681 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20652 : 88140 61 Listeria_phage(18.18%) transposase,holin,tail NA
DBSCAN-SWA_2 173639 : 254385 59 Streptococcus_phage(25.0%) transposase,integrase,protease,holin,tRNA attL 220879:220902|attR 256931:256954
DBSCAN-SWA_3 315253 : 376098 52 Streptococcus_phage(38.46%) integrase,transposase,tRNA,protease attL 309292:309329|attR 344264:344301
DBSCAN-SWA_4 1319900 : 1390670 51 Streptococcus_phage(15.79%) transposase,tRNA,protease NA
DBSCAN-SWA_5 1422360 : 1464010 39 Leuconostoc_phage(16.67%) integrase,transposase attL 1423417:1423476|attR 1464011:1469648
DBSCAN-SWA_6 1668729 : 1726922 50 Paenibacillus_phage(28.57%) transposase,tRNA NA
DBSCAN-SWA_7 1733432 : 1802139 52 Paenibacillus_phage(22.22%) integrase,transposase,protease attL 1731226:1731241|attR 1748203:1748218
DBSCAN-SWA_8 1979347 : 2004888 21 Streptococcus_phage(40.0%) integrase,transposase attL 1978732:1978748|attR 1991022:1991038
DBSCAN-SWA_9 2530457 : 2539504 9 Gordonia_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP012367
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012367_1 3335-3461 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 3358-3396 0 1.0
NZ_CP012367_1 1.2|3420|19|NZ_CP012367|CRISPRCasFinder 3420-3438 19 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 3420-3438 0 1.0
NZ_CP012367_1 1.2|3420|19|NZ_CP012367|CRISPRCasFinder 3420-3438 19 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 95049-95067 0 1.0
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 221216-221254 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 95092-95130 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 358205-358243 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 119937-119975 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP040905 Enterococcus faecium strain N56454 plasmid unnamed, complete sequence 153621-153659 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 129212-129250 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 249118-249156 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 91402-91440 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 102426-102464 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 60362-60400 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 97677-97715 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 52637-52675 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 102651-102689 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 56543-56581 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 65333-65371 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP019993 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence 14572-14610 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 33082-33120 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 39887-39925 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 92046-92084 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 17089-17127 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 192113-192151 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 168263-168301 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 LT603679 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2 452-490 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 244126-244164 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP043485 Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence 27883-27921 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 96547-96585 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 454-492 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 111370-111408 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP027498 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP027507 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 126934-126972 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135279 Enterococcus faecium isolate E6975 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 71269-71307 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 107198-107236 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 1397-1435 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 200630-200668 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 67328-67366 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 178898-178936 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP040850 Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence 105709-105747 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 35165-35203 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 225612-225650 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 86167-86205 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 61653-61691 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 5084-5122 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 177278-177316 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 244126-244164 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 453-491 4 0.897
NZ_CP012367_1 1.1|3358|39|NZ_CP012367|CRISPRCasFinder 3358-3396 39 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 453-491 4 0.897

1. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatccttggggct	Protospacer
***************************************

2. spacer 1.2|3420|19|NZ_CP012367|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcctaaacgttgataaa	CRISPR spacer
gtgcctaaacgttgataaa	Protospacer
*******************

3. spacer 1.2|3420|19|NZ_CP012367|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcctaaacgttgataaa	CRISPR spacer
gtgcctaaacgttgataaa	Protospacer
*******************

4. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

5. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

6. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

7. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

8. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

9. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

10. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

11. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

12. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

13. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

14. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

15. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

16. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

17. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

18. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

19. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

20. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

21. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

22. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

23. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

24. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

25. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

26. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

27. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

28. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

29. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

30. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

31. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

32. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

33. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

34. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

35. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

36. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

37. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

38. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

39. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

40. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

41. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

42. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

43. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

44. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

45. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

46. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

47. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

48. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

49. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

50. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

51. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

52. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

53. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

54. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

55. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

56. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

57. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

58. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

59. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

60. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

61. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

62. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

63. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

64. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

65. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

66. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

67. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

68. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

69. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

70. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

71. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

72. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

73. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

74. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

75. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

76. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

77. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

78. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

79. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

80. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

81. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

82. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

83. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

84. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

85. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

86. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

87. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

88. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

89. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

90. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

91. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

92. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

93. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

94. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

95. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

96. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

97. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

98. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

99. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

100. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

101. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

102. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

103. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

104. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

105. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

106. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

107. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

108. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

109. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

110. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

111. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

112. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

113. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

114. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

115. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

116. spacer 1.1|3358|39|NZ_CP012367|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 4, identity: 0.897

caccctcgacgaaaaatcagacgctgaatccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggc	Protospacer
*******************************.* *** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19031 : 69887 42 Staphylococcus_phage(25.0%) transposase,holin,bacteriocin,integrase attL 15956:15971|attR 73922:73937
DBSCAN-SWA_2 75568 : 137927 56 Bacillus_phage(22.73%) transposase,bacteriocin,protease,integrase attL 76476:76500|attR 103472:103496
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage