Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 0 crisprs DEDDh 0 0 0 0
NZ_LN868939 Nocardia farcinica strain NCTC11134 plasmid 2, complete sequence 16 crisprs csa3,cas3,WYL,DEDDh,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 13 107 6 0
NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 1 crisprs NA 5 6 0 0
NZ_LN868938 Nocardia farcinica strain NCTC11134 chromosome 1 5 crisprs csa3,WYL,cas4,DEDDh,cas3,DinG 2 1 3 0
NZ_LN868941 Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence 0 crisprs WYL 0 0 0 0

Results visualization

1. NZ_LN868939
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_1 275041-275137 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_2 471866-471971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_3 477939-478043 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_4 1179670-1179777 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_5 1449339-1449672 Orphan I-E:NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_6 1456864-1457562 Orphan I-E
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_7 1687970-1688090 Orphan A:N
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_8 1876499-1876622 Orphan A:N
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_9 1887944-1888068 Orphan A:N
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_10 1970102-1970226 Orphan A:N
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_11 2140312-2140706 TypeI-E A:N
6 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_12 2142411-2142866 TypeI-E A:N
7 spacers
cas3,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_13 2153826-2154343 TypeI-E A:N
8 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_14 2163603-2164668 TypeI-E A:N
17 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_15 2278226-2279472 Orphan A:N
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868939_16 2651161-2651586 Orphan A:N
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_LN868938.1 221132-221163 0 1.0
NZ_LN868939_7 7.1|1688014|33|NZ_LN868939|CRISPRCasFinder 1688014-1688046 33 NZ_LN868938.1 3021497-3021529 1 0.97
NZ_LN868939_7 7.1|1688014|33|NZ_LN868939|CRISPRCasFinder 1688014-1688046 33 NZ_LN868938.1 3287902-3287934 1 0.97
NZ_LN868939_8 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder 1876546-1876575 30 NZ_LN868939.1 161559-161588 1 0.967
NZ_LN868939_11 11.5|2140585|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140585-2140616 32 NZ_LN868938.1 220595-220626 2 0.938
NZ_LN868939_14 14.24|2163998|32|NZ_LN868939|CRISPRCasFinder 2163998-2164029 32 NZ_LN868942.1 5268-5299 0 1.0
NZ_LN868939_14 14.41|2163997|33|NZ_LN868939|CRT 2163997-2164029 33 NZ_LN868942.1 5268-5300 0 1.0
NZ_LN868939_15 15.4|2278438|32|NZ_LN868939|CRISPRCasFinder 2278438-2278469 32 NZ_LN868939.1 112486-112517 0 1.0
NZ_LN868939_16 16.1|2651179|18|NZ_LN868939|CRT 2651179-2651196 18 NZ_LN868939.1 2651155-2651172 1 0.944
NZ_LN868939_16 16.1|2651179|18|NZ_LN868939|CRT 2651179-2651196 18 NZ_LN868940.1 14260-14277 1 0.944
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868939.1 2651563-2651592 0 1.0
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868939.1 2651587-2651616 1 0.967
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940.1 13817-13846 1 0.967
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868939.1 2651563-2651592 0 1.0
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868939.1 2651587-2651616 1 0.967
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940.1 13817-13846 1 0.967
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868939.1 2651563-2651592 0 1.0
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868939.1 2651587-2651616 1 0.967
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940.1 13817-13846 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868939.1 2651563-2651592 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868939.1 2651587-2651616 2 0.933
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940.1 13817-13846 2 0.933
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868939.1 2651563-2651592 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868939.1 2651587-2651616 2 0.933
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940.1 13817-13846 2 0.933

1. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to position: 221132-221163, mismatch: 0, identity: 1.0

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
gtcgagggggtgcgggtgcccgcggcgccgcc	Protospacer
********************************

2. spacer 7.1|1688014|33|NZ_LN868939|CRISPRCasFinder matches to position: 3021497-3021529, mismatch: 1, identity: 0.97

cgctcaggctgtgttggatttgcctgagcgggg	CRISPR spacer
cgctcaggctgtgttggatgtgcctgagcgggg	Protospacer
******************* *************

3. spacer 7.1|1688014|33|NZ_LN868939|CRISPRCasFinder matches to position: 3287902-3287934, mismatch: 1, identity: 0.97

cgctcaggctgtgttggatttgcctgagcgggg	CRISPR spacer
cgctcaggctgtgttggatgtgcctgagcgggg	Protospacer
******************* *************

4. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to position: 161559-161588, mismatch: 1, identity: 0.967

acggaggccgccccggtcgggcgcaaatgg	CRISPR spacer
acgcaggccgccccggtcgggcgcaaatgg	Protospacer
*** **************************

5. spacer 11.5|2140585|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to position: 220595-220626, mismatch: 2, identity: 0.938

tacgagagcaaggggatcggcctggtcctcat	CRISPR spacer
tacggaagcaaggggatcggcctggtcctcat	Protospacer
****..**************************

6. spacer 14.24|2163998|32|NZ_LN868939|CRISPRCasFinder matches to position: 5268-5299, mismatch: 0, identity: 1.0

acggtcgcccgagcgatcaacgagctacagaa	CRISPR spacer
acggtcgcccgagcgatcaacgagctacagaa	Protospacer
********************************

7. spacer 14.41|2163997|33|NZ_LN868939|CRT matches to position: 5268-5300, mismatch: 0, identity: 1.0

cacggtcgcccgagcgatcaacgagctacagaa	CRISPR spacer
cacggtcgcccgagcgatcaacgagctacagaa	Protospacer
*********************************

8. spacer 15.4|2278438|32|NZ_LN868939|CRISPRCasFinder matches to position: 112486-112517, mismatch: 0, identity: 1.0

taggcggtcaccgtgttgctgggtttgaatcg	CRISPR spacer
taggcggtcaccgtgttgctgggtttgaatcg	Protospacer
********************************

9. spacer 16.1|2651179|18|NZ_LN868939|CRT matches to position: 2651155-2651172, mismatch: 1, identity: 0.944

gcaggcccaggtgtgggc	CRISPR spacer
gcaggcccaggtgcgggc	Protospacer
*************.****

10. spacer 16.1|2651179|18|NZ_LN868939|CRT matches to position: 14260-14277, mismatch: 1, identity: 0.944

gcaggcccaggtgtgggc	CRISPR spacer
gcaggcccaggtgcgggc	Protospacer
*************.****

11. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to position: 2651563-2651592, mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

12. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to position: 2651587-2651616, mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

13. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to position: 13817-13846, mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

14. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to position: 2651563-2651592, mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

15. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to position: 2651587-2651616, mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

16. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to position: 13817-13846, mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

17. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to position: 2651563-2651592, mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

18. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to position: 2651587-2651616, mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

19. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to position: 13817-13846, mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

20. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to position: 2651563-2651592, mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

21. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to position: 2651587-2651616, mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

22. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to position: 13817-13846, mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

23. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to position: 2651563-2651592, mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

24. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to position: 2651587-2651616, mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

25. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to position: 13817-13846, mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LN868939_14 14.24|2163998|32|NZ_LN868939|CRISPRCasFinder 2163998-2164029 32 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 5268-5299 0 1.0
NZ_LN868939_14 14.24|2163998|32|NZ_LN868939|CRISPRCasFinder 2163998-2164029 32 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 3381-3412 0 1.0
NZ_LN868939_14 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder 2164608-2164639 32 NC_006363 Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence 4140-4171 0 1.0
NZ_LN868939_14 14.41|2163997|33|NZ_LN868939|CRT 2163997-2164029 33 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 5268-5300 0 1.0
NZ_LN868939_14 14.41|2163997|33|NZ_LN868939|CRT 2163997-2164029 33 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 3380-3412 0 1.0
NZ_LN868939_14 14.51|2164607|33|NZ_LN868939|CRT 2164607-2164639 33 NC_006363 Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence 4139-4171 0 1.0
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13841-13870 0 1.0
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14020-14049 0 1.0
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14044-14073 0 1.0
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14104-14133 0 1.0
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14128-14157 0 1.0
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14164-14193 0 1.0
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14188-14217 0 1.0
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13841-13870 0 1.0
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14020-14049 0 1.0
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14044-14073 0 1.0
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14104-14133 0 1.0
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14128-14157 0 1.0
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14164-14193 0 1.0
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14188-14217 0 1.0
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13841-13870 0 1.0
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14020-14049 0 1.0
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14044-14073 0 1.0
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14104-14133 0 1.0
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14128-14157 0 1.0
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14164-14193 0 1.0
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14188-14217 0 1.0
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13925-13954 0 1.0
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13996-14025 0 1.0
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13925-13954 0 1.0
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13996-14025 0 1.0
NZ_LN868939_16 16.9|2651527|42|NZ_LN868939|CRT 2651527-2651568 42 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13865-13906 0 1.0
NZ_LN868939_14 14.7|2163996|34|NZ_LN868939|PILER-CR 2163996-2164029 34 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 3379-3412 1 0.971
NZ_LN868939_14 14.7|2163996|34|NZ_LN868939|PILER-CR 2163996-2164029 34 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 5268-5301 1 0.971
NZ_LN868939_14 14.17|2164606|34|NZ_LN868939|PILER-CR 2164606-2164639 34 NC_006363 Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence 4138-4171 1 0.971
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13817-13846 1 0.967
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13901-13930 1 0.967
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13925-13954 1 0.967
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13996-14025 1 0.967
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14080-14109 1 0.967
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13817-13846 1 0.967
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13901-13930 1 0.967
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13925-13954 1 0.967
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13996-14025 1 0.967
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14080-14109 1 0.967
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13817-13846 1 0.967
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13901-13930 1 0.967
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13925-13954 1 0.967
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13996-14025 1 0.967
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14080-14109 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13949-13978 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13841-13870 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14020-14049 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14044-14073 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14104-14133 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14128-14157 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14164-14193 1 0.967
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14188-14217 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13949-13978 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13841-13870 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14020-14049 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14044-14073 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14104-14133 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14128-14157 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14164-14193 1 0.967
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14188-14217 1 0.967
NZ_LN868939_16 16.9|2651527|42|NZ_LN868939|CRT 2651527-2651568 42 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14068-14109 1 0.976
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13949-13978 2 0.933
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13877-13906 2 0.933
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14212-14241 2 0.933
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13949-13978 2 0.933
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13877-13906 2 0.933
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14212-14241 2 0.933
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13949-13978 2 0.933
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13877-13906 2 0.933
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14212-14241 2 0.933
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13972-14001 2 0.933
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13817-13846 2 0.933
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13901-13930 2 0.933
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14080-14109 2 0.933
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13972-14001 2 0.933
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13817-13846 2 0.933
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13901-13930 2 0.933
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14080-14109 2 0.933
NZ_LN868939_16 16.9|2651527|42|NZ_LN868939|CRT 2651527-2651568 42 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14152-14193 2 0.952
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MN175604 Gordonia phage PhorbesPhlower, complete genome 4681-4712 3 0.906
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MN234183 Mycobacterium phage Antsirabe, complete genome 7490-7521 3 0.906
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13972-14001 3 0.9
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13972-14001 3 0.9
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13972-14001 3 0.9
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14212-14241 3 0.9
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14212-14241 3 0.9
NZ_LN868939_16 16.9|2651527|42|NZ_LN868939|CRT 2651527-2651568 42 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13889-13930 3 0.929
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH371116 Mycobacterium phage DMoney, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH045569 Mycobacterium phage Schiebel, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH371119 Mycobacterium phage OctaviousRex, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MF919497 Mycobacterium phage Chance64, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH001456 Mycobacterium phage CLED96, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 GQ303261 Mycobacterium phage Hope, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MG099946 Mycobacterium phage LouisV14, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KC787112 Mycobacterium phage Clark, partial genome 7332-7363 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH779513 Mycobacterium phage Olga, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MK919475 Mycobacterium phage Camri, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MK310146 Mycobacterium phage Crespo, complete genome 7329-7360 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MK524493 Mycobacterium phage Darionha, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH779505 Mycobacterium phage Grizzly, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 EU568876 Mycobacterium phage BPs, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KC787107 Mycobacterium phage Bo4, complete genome 31964-31995 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MF668268 Mycobacterium phage Aroostook, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KX588251 Mycobacterium phage Jane, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KC787103 Mycobacterium phage Chy2, partial genome 6092-6123 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH001455 Mycobacterium phage Remy19, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MF141540 Mycobacterium phage Avocado, complete genome 7480-7511 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KR080198 Mycobacterium phage Cambiare, complete genome 7942-7973 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KT355472 Mycobacterium phage Cedasite, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KX664455 Mycobacterium phage Zombie, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KR080197 Mycobacterium phage FlagStaff, complete genome 7435-7466 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH077584 Mycobacterium phage Phish, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KC787108 Mycobacterium phage DNAIII, complete genome 7337-7368 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MN444875 Mycobacterium phage Jonghyun, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MK433279 Mycobacterium phage Kareem, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KJ725374 Mycobacterium phage Guo1, complete genome 26492-26523 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MT818422 Mycobacterium phage Periodt, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MK305884 Mycobacterium phage BQuat, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MF668272 Mycobacterium phage Gideon, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KC787111 Mycobacterium phage Sedge, partial genome 7268-7299 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KC787104 Mycobacterium phage Chy3, partial genome 7707-7738 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 NC_012788 Mycobacterium phage Angel, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KX443326 Mycobacterium phage BruceB, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MK433277 Mycobacterium phage Renaissance, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH590605 Mycobacterium phage Cherrybomb426, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH779509 Mycobacterium phage Kasen3, complete genome 7329-7360 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 JN699002 Mycobacterium phage Avrafan, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH779507 Mycobacterium phage Hotshotbaby7, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KT355474 Mycobacterium phage Frosty24, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KC787109 Mycobacterium phage Legendre, partial genome 33380-33411 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 JN412593 Mycobacterium phage Liefie, complete genome 7327-7358 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH479920 Mycobacterium phage Mowgli, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KM923970 Mycobacterium phage Gomashi, complete genome 7329-7360 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH450127 Mycobacterium phage Plagueis, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KT347314 Mycobacterium phage Phreak, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KT365399 Mycobacterium phage Annihilator, complete genome 7328-7359 4 0.875
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KC787110 Mycobacterium phage Leo, complete genome 7344-7375 4 0.875
NZ_LN868939_14 14.11|2164240|34|NZ_LN868939|PILER-CR 2164240-2164273 34 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 298791-298824 4 0.882
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 275725-275753 4 0.862
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MK524494 Mycobacterium phage Rabbs, complete genome 7324-7355 5 0.844
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KX641266 Mycobacterium phage Terror, complete genome 7333-7364 5 0.844
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 NC_031102 Mycobacterium phage Sneeze, complete genome 7323-7354 5 0.844
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KX641265 Mycobacterium phage Taheera, complete genome 7333-7364 5 0.844
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MH779514 Mycobacterium phage Paito, complete genome 7387-7418 5 0.844
NZ_LN868939_6 6.9|1457380|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457380-1457411 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 5504-5535 5 0.844
NZ_LN868939_6 6.9|1457380|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457380-1457411 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 58564-58595 5 0.844
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 218172-218203 5 0.844
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 239876-239907 5 0.844
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 77107-77138 5 0.844
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 135662-135693 5 0.844
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 642255-642286 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 885610-885641 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 304880-304911 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1755952-1755983 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1782592-1782623 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 889255-889286 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 78897-78928 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1813403-1813434 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1842910-1842941 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1987227-1987258 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1465753-1465784 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 670731-670762 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1745303-1745334 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 357232-357263 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 551320-551351 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1822887-1822918 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 654106-654137 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1530493-1530524 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1763220-1763251 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1758090-1758121 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1828855-1828886 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1340928-1340959 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1701049-1701080 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1759457-1759488 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1834367-1834398 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1828822-1828853 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1736303-1736334 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1813802-1813833 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1827565-1827596 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1722761-1722792 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1736615-1736646 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1813802-1813833 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1827664-1827695 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1736303-1736334 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1723408-1723439 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1735506-1735537 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1813802-1813833 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1813802-1813833 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1813802-1813833 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1827660-1827691 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 218422-218453 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1827649-1827680 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1722784-1722815 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1738435-1738466 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1719074-1719105 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1780130-1780161 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1812118-1812149 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1811117-1811148 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1827649-1827680 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1722784-1722815 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1736614-1736645 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1828646-1828677 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1722784-1722815 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1722784-1722815 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1827660-1827691 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1813807-1813838 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 188209-188240 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1827671-1827702 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1827472-1827503 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 188209-188240 5 0.844
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 2765-2796 5 0.844
NZ_LN868939_14 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder 2163815-2163846 32 NC_048169 Gordonia phage BrutonGaster, complete genome 8000-8031 5 0.844
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 298791-298822 5 0.844
NZ_LN868939_14 14.45|2164241|33|NZ_LN868939|CRT 2164241-2164273 33 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 298791-298823 5 0.848
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 216486-216514 5 0.828
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 777879-777907 5 0.828
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 307265-307293 5 0.828
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 816169-816202 5 0.853
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 417938-417971 5 0.853
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 75195-75228 5 0.853
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 75026-75057 5 0.844
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 75027-75057 5 0.839
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 777879-777909 5 0.839
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14224-14253 5 0.833
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14224-14253 5 0.833
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14224-14253 5 0.833
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MN234219 Mycobacterium phage Mercurio, complete genome 7140-7171 6 0.812
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 KJ410133 Mycobacterium phage Jolie2, complete genome 6472-6503 6 0.812
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 MN234185 Mycobacterium phage Lemuria, complete genome 6512-6543 6 0.812
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 KR053197 Gordonia phage GRU3, complete genome 11552-11583 6 0.812
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 333629-333660 6 0.812
NZ_LN868939_6 6.11|1457502|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457502-1457533 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 779584-779615 6 0.812
NZ_LN868939_8 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder 1876546-1876575 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 690121-690150 6 0.8
NZ_LN868939_8 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder 1876546-1876575 30 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 503782-503811 6 0.8
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP019313 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-1, complete sequence 68335-68366 6 0.812
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 118869-118900 6 0.812
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 7564-7595 6 0.812
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1644621-1644652 6 0.812
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 267604-267635 6 0.812
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 132591-132622 6 0.812
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP024892 Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence 205421-205452 6 0.812
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 352577-352608 6 0.812
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1842911-1842942 6 0.812
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 180902-180933 6 0.812
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP037914 Sphingomonas sp. AAP5 plasmid p213, complete sequence 109105-109136 6 0.812
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP038031 Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence 73465-73496 6 0.812
NZ_LN868939_14 14.6|2163935|34|NZ_LN868939|PILER-CR 2163935-2163968 34 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 607764-607797 6 0.824
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 126099-126130 6 0.812
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 209863-209894 6 0.812
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1447700-1447731 6 0.812
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 597632-597663 6 0.812
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 684669-684700 6 0.812
NZ_LN868939_14 14.38|2163814|33|NZ_LN868939|CRT 2163814-2163846 33 NC_048169 Gordonia phage BrutonGaster, complete genome 7999-8031 6 0.818
NZ_LN868939_14 14.40|2163936|33|NZ_LN868939|CRT 2163936-2163968 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 607764-607796 6 0.818
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 209863-209895 6 0.818
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1447700-1447732 6 0.818
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 597632-597664 6 0.818
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 684668-684700 6 0.818
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 KX452697 UNVERIFIED: Serratia phage KPN4 genomic sequence 9273-9304 6 0.812
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 JX878496 Serratia phage phiMAM1, complete genome 26157-26188 6 0.812
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 134882-134910 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5398008-5398036 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_LT703507 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3 24805-24833 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 95272-95300 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP015273 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence 17028-17056 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP023153 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence 70942-70970 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 75027-75055 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP029333 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence 18860-18888 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP019224 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence 18780-18808 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP045964 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence 8271-8299 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NC_022654 Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence 104499-104527 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 MN694695 Marine virus AFVG_250M866, complete genome 2095-2123 6 0.793
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 281316-281344 6 0.793
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NC_048021 Gordonia phage Daredevil, complete genome 11990-12021 6 0.812
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NZ_LR134462 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence 1127-1158 6 0.812
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 576700-576731 6 0.812
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 118185-118216 6 0.812
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 525161-525192 6 0.812
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 974145-974176 6 0.812
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 406676-406706 6 0.806
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 667326-667359 6 0.824
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 354169-354200 6 0.812
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 777878-777909 6 0.812
NZ_LN868939_15 15.45|2278560|34|NZ_LN868939|CRT 2278560-2278593 34 KX452697 UNVERIFIED: Serratia phage KPN4 genomic sequence 9271-9304 6 0.824
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 134880-134910 6 0.806
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 526457-526487 6 0.806
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 216486-216516 6 0.806
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 307265-307295 6 0.806
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 138700-138730 6 0.806
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 263073-263103 6 0.806
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 138701-138731 6 0.806
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 AF311651 Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds 855-885 6 0.806
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14248-14277 6 0.8
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 842405-842434 6 0.8
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 184970-184999 6 0.8
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 110336-110365 6 0.8
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14248-14277 6 0.8
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 842405-842434 6 0.8
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 184970-184999 6 0.8
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 110336-110365 6 0.8
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 CP000663 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 43761-43792 7 0.781
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NZ_CP031752 Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence 88869-88900 7 0.781
NZ_LN868939_6 6.1|1456893|31|NZ_LN868939|CRT 1456893-1456923 31 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 845186-845216 7 0.774
NZ_LN868939_6 6.1|1456893|31|NZ_LN868939|CRT 1456893-1456923 31 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 245885-245915 7 0.774
NZ_LN868939_6 6.1|1456893|31|NZ_LN868939|CRT 1456893-1456923 31 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 208015-208045 7 0.774
NZ_LN868939_6 6.3|1457014|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457014-1457045 32 NZ_MF621618 Aeromonas salmonicida subsp. salmonicida strain HER1084 plasmid pAsaXII, complete sequence 7614-7645 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1042971-1043002 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 644701-644732 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 301957-301988 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 215942-215973 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 219650-219681 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 219646-219677 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 219550-219581 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 218125-218156 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 223581-223612 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 219646-219677 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 218125-218156 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 219550-219581 7 0.781
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 210857-210888 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 226163-226194 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 163488-163519 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 MT074151 Bacteroides phage SJC13, complete genome 8438-8469 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 MT074159 Bacteroides phage SJC23, complete genome 8435-8466 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 89135-89166 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_HG917973 Mycobacterium marinum E11 plasmid pRAW, complete sequence 75760-75791 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_AP018497 Mycobacterium marinum strain ATCC 927 plasmid pMMRN, complete sequence 23985-24016 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP013255 Kocuria flava strain HO-9041 plasmid 1, complete sequence 26587-26618 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 204395-204426 7 0.781
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NC_006824 Aromatoleum aromaticum EbN1 plasmid 2, complete sequence 215611-215642 7 0.781
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 397673-397704 7 0.781
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 429743-429774 7 0.781
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1075476-1075507 7 0.781
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 469772-469803 7 0.781
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP046321 Gordonia bronchialis strain FDAARGOS_676 plasmid unnamed1, complete sequence 66727-66758 7 0.781
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NC_013442 Gordonia bronchialis DSM 43247 plasmid pGBRO01, complete sequence 62480-62511 7 0.781
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 968520-968551 7 0.781
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 265421-265452 7 0.781
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 581360-581391 7 0.781
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 321209-321240 7 0.781
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 760953-760984 7 0.781
NZ_LN868939_11 11.5|2140585|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140585-2140616 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 61487-61518 7 0.781
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NZ_CP024892 Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence 180266-180297 7 0.781
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NC_031265 Gordonia phage Guacamole, complete genome 40032-40063 7 0.781
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 MK967389 Gordonia phage JasperJr, complete genome 40032-40063 7 0.781
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 MT723936 Gordonia phage Hitter, complete genome 39578-39609 7 0.781
NZ_LN868939_12 12.2|2142501|32|NZ_LN868939|CRISPRCasFinder,CRT 2142501-2142532 32 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 385103-385134 7 0.781
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1698722-1698753 7 0.781
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_015952 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence 137925-137956 7 0.781
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 101627-101658 7 0.781
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 37741-37772 7 0.781
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 739827-739858 7 0.781
NZ_LN868939_12 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT 2142745-2142776 32 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 749-780 7 0.781
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 MT701591 Burkholderia phage Mana, complete genome 19370-19401 7 0.781
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 KP966108 Burkholderia phage vB_BceM_AP3, complete genome 22863-22894 7 0.781
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MN234192 Streptomyces phage Animus, complete genome 17585-17616 7 0.781
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MF766047 Streptomyces phage SqueakyClean, complete genome 17511-17542 7 0.781
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 23602-23633 7 0.781
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 2063125-2063156 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 MH513974 Gordonia phage LastResort, complete genome 13066-13097 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 KX557283 Gordonia phage Remus, complete genome 13027-13058 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 MF668282 Gordonia phage ShayRa, complete genome 13188-13219 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 KX557280 Gordonia phage JSwag, complete genome 13052-13083 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NC_030698 Gordonia phage Soups, complete genome 13188-13219 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 KU998251 Gordonia phage KatherineG, complete genome 13188-13219 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NC_042123 Gordonia phage Waits, complete genome 13033-13064 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 MN284898 Gordonia phage MinecraftSteve, complete genome 13188-13219 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NC_041886 Gordonia phage Strosahl, complete genome 13027-13058 7 0.781
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NC_030694 Gordonia phage Rosalind, complete genome 13188-13219 7 0.781
NZ_LN868939_14 14.4|2163813|34|NZ_LN868939|PILER-CR 2163813-2163846 34 NC_048169 Gordonia phage BrutonGaster, complete genome 7998-8031 7 0.794
NZ_LN868939_14 14.9|2164118|34|NZ_LN868939|PILER-CR 2164118-2164151 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 1095622-1095655 7 0.794
NZ_LN868939_14 14.11|2164240|34|NZ_LN868939|PILER-CR 2164240-2164273 34 NC_010604 Mycobacterium marinum M plasmid pMM23, complete sequence 12074-12107 7 0.794
NZ_LN868939_14 14.11|2164240|34|NZ_LN868939|PILER-CR 2164240-2164273 34 NZ_CP034180 Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence 4386-4419 7 0.794
NZ_LN868939_14 14.11|2164240|34|NZ_LN868939|PILER-CR 2164240-2164273 34 NC_010394 Mycobacterium abscessus plasmid, complete sequence 6133-6166 7 0.794
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 684667-684700 7 0.794
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 209863-209896 7 0.794
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1447700-1447733 7 0.794
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 597632-597665 7 0.794
NZ_LN868939_14 14.14|2164423|34|NZ_LN868939|PILER-CR 2164423-2164456 34 MT936332 Streptomyces phage phiRKBJ001, complete genome 60439-60472 7 0.794
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 304804-304835 7 0.781
NZ_LN868939_14 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder 2163815-2163846 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 357246-357277 7 0.781
NZ_LN868939_14 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder 2163815-2163846 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 690161-690192 7 0.781
NZ_LN868939_14 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder 2163815-2163846 32 NZ_CP012183 Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence 29554-29585 7 0.781
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 KX576640 Arthrobacter phage RcigaStruga, complete genome 39678-39709 7 0.781
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 MG210949 Arthrobacter phage Huntingdon, complete genome 39678-39709 7 0.781
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 MK112529 Arthrobacter phage BigMack, complete genome 38375-38406 7 0.781
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 MH179474 Aeromonas phage 62AhydR11PP, complete genome 16574-16605 7 0.781
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2371938-2371969 7 0.781
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 MN586026 Gordonia phage Leonard, complete genome 21897-21928 7 0.781
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NC_031112 Gordonia phage Phinally, complete genome 21894-21925 7 0.781
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 156525-156556 7 0.781
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NC_021347 Rhodococcus phage E3, complete genome 39040-39071 7 0.781
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1034971-1035002 7 0.781
NZ_LN868939_14 14.27|2164181|32|NZ_LN868939|CRISPRCasFinder 2164181-2164212 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 902740-902771 7 0.781
NZ_LN868939_14 14.27|2164181|32|NZ_LN868939|CRISPRCasFinder 2164181-2164212 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 762640-762671 7 0.781
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NC_010604 Mycobacterium marinum M plasmid pMM23, complete sequence 12074-12105 7 0.781
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NZ_CP034180 Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence 4388-4419 7 0.781
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NC_010394 Mycobacterium abscessus plasmid, complete sequence 6135-6166 7 0.781
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 8096-8127 7 0.781
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 240216-240247 7 0.781
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 220341-220372 7 0.781
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 MT939492 Xanthomonas phage Xoo-sp14, complete genome 123049-123080 7 0.781
NZ_LN868939_14 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder 2164608-2164639 32 NC_010627 Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence 167356-167387 7 0.781
NZ_LN868939_14 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder 2164608-2164639 32 NC_018696 Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence 38472-38503 7 0.781
NZ_LN868939_14 14.35|2163631|33|NZ_LN868939|CRT 2163631-2163663 33 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 126098-126130 7 0.788
NZ_LN868939_14 14.40|2163936|33|NZ_LN868939|CRT 2163936-2163968 33 MN586026 Gordonia phage Leonard, complete genome 21896-21928 7 0.788
NZ_LN868939_14 14.40|2163936|33|NZ_LN868939|CRT 2163936-2163968 33 NC_031112 Gordonia phage Phinally, complete genome 21893-21925 7 0.788
NZ_LN868939_14 14.42|2164058|33|NZ_LN868939|CRT 2164058-2164090 33 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 61825-61857 7 0.788
NZ_LN868939_15 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder 2278499-2278530 32 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 99606-99637 7 0.781
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 342495-342526 7 0.781
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 106357-106385 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 354171-354199 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 326924-326952 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 309563-309591 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 326924-326952 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NC_017791 Deinococcus gobiensis I-0 plasmid P2, complete sequence 220290-220318 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NC_017791 Deinococcus gobiensis I-0 plasmid P2, complete sequence 228470-228498 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1014751-1014779 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 AP013686 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS *** 30463-30491 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 AP013685 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS *** 11730-11758 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 AP013676 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS *** 13857-13885 7 0.759
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 AF311651 Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds 857-885 7 0.759
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 NC_012523 Rhodococcus opacus B4 plasmid pKNR, complete sequence 29336-29367 7 0.781
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 KM083128 Mycobacterium phage Sparky, complete genome 61222-61253 7 0.781
NZ_LN868939_15 15.14|2279045|32|NZ_LN868939|CRISPRCasFinder 2279045-2279076 32 NZ_CP044987 Deinococcus sp. AJ005 plasmid p96k, complete sequence 46984-47015 7 0.781
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 161725-161756 7 0.781
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1788918-1788949 7 0.781
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 MT310863 Streptomyces phage Issmi, complete genome 1433-1464 7 0.781
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP011506 Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence 22269-22299 7 0.774
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 21839-21869 7 0.774
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 651363-651396 7 0.794
NZ_LN868939_15 15.26|2278559|35|NZ_LN868939|PILER-CR 2278559-2278593 35 KX452697 UNVERIFIED: Serratia phage KPN4 genomic sequence 9271-9305 7 0.8
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 134880-134911 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 128428-128459 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 526456-526487 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 216485-216516 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 139344-139375 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 138699-138730 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 263073-263104 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 138700-138731 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 25184-25215 7 0.781
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 AF311651 Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds 855-886 7 0.781
NZ_LN868939_15 15.45|2278560|34|NZ_LN868939|CRT 2278560-2278593 34 JX878496 Serratia phage phiMAM1, complete genome 26155-26188 7 0.794
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5398008-5398038 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1413866-1413896 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 316164-316194 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_LT703507 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3 24805-24835 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 95270-95300 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP015273 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence 17028-17058 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP023153 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence 70940-70970 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP029333 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence 18860-18890 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP019224 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence 18778-18808 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP045964 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence 8271-8301 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_022654 Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence 104499-104529 7 0.774
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 25184-25214 7 0.774
NZ_LN868939_15 15.49|2278801|34|NZ_LN868939|CRT 2278801-2278834 34 NZ_LR134462 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence 1127-1160 7 0.794
NZ_LN868939_15 15.58|2279350|33|NZ_LN868939|CRT 2279350-2279382 33 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 318400-318432 7 0.788
NZ_LN868939_5 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT 1449368-1449399 32 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 70551-70582 8 0.75
NZ_LN868939_5 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT 1449368-1449399 32 NZ_CP024892 Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence 7111-7142 8 0.75
NZ_LN868939_5 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT 1449368-1449399 32 NZ_CP024892 Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence 34366-34397 8 0.75
NZ_LN868939_5 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT 1449368-1449399 32 NZ_CP024892 Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence 233873-233904 8 0.75
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 149016-149047 8 0.75
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 378137-378168 8 0.75
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 193919-193950 8 0.75
NZ_LN868939_6 6.1|1456893|31|NZ_LN868939|CRT 1456893-1456923 31 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 258194-258224 8 0.742
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 36603-36634 8 0.75
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 MK801721 Gordonia phage William, complete genome 17502-17533 8 0.75
NZ_LN868939_6 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457319-1457350 32 MK977706 Corynebacterium phage Dina, complete genome 39049-39080 8 0.75
NZ_LN868939_6 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457319-1457350 32 MH926061 Corynebacterium phage Troy, complete genome 39457-39488 8 0.75
NZ_LN868939_6 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457319-1457350 32 NC_048791 Corynebacterium phage Adelaide, complete genome 39973-40004 8 0.75
NZ_LN868939_6 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457319-1457350 32 NC_048069 Corynebacterium phage SamW, complete genome 39457-39488 8 0.75
NZ_LN868939_6 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457319-1457350 32 NC_048790 Corynebacterium phage Lederberg, complete genome 39842-39873 8 0.75
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 594447-594478 8 0.75
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 248113-248144 8 0.75
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 36340-36371 8 0.75
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 220130-220161 8 0.75
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 101314-101345 8 0.75
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 109457-109488 8 0.75
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NC_020542 Sphingomonas sp. MM-1 plasmid pISP0, complete sequence 154175-154206 8 0.75
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 59791-59822 8 0.75
NZ_LN868939_9 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder 1887990-1888022 33 MK479295 Salmonella phage SEE-1, complete genome 22569-22601 8 0.758
NZ_LN868939_9 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder 1887990-1888022 33 MT012729 Salmonella phage vB_SenTO17, complete genome 32655-32687 8 0.758
NZ_LN868939_9 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder 1887990-1888022 33 MK214385 Salmonella phage TS6, complete genome 20133-20165 8 0.758
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1590477-1590508 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2298797-2298828 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 211138-211169 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 47950-47981 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP011667 Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence 40951-40982 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 909310-909341 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 391892-391923 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP033583 Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence 199410-199441 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 596474-596505 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP041744 Paraburkholderia megapolitana strain LMG 23650 plasmid unnamed1, complete sequence 77004-77035 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 MH590601 Streptomyces phage Haizum, complete genome 22243-22274 8 0.75
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 MK392364 Streptomyces phage Nishikigoi, complete genome 22243-22274 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NC_013531 Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence 14430-14461 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015451 Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence 922-953 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015451 Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence 7256-7287 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015451 Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence 13592-13623 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015451 Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence 19932-19963 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015451 Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence 26338-26369 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015451 Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence 32645-32676 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015452 Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence 3421-3452 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015452 Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence 9747-9778 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015452 Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence 16060-16091 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015452 Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence 22392-22423 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP015452 Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence 28727-28758 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 461152-461183 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 161811-161842 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 220356-220387 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 461152-461183 8 0.75
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 CP003950 Rhodococcus opacus PD630 plasmid 1, complete sequence 151905-151936 8 0.75
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 928443-928474 8 0.75
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 311094-311125 8 0.75
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 132588-132619 8 0.75
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 193335-193366 8 0.75
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 349680-349711 8 0.75
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP014679 Kozakia baliensis strain DSM 14400 plasmid pKB14400_5 28516-28547 8 0.75
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 412102-412133 8 0.75
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NZ_CP039914 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625c, complete sequence 15960-15991 8 0.75
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 4972-5003 8 0.75
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 22550-22581 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_LR134470 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 28, complete sequence 43452-43483 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 802085-802116 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 88646-88677 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 11543-11574 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 52047-52078 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP038031 Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence 33785-33816 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 CP003958 Rhodococcus opacus PD630 plasmid 9, complete sequence 13102-13133 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 CP003952 Rhodococcus opacus PD630 plasmid 3, complete sequence 53921-53952 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 280212-280243 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 MN183284 Microbacterium phage Mashley, complete genome 51872-51903 8 0.75
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_047973 Microbacterium phage Hyperion, complete genome 51350-51381 8 0.75
NZ_LN868939_12 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT 2142745-2142776 32 NC_015579 Novosphingobium sp. PP1Y plasmid Lpl, complete sequence 122060-122091 8 0.75
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 368527-368558 8 0.75
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 MN204496 Streptomyces phage Kardashian, complete genome 25269-25300 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP021119 Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence 54456-54487 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 731813-731844 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 118850-118881 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP040995 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence 3965-3996 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 42434-42465 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 42434-42465 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 152578-152609 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 65971-66002 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP011044 Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI1, complete sequence 27460-27491 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP021035 Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI1, complete sequence 27460-27491 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP021039 Clavibacter michiganensis subsp. insidiosus strain ATCC 10253 plasmid pCI1, complete sequence 27465-27496 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP016618 Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence 295506-295537 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 MK977714 Corynebacterium phage Bran, complete genome 41646-41677 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 MK977706 Corynebacterium phage Dina, complete genome 41543-41574 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 MH926061 Corynebacterium phage Troy, complete genome 41771-41802 8 0.75
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NC_048069 Corynebacterium phage SamW, complete genome 41771-41802 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NC_017311 Desulfovibrio vulgaris RCH1 plasmid pDEVAL01, complete sequence 4349-4380 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NC_005863 Desulfovibrio vulgaris str. Hildenborough plasmid pDV, complete sequence 9793-9824 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NC_008741 Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence 191228-191259 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 610146-610177 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 354743-354774 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 60943-60974 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 307692-307723 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 233835-233866 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NC_022044 Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence 150968-150999 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP022197 Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence 79546-79577 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 303244-303275 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP021117 Rhodobacteraceae bacterium strain G7 plasmid unnamed3, complete sequence 122-153 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP004396 Celeribacter indicus strain P73 plasmid pP73C, complete sequence 58180-58211 8 0.75
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP053565 Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence 32319-32350 8 0.75
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NC_009956 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence 65247-65278 8 0.75
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 MT522007 Gordonia phage Epsocamisio, complete genome 13066-13097 8 0.75
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 MK967382 Gordonia phage ReMo, complete genome 13066-13097 8 0.75
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1364003-1364034 8 0.75
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 464641-464672 8 0.75
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 258126-258157 8 0.75
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 298021-298052 8 0.75
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP010871 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence 49563-49594 8 0.75
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP053710 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence 47845-47876 8 0.75
NZ_LN868939_14 14.1|2163630|34|NZ_LN868939|PILER-CR 2163630-2163663 34 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 126097-126130 8 0.765
NZ_LN868939_14 14.1|2163630|34|NZ_LN868939|PILER-CR 2163630-2163663 34 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 979567-979600 8 0.765
NZ_LN868939_14 14.4|2163813|34|NZ_LN868939|PILER-CR 2163813-2163846 34 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 357244-357277 8 0.765
NZ_LN868939_14 14.4|2163813|34|NZ_LN868939|PILER-CR 2163813-2163846 34 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 690161-690194 8 0.765
NZ_LN868939_14 14.4|2163813|34|NZ_LN868939|PILER-CR 2163813-2163846 34 NZ_CP012183 Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence 29552-29585 8 0.765
NZ_LN868939_14 14.6|2163935|34|NZ_LN868939|PILER-CR 2163935-2163968 34 MN586026 Gordonia phage Leonard, complete genome 21895-21928 8 0.765
NZ_LN868939_14 14.6|2163935|34|NZ_LN868939|PILER-CR 2163935-2163968 34 NC_031112 Gordonia phage Phinally, complete genome 21892-21925 8 0.765
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 33389-33422 8 0.765
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP033221 Parasedimentitalea marina strain W43 plasmid pW43B, complete sequence 213083-213116 8 0.765
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP033222 Parasedimentitalea marina strain W43 plasmid pW43C, complete sequence 125114-125147 8 0.765
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 5246-5277 8 0.75
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 29869-29900 8 0.75
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NC_015852 Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence 1861-1892 8 0.75
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 427603-427634 8 0.75
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NZ_CP035512 Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence 318094-318125 8 0.75
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1945023-1945054 8 0.75
NZ_LN868939_14 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder 2163815-2163846 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 304559-304590 8 0.75
NZ_LN868939_14 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder 2163815-2163846 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 744051-744082 8 0.75
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP042265 Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence 102613-102644 8 0.75
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2128698-2128729 8 0.75
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 607764-607795 8 0.75
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 91205-91236 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 1252-1283 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 407923-407954 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 994-1025 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 106050-106081 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NC_003064 Agrobacterium fabrum str. C58 plasmid At, complete sequence 206802-206833 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NZ_CP024896 Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence 14385-14416 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 MH834599 Microbacterium phage Bernstein, complete genome 13156-13187 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 MH834602 Microbacterium phage Brahms, complete genome 13096-13127 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 MN183281 Microbacterium phage Vitas, complete genome 13096-13127 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 MH834626 Microbacterium phage Rollins, complete genome 13156-13187 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 MH834604 Microbacterium phage Coltrane, complete genome 13096-13127 8 0.75
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 MH834596 Microbacterium phage Armstrong, complete genome 13096-13127 8 0.75
NZ_LN868939_14 14.26|2164120|32|NZ_LN868939|CRISPRCasFinder 2164120-2164151 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 416172-416203 8 0.75
NZ_LN868939_14 14.26|2164120|32|NZ_LN868939|CRISPRCasFinder 2164120-2164151 32 HM461982 Burkholderia phage KS14, complete genome 10715-10746 8 0.75
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2393148-2393179 8 0.75
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 154157-154188 8 0.75
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 401504-401535 8 0.75
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 429169-429200 8 0.75
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 101312-101343 8 0.75
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 564944-564975 8 0.75
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 33389-33420 8 0.75
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1818774-1818805 8 0.75
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NC_008713 Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence 137449-137480 8 0.75
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP054600 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed1, complete sequence 76416-76447 8 0.75
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1227934-1227965 8 0.75
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 371881-371912 8 0.75
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 246795-246826 8 0.75
NZ_LN868939_14 14.31|2164425|32|NZ_LN868939|CRISPRCasFinder 2164425-2164456 32 KU963249 Gordonia phage Yeezy, complete genome 41076-41107 8 0.75
NZ_LN868939_14 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder 2164486-2164517 32 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1148851-1148882 8 0.75
NZ_LN868939_14 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder 2164486-2164517 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1963881-1963912 8 0.75
NZ_LN868939_14 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder 2164547-2164578 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 1048306-1048337 8 0.75
NZ_LN868939_14 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder 2164608-2164639 32 MN445183 Salmonella phage vB_SalM_SA002, complete genome 77554-77585 8 0.75
NZ_LN868939_14 14.35|2163631|33|NZ_LN868939|CRT 2163631-2163663 33 NC_015852 Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence 1860-1892 8 0.758
NZ_LN868939_14 14.38|2163814|33|NZ_LN868939|CRT 2163814-2163846 33 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 357245-357277 8 0.758
NZ_LN868939_14 14.38|2163814|33|NZ_LN868939|CRT 2163814-2163846 33 NZ_CP012183 Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence 29553-29585 8 0.758
NZ_LN868939_14 14.38|2163814|33|NZ_LN868939|CRT 2163814-2163846 33 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 690161-690193 8 0.758
NZ_LN868939_14 14.39|2163875|33|NZ_LN868939|CRT 2163875-2163907 33 KX576640 Arthrobacter phage RcigaStruga, complete genome 39678-39710 8 0.758
NZ_LN868939_14 14.39|2163875|33|NZ_LN868939|CRT 2163875-2163907 33 MG210949 Arthrobacter phage Huntingdon, complete genome 39678-39710 8 0.758
NZ_LN868939_14 14.39|2163875|33|NZ_LN868939|CRT 2163875-2163907 33 MK112529 Arthrobacter phage BigMack, complete genome 38375-38407 8 0.758
NZ_LN868939_14 14.40|2163936|33|NZ_LN868939|CRT 2163936-2163968 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2371938-2371970 8 0.758
NZ_LN868939_14 14.40|2163936|33|NZ_LN868939|CRT 2163936-2163968 33 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 91204-91236 8 0.758
NZ_LN868939_14 14.42|2164058|33|NZ_LN868939|CRT 2164058-2164090 33 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1034970-1035002 8 0.758
NZ_LN868939_14 14.42|2164058|33|NZ_LN868939|CRT 2164058-2164090 33 NZ_CP024896 Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence 14384-14416 8 0.758
NZ_LN868939_14 14.42|2164058|33|NZ_LN868939|CRT 2164058-2164090 33 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 1251-1283 8 0.758
NZ_LN868939_14 14.42|2164058|33|NZ_LN868939|CRT 2164058-2164090 33 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 407923-407955 8 0.758
NZ_LN868939_14 14.42|2164058|33|NZ_LN868939|CRT 2164058-2164090 33 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 993-1025 8 0.758
NZ_LN868939_14 14.42|2164058|33|NZ_LN868939|CRT 2164058-2164090 33 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 106050-106082 8 0.758
NZ_LN868939_14 14.45|2164241|33|NZ_LN868939|CRT 2164241-2164273 33 NZ_CP034180 Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence 4387-4419 8 0.758
NZ_LN868939_14 14.45|2164241|33|NZ_LN868939|CRT 2164241-2164273 33 NC_010394 Mycobacterium abscessus plasmid, complete sequence 6134-6166 8 0.758
NZ_LN868939_14 14.45|2164241|33|NZ_LN868939|CRT 2164241-2164273 33 NC_010604 Mycobacterium marinum M plasmid pMM23, complete sequence 12074-12106 8 0.758
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 33389-33421 8 0.758
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 240216-240248 8 0.758
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 220341-220373 8 0.758
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NC_008713 Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence 137449-137481 8 0.758
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 MT939492 Xanthomonas phage Xoo-sp14, complete genome 123049-123081 8 0.758
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_007491 Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence 266406-266437 8 0.75
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 215053-215084 8 0.75
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 258196-258227 8 0.75
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 496604-496635 8 0.75
NZ_LN868939_15 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder 2278499-2278530 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 27955-27986 8 0.75
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 77704-77735 8 0.75
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 682456-682487 8 0.75
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 172762-172790 8 0.724
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 459503-459531 8 0.724
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP026696 Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence 17592-17620 8 0.724
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 320110-320138 8 0.724
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 320110-320138 8 0.724
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 18697-18725 8 0.724
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 128429-128457 8 0.724
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 KT997874 Uncultured Mediterranean phage uvDeep-CGR2-KM23-C198, complete genome 21593-21621 8 0.724
NZ_LN868939_15 15.9|2278740|32|NZ_LN868939|CRISPRCasFinder 2278740-2278771 32 MH316566 Gordonia phage Nedarya, complete genome 4595-4626 8 0.75
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1376738-1376769 8 0.75
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 102773-102804 8 0.75
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1987928-1987959 8 0.75
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 26128-26159 8 0.75
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 162892-162923 8 0.75
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 MH077578 Mycobacterium phage DillTech15, complete genome 56881-56912 8 0.75
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 MT684586 Mycobacterium phage Gandalph, complete genome 54057-54088 8 0.75
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 MH371120 Mycobacterium phage OlympiaSaint, complete genome 57380-57411 8 0.75
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 KT281795 Mycobacterium phage XFactor, complete genome 54700-54731 8 0.75
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 131907-131938 8 0.75
NZ_LN868939_15 15.14|2279045|32|NZ_LN868939|CRISPRCasFinder 2279045-2279076 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 118963-118994 8 0.75
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 224475-224506 8 0.75
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 229148-229179 8 0.75
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 927178-927209 8 0.75
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 619885-619916 8 0.75
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_CP023740 Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence 159555-159586 8 0.75
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NC_048047 Caulobacter phage CcrBL9, complete genome 225980-226011 8 0.75
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 13785-13815 8 0.742
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 5544-5574 8 0.742
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP015032 Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence 225807-225837 8 0.742
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3128088-3128118 8 0.742
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NC_048046 Caulobacter phage CcrPW, complete genome 43368-43398 8 0.742
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 JX100810 Caulobacter phage CcrColossus, complete genome 41176-41206 8 0.742
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 73710-73740 8 0.742
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 173537-173570 8 0.765
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 159424-159457 8 0.765
NZ_LN868939_15 15.26|2278559|35|NZ_LN868939|PILER-CR 2278559-2278593 35 JX878496 Serratia phage phiMAM1, complete genome 26155-26189 8 0.771
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5398007-5398038 8 0.75
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1413865-1413896 8 0.75
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 316164-316195 8 0.75
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1744423-1744454 8 0.75
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP023670 Methylomonas koyamae strain LM6 plasmid pLM6, complete sequence 103867-103898 8 0.75
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 KU984979 Propionibacterium phage PFR1, complete genome 6769-6800 8 0.75
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NC_031108 Propionibacterium phage PFR2, complete genome 6769-6800 8 0.75
NZ_LN868939_15 15.30|2278800|35|NZ_LN868939|PILER-CR 2278800-2278834 35 NC_048021 Gordonia phage Daredevil, complete genome 11988-12022 8 0.771
NZ_LN868939_15 15.37|2279227|35|NZ_LN868939|PILER-CR 2279227-2279261 35 NZ_CP023740 Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence 159553-159587 8 0.771
NZ_LN868939_15 15.39|2279349|34|NZ_LN868939|PILER-CR 2279349-2279382 34 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 318400-318433 8 0.765
NZ_LN868939_15 15.44|2278499|34|NZ_LN868939|CRT 2278499-2278532 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 99606-99639 8 0.765
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 128429-128459 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 106357-106387 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 MN694695 Marine virus AFVG_250M866, complete genome 2095-2125 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 281316-281346 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 354169-354199 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 139345-139375 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP026696 Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence 17592-17622 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 694086-694116 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1744423-1744453 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 KU984979 Propionibacterium phage PFR1, complete genome 6769-6799 8 0.742
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_031108 Propionibacterium phage PFR2, complete genome 6769-6799 8 0.742
NZ_LN868939_15 15.49|2278801|34|NZ_LN868939|CRT 2278801-2278834 34 NC_048021 Gordonia phage Daredevil, complete genome 11988-12021 8 0.765
NZ_LN868939_15 15.51|2278923|34|NZ_LN868939|CRT 2278923-2278956 34 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 243884-243917 8 0.765
NZ_LN868939_15 15.52|2278984|34|NZ_LN868939|CRT 2278984-2279017 34 KM083128 Mycobacterium phage Sparky, complete genome 61220-61253 8 0.765
NZ_LN868939_15 15.56|2279228|34|NZ_LN868939|CRT 2279228-2279261 34 NZ_CP023740 Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence 159553-159586 8 0.765
NZ_LN868939_15 15.56|2279228|34|NZ_LN868939|CRT 2279228-2279261 34 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 161723-161756 8 0.765
NZ_LN868939_15 15.56|2279228|34|NZ_LN868939|CRT 2279228-2279261 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 224475-224508 8 0.765
NZ_LN868939_15 15.58|2279350|33|NZ_LN868939|CRT 2279350-2279382 33 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 21839-21871 8 0.758
NZ_LN868939_15 15.58|2279350|33|NZ_LN868939|CRT 2279350-2279382 33 NZ_CP011506 Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence 22267-22299 8 0.758
NZ_LN868939_15 15.59|2279410|36|NZ_LN868939|CRT 2279410-2279445 36 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 667326-667361 8 0.778
NZ_LN868939_16 16.2|2651215|30|NZ_LN868939|CRT 2651215-2651244 30 NC_015170 Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence 28800-28829 8 0.733
NZ_LN868939_16 16.4|2651299|30|NZ_LN868939|CRT 2651299-2651328 30 NC_015170 Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence 28800-28829 8 0.733
NZ_LN868939_16 16.6|2651383|30|NZ_LN868939|CRT 2651383-2651412 30 NC_015170 Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence 28800-28829 8 0.733
NZ_LN868939_5 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449429-1449460 32 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 108064-108095 9 0.719
NZ_LN868939_5 5.3|1449490|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449490-1449521 32 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 263268-263299 9 0.719
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2230876-2230907 9 0.719
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 136266-136297 9 0.719
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 CP054928 Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence 47657-47688 9 0.719
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NZ_CP039426 Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence 17951-17982 9 0.719
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 438025-438056 9 0.719
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 278000-278031 9 0.719
NZ_LN868939_5 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449551-1449582 32 NZ_CP039431 Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence 17951-17982 9 0.719
NZ_LN868939_6 6.1|1456893|31|NZ_LN868939|CRT 1456893-1456923 31 NZ_CP023492 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed2, complete sequence 47392-47422 9 0.71
NZ_LN868939_6 6.1|1456893|31|NZ_LN868939|CRT 1456893-1456923 31 NZ_CP026507 Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed2, complete sequence 29951-29981 9 0.71
NZ_LN868939_6 6.2|1456953|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1456953-1456984 32 NC_015579 Novosphingobium sp. PP1Y plasmid Lpl, complete sequence 123056-123087 9 0.719
NZ_LN868939_6 6.3|1457014|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457014-1457045 32 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 65978-66009 9 0.719
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2161461-2161492 9 0.719
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2747383-2747414 9 0.719
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 MN234161 Gordonia phage Toast, complete genome 17553-17584 9 0.719
NZ_LN868939_6 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457319-1457350 32 NZ_CP021407 Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence 75247-75278 9 0.719
NZ_LN868939_6 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457319-1457350 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1503554-1503585 9 0.719
NZ_LN868939_6 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457319-1457350 32 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 241476-241507 9 0.719
NZ_LN868939_8 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder 1876546-1876575 30 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 971063-971092 9 0.7
NZ_LN868939_8 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder 1876546-1876575 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 56943-56972 9 0.7
NZ_LN868939_10 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder 1970147-1970181 35 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1110661-1110695 9 0.743
NZ_LN868939_10 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder 1970147-1970181 35 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 785000-785034 9 0.743
NZ_LN868939_10 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder 1970147-1970181 35 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1110783-1110817 9 0.743
NZ_LN868939_10 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder 1970147-1970181 35 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 794676-794710 9 0.743
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 246611-246642 9 0.719
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 865925-865956 9 0.719
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 37115-37146 9 0.719
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 JQ067087 Pseudomonas phage PaMx11, complete genome 51311-51342 9 0.719
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 MT664984 Xanthomonas phage Xp12, complete genome 18322-18353 9 0.719
NZ_LN868939_11 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140402-2140433 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 240945-240976 9 0.719
NZ_LN868939_11 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140402-2140433 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1401701-1401732 9 0.719
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 262367-262398 9 0.719
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NC_009660 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD02, complete sequence 932-963 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 501513-501544 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1630878-1630909 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 280292-280323 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 999975-1000006 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP031159 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence 252507-252538 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 481293-481324 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP044475 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-1, complete sequence 100221-100252 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP044446 Acinetobacter indicus strain CMG3-2 plasmid pCMG3-2-1, complete sequence 4665-4696 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP049912 Diaphorobacter sp. HDW4A plasmid p_unnamed2, complete sequence 1165-1196 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP044484 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-1, complete sequence 74170-74201 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1396039-1396070 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP044451 Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-1, complete sequence 43610-43641 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 218909-218940 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP047350 Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence 56778-56809 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP047345 Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence 56776-56807 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP047353 Proteus mirabilis strain ZA25 plasmid pZA25-tetX-168kb, complete sequence 54082-54113 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 436198-436229 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 45064-45095 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 481329-481360 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 CP046596 Acinetobacter indicus strain FS42-2 plasmid pFS42-2-1, complete sequence 130508-130539 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 481328-481359 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP044464 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence 46713-46744 9 0.719
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 481320-481351 9 0.719
NZ_LN868939_11 11.5|2140585|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140585-2140616 32 NC_002112 Streptomyces cyaneus plasmid pSA1.1, complete sequence 8043-8074 9 0.719
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 325437-325468 9 0.719
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 849349-849380 9 0.719
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 55727-55758 9 0.719
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NC_047851 Brevibacterium phage LuckyBarnes, complete genome 949-980 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 MN813684 Microbacterium phage Terij, complete genome 47124-47155 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 622958-622989 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_011991 Agrobacterium vitis S4 plasmid pAtS4b, complete sequence 10046-10077 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 12262-12293 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 MH834618 Arthrobacter phage Lunar, complete genome 28254-28285 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 MN234214 Arthrobacter phage Amelia, complete genome 27595-27626 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 MH834624 Arthrobacter phage Polka, complete genome 27444-27475 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 MH834608 Arthrobacter phage Cote, complete genome 27920-27951 9 0.719
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_047975 Microbacterium phage Squash, complete genome 51955-51986 9 0.719
NZ_LN868939_12 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT 2142745-2142776 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 491946-491977 9 0.719
NZ_LN868939_12 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT 2142745-2142776 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 555455-555486 9 0.719
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 NZ_CP015221 Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence 59144-59175 9 0.719
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 169177-169208 9 0.719
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 185202-185233 9 0.719
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 278670-278701 9 0.719
NZ_LN868939_13 13.1|2153855|32|NZ_LN868939|CRISPRCasFinder,CRT 2153855-2153886 32 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 139376-139407 9 0.719
NZ_LN868939_13 13.1|2153855|32|NZ_LN868939|CRISPRCasFinder,CRT 2153855-2153886 32 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 141222-141253 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 747422-747453 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP021407 Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence 2369-2400 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 79954-79985 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 307574-307605 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 391788-391819 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1581343-1581374 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 686032-686063 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP018865 Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence 28574-28605 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 MT522004 Mycobacterium phage Gail, complete genome 25327-25358 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 KX589269 Mycobacterium phage Fortunato, complete genome 9240-9271 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NC_022063 Mycobacterium phage Phelemich, complete genome 9388-9419 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NC_022331 Mycobacterium phage Bane1, complete genome 9264-9295 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 KF279413 Mycobacterium phage Bane2, complete genome 9243-9274 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 KF024727 Mycobacterium phage Reprobate, complete genome 9385-9416 9 0.719
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 MT310870 Mycobacterium phage RawrgerThat, complete genome 9240-9271 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 206769-206800 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 15513-15544 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MK937601 Gordonia phage Charming, complete genome 40734-40765 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MH976519 Gordonia phage Tangent, complete genome 40746-40777 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MH976510 Gordonia phage Fosterous, complete genome 40195-40226 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MH153809 Gordonia phage Sitar, complete genome 41719-41750 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MH976518 Gordonia phage Stultus, complete genome 40672-40703 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MH479924 Gordonia phage Rofo, complete genome 41155-41186 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MT723934 Gordonia phage Love, complete genome 42167-42198 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MH651166 Gordonia phage Angelicage, complete genome 40824-40855 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MH976506 Gordonia phage Affeca, complete genome 40406-40437 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NC_042045 Gordonia phage Lennon, complete genome 41719-41750 9 0.719
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 MH976512 Gordonia phage Geodirt, complete genome 41614-41645 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 815541-815572 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 226367-226398 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 183924-183955 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP021029 Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence 310842-310873 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 462669-462700 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 462669-462700 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 461110-461141 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 465357-465388 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 459476-459507 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 306156-306187 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 462669-462700 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 306150-306181 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 2096638-2096669 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 136262-136293 9 0.719
NZ_LN868939_13 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT 2154221-2154252 32 CP016641 Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence 35927-35958 9 0.719
NZ_LN868939_14 14.1|2163630|34|NZ_LN868939|PILER-CR 2163630-2163663 34 NZ_CP035418 Leisingera sp. NJS204 plasmid unnamed1, complete sequence 77492-77525 9 0.735
NZ_LN868939_14 14.1|2163630|34|NZ_LN868939|PILER-CR 2163630-2163663 34 NC_015852 Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence 1859-1892 9 0.735
NZ_LN868939_14 14.5|2163874|34|NZ_LN868939|PILER-CR 2163874-2163907 34 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1864636-1864669 9 0.735
NZ_LN868939_14 14.5|2163874|34|NZ_LN868939|PILER-CR 2163874-2163907 34 KX576640 Arthrobacter phage RcigaStruga, complete genome 39678-39711 9 0.735
NZ_LN868939_14 14.5|2163874|34|NZ_LN868939|PILER-CR 2163874-2163907 34 MG210949 Arthrobacter phage Huntingdon, complete genome 39678-39711 9 0.735
NZ_LN868939_14 14.5|2163874|34|NZ_LN868939|PILER-CR 2163874-2163907 34 MK112529 Arthrobacter phage BigMack, complete genome 38375-38408 9 0.735
NZ_LN868939_14 14.6|2163935|34|NZ_LN868939|PILER-CR 2163935-2163968 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2371938-2371971 9 0.735
NZ_LN868939_14 14.8|2164057|34|NZ_LN868939|PILER-CR 2164057-2164090 34 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1034969-1035002 9 0.735
NZ_LN868939_14 14.8|2164057|34|NZ_LN868939|PILER-CR 2164057-2164090 34 NZ_CP024896 Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence 14383-14416 9 0.735
NZ_LN868939_14 14.8|2164057|34|NZ_LN868939|PILER-CR 2164057-2164090 34 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 1250-1283 9 0.735
NZ_LN868939_14 14.8|2164057|34|NZ_LN868939|PILER-CR 2164057-2164090 34 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 407923-407956 9 0.735
NZ_LN868939_14 14.8|2164057|34|NZ_LN868939|PILER-CR 2164057-2164090 34 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 992-1025 9 0.735
NZ_LN868939_14 14.8|2164057|34|NZ_LN868939|PILER-CR 2164057-2164090 34 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 106050-106083 9 0.735
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 240216-240249 9 0.735
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 220341-220374 9 0.735
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1818772-1818805 9 0.735
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 NC_008713 Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence 137449-137482 9 0.735
NZ_LN868939_14 14.12|2164301|34|NZ_LN868939|PILER-CR 2164301-2164334 34 MT939492 Xanthomonas phage Xoo-sp14, complete genome 123049-123082 9 0.735
NZ_LN868939_14 14.14|2164423|34|NZ_LN868939|PILER-CR 2164423-2164456 34 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 847714-847747 9 0.735
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NC_017543 Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence 189646-189677 9 0.719
NZ_LN868939_14 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder 2163632-2163663 32 NZ_KY000038 Agrobacterium rhizogenes strain 1724 plasmid pRi_1724, complete sequence 18196-18227 9 0.719
NZ_LN868939_14 14.19|2163693|32|NZ_LN868939|CRISPRCasFinder 2163693-2163724 32 KU886270 Freshwater phage uvFW-CGR-AMD-COM-C429, complete genome 36370-36401 9 0.719
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 478122-478153 9 0.719
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 901052-901083 9 0.719
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 7400-7431 9 0.719
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NC_018291 Phaeobacter inhibens DSM 17395 plasmid pPGA1_262, complete sequence 52480-52511 9 0.719
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_CP010596 Phaeobacter inhibens strain P10 plasmid pP10_a, complete sequence 53637-53668 9 0.719
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_CP031949 Phaeobacter inhibens strain BS107 plasmid unnamed1, complete sequence 52481-52512 9 0.719
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 621631-621662 9 0.719
NZ_LN868939_14 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder 2163937-2163968 32 NZ_CP010736 Phaeobacter inhibens strain P72 plasmid pP72_a, complete sequence 53653-53684 9 0.719
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 61825-61856 9 0.719
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NC_024972 Micrococcus sp. A1 plasmid pLMA1, complete sequence 99167-99198 9 0.719
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 64025-64056 9 0.719
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 NC_048133 Aeromonas phage ZPAH7, complete genome 9349-9380 9 0.719
NZ_LN868939_14 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder 2164242-2164273 32 MK330684 Aeromonas phage ZPAH7B, complete genome 8594-8625 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 527382-527413 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP010859 Marinovum algicola DG 898 plasmid pMaD4, complete sequence 177590-177621 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 MN270889 Ralstonia phage P-PSG-11, complete genome 31293-31324 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 MN270890 Ralstonia phage P-PSG-11-1, complete genome 31293-31324 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 MN685189 UNVERIFIED: Ralstonia phage vRsoP-WF2 genomic sequence 7311-7342 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 MF979559 Ralstonia phage DU_RP_I, complete genome 5404-5435 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 MN693531 Marine virus AFVG_25M28, complete genome 10739-10770 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 MN685191 UNVERIFIED: Ralstonia phage vRsoP-WR2 genomic sequence 7311-7342 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 MN685190 UNVERIFIED: Ralstonia phage vRsoP-WM2 genomic sequence 7315-7346 9 0.719
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NC_047946 Ralstonia phage RsoP1EGY, complete genome 18414-18445 9 0.719
NZ_LN868939_14 14.31|2164425|32|NZ_LN868939|CRISPRCasFinder 2164425-2164456 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 847716-847747 9 0.719
NZ_LN868939_14 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder 2164486-2164517 32 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 183451-183482 9 0.719
NZ_LN868939_14 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder 2164547-2164578 32 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 49253-49284 9 0.719
NZ_LN868939_14 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder 2164547-2164578 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 182985-183016 9 0.719
NZ_LN868939_14 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder 2164547-2164578 32 NZ_CP016291 Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence 105383-105414 9 0.719
NZ_LN868939_14 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder 2164547-2164578 32 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 35556-35587 9 0.719
NZ_LN868939_14 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder 2164547-2164578 32 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 361334-361365 9 0.719
NZ_LN868939_14 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder 2164547-2164578 32 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 422504-422535 9 0.719
NZ_LN868939_14 14.46|2164302|33|NZ_LN868939|CRT 2164302-2164334 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1818773-1818805 9 0.727
NZ_LN868939_14 14.48|2164424|33|NZ_LN868939|CRT 2164424-2164456 33 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 847715-847747 9 0.727
NZ_LN868939_14 14.49|2164485|33|NZ_LN868939|CRT 2164485-2164517 33 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1148851-1148883 9 0.727
NZ_LN868939_14 14.49|2164485|33|NZ_LN868939|CRT 2164485-2164517 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1963880-1963912 9 0.727
NZ_LN868939_14 14.51|2164607|33|NZ_LN868939|CRT 2164607-2164639 33 MN445183 Salmonella phage vB_SalM_SA002, complete genome 77553-77585 9 0.727
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 MT897910 Mycobacterium phage VioletZ, complete genome 68840-68871 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 MN428050 Mycobacterium phage Apex, complete genome 68791-68822 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_023600 Mycobacterium phage Jolie1, complete genome 68683-68714 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 MN234171 Mycobacterium phage Magpie, complete genome 68449-68480 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 MH513970 Mycobacterium phage Hangman, complete genome 68900-68931 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 MT639648 Mycobacterium phage Heath, complete genome 66670-66701 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_042035 Mycobacterium phage Zemanar, complete sequence 68504-68535 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_008195 Mycobacterium phage Cooper, complete genome 67908-67939 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 67362-67393 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_022061 Mycobacterium phage KayaCho, complete genome 68499-68530 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 KJ433975 Mycobacterium phage 40BC, complete genome 69310-69341 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_011044 Mycobacterium phage Nigel, complete genome 66987-67018 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_022331 Mycobacterium phage Bane1, complete genome 66729-66760 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 KF279413 Mycobacterium phage Bane2, complete genome 66705-66736 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 KJ433973 Mycobacterium phage 39HC, complete genome 69310-69341 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 KF493881 Mycobacterium phage JAMaL, complete genome 68219-68250 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 MT310870 Mycobacterium phage RawrgerThat, complete genome 68231-68262 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 KF279411 Mycobacterium phage Adawi, complete genome 67336-67367 9 0.719
NZ_LN868939_15 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder 2278377-2278408 32 NC_024145 Mycobacterium phage Hosp, complete genome 66614-66645 9 0.719
NZ_LN868939_15 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder 2278499-2278530 32 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 478283-478314 9 0.719
NZ_LN868939_15 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder 2278499-2278530 32 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 465769-465800 9 0.719
NZ_LN868939_15 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder 2278499-2278530 32 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 230463-230494 9 0.719
NZ_LN868939_15 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder 2278499-2278530 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 360088-360119 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 786876-786907 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 208441-208472 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 NC_012849 Ralstonia pickettii 12D plasmid pRp12D02, complete sequence 20568-20599 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 MN871482 UNVERIFIED: Pseudomonas virus PaSz-6, complete genome 45118-45149 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 MN871486 UNVERIFIED: Pseudomonas phage PaSz-9_45_61k, complete genome 28155-28186 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 MN871456 UNVERIFIED: Pseudomonas phage Pa-C, complete genome 42685-42716 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 NC_010116 Pseudomonas phage YuA, complete genome 9556-9587 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 MT118302 Pseudomonas phage Epa38, complete genome 17283-17314 9 0.719
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 KC758116 Pseudomonas phage LKO4, complete genome 10161-10192 9 0.719
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 19313-19344 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NZ_CP013073 Sphingobium indicum B90A plasmid pSRL3, complete sequence 14140-14171 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NC_014005 Sphingobium japonicum UT26S plasmid pUT1, complete sequence 19395-19426 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 158572-158603 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 27372-27403 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NC_020563 Sphingomonas sp. MM-1 plasmid pISP4, complete sequence 3704-3735 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NZ_CP005088 Sphingobium sp. TKS plasmid pTK4, complete sequence 37351-37382 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NZ_CP005090 Sphingobium sp. TKS plasmid pTK6, complete sequence 12908-12939 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NC_020544 Sphingomonas sp. MM-1 plasmid pISP3, complete sequence 2234-2265 9 0.719
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NC_020562 Sphingomonas sp. MM-1 plasmid pISP1, complete sequence 155754-155785 9 0.719
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_CP014597 Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence 76402-76433 9 0.719
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_AP014801 Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351 91772-91803 9 0.719
NZ_LN868939_15 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder 2279228-2279259 32 NZ_CP049702 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2c, complete sequence 139185-139216 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 672570-672601 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NC_008242 Chelativorans sp. BNC1 plasmid 1, complete sequence 246301-246332 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 347368-347399 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_CP033037 Agrobacterium fabrum strain 12D13 plasmid pAt12D13b, complete sequence 95141-95172 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 263611-263642 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 174170-174201 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 198499-198530 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NC_009669 Ochrobactrum anthropi ATCC 49188 plasmid pOANT01, complete sequence 169197-169228 9 0.719
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_LR594664 Variovorax sp. RA8 plasmid 3 124673-124704 9 0.719
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 843977-844007 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP022081 Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence 55722-55752 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP012984 Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416 2558-2588 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP012984 Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416 206728-206758 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP034556 Burkholderia cepacia ATCC 25416 plasmid unnamed1, complete sequence 105738-105768 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 MT889376 Arthrobacter phage Phives, complete genome 22501-22531 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_KF418775 Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence 5006-5036 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP023519 Burkholderia cepacia strain FDAARGOS_388 plasmid unnamed1, complete sequence 65293-65323 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP007745 Burkholderia cepacia ATCC 25416 plasmid unnamed, complete sequence 90250-90280 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 860569-860599 9 0.71
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1030107-1030137 9 0.71
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NC_015952 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence 76107-76140 9 0.735
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 86029-86062 9 0.735
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 307264-307295 9 0.719
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 18696-18727 9 0.719
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP027240 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed2, complete sequence 46975-47006 9 0.719
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP014515 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence 79044-79075 9 0.719
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP025617 Micrococcus luteus strain SGAir0127 plasmid pSGAir0127 14305-14336 9 0.719
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 281315-281346 9 0.719
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP026696 Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence 17591-17622 9 0.719
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 694086-694117 9 0.719
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 JN672684 Enterobacteria phage F20, partial genome 18784-18815 9 0.719
NZ_LN868939_15 15.39|2279349|34|NZ_LN868939|PILER-CR 2279349-2279382 34 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 21838-21871 9 0.735
NZ_LN868939_15 15.39|2279349|34|NZ_LN868939|PILER-CR 2279349-2279382 34 NZ_CP011506 Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence 22267-22300 9 0.735
NZ_LN868939_15 15.39|2279349|34|NZ_LN868939|PILER-CR 2279349-2279382 34 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 843976-844009 9 0.735
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 172760-172790 9 0.71
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 18697-18727 9 0.71
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP027240 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed2, complete sequence 46976-47006 9 0.71
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP025617 Micrococcus luteus strain SGAir0127 plasmid pSGAir0127 14305-14335 9 0.71
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 989900-989930 9 0.71
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 AP013686 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS *** 30463-30493 9 0.71
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 AP013685 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS *** 11730-11760 9 0.71
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 AP013676 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS *** 13857-13887 9 0.71
NZ_LN868939_15 15.52|2278984|34|NZ_LN868939|CRT 2278984-2279017 34 NC_012523 Rhodococcus opacus B4 plasmid pKNR, complete sequence 29336-29369 9 0.735
NZ_LN868939_15 15.53|2279045|34|NZ_LN868939|CRT 2279045-2279078 34 NZ_CP044987 Deinococcus sp. AJ005 plasmid p96k, complete sequence 46984-47017 9 0.735
NZ_LN868939_15 15.56|2279228|34|NZ_LN868939|CRT 2279228-2279261 34 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 229148-229181 9 0.735
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NC_048047 Caulobacter phage CcrBL9, complete genome 225978-226011 9 0.735
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1788918-1788951 9 0.735
NZ_LN868939_15 15.58|2279350|33|NZ_LN868939|CRT 2279350-2279382 33 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 13785-13817 9 0.727
NZ_LN868939_15 15.58|2279350|33|NZ_LN868939|CRT 2279350-2279382 33 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 5542-5574 9 0.727
NZ_LN868939_15 15.58|2279350|33|NZ_LN868939|CRT 2279350-2279382 33 NZ_CP015032 Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence 225805-225837 9 0.727
NZ_LN868939_15 15.58|2279350|33|NZ_LN868939|CRT 2279350-2279382 33 NZ_CP011771 Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence 156240-156272 9 0.727
NZ_LN868939_16 16.7|2651431|30|NZ_LN868939|CRT 2651431-2651460 30 NZ_CP014769 Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence 10541-10570 9 0.7
NZ_LN868939_16 16.8|2651479|30|NZ_LN868939|CRT 2651479-2651508 30 NZ_CP014769 Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence 10541-10570 9 0.7
NZ_LN868939_5 5.5|1449612|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR 1449612-1449643 32 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 34996-35027 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP023451 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence 244843-244874 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP032687 Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence 567165-567196 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_AP018665 Sphingobium amiense strain DSM 16289 plasmid pSAMIE_2, complete sequence 187811-187842 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP032692 Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence 495729-495760 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 196306-196337 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP018821 Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence 30730-30761 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 198447-198478 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 173848-173879 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 181015-181046 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 178734-178765 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 179104-179135 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 191349-191380 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 179104-179135 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 182025-182056 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 179098-179129 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 198447-198478 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 CP021185 Sphingomonas wittichii DC-6 plasmid pDC04, complete sequence 83207-83238 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NC_020061 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence 539036-539067 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 191349-191380 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 178734-178765 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 89523-89554 10 0.688
NZ_LN868939_6 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457197-1457228 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 497870-497901 10 0.688
NZ_LN868939_6 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457441-1457472 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1919380-1919411 10 0.688
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2485758-2485789 10 0.688
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_LR134449 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence 29960-29991 10 0.688
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1515915-1515946 10 0.688
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 59517-59548 10 0.688
NZ_LN868939_11 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140341-2140372 32 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1732778-1732809 10 0.688
NZ_LN868939_11 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140402-2140433 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 77172-77203 10 0.688
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 MK524525 Mycobacterium phage Ringer, complete genome 50257-50288 10 0.688
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 MH371110 Mycobacterium phage Magnar, complete genome 49496-49527 10 0.688
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 AF271693 Mycobacterium virus Bxb1, complete genome 47531-47562 10 0.688
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 MH697581 Mycobacterium phage Crispicous1, complete genome 47039-47070 10 0.688
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NC_028828 Mycobacterium phage TheloniousMonk, complete genome 50832-50863 10 0.688
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 MK310141 Mycobacterium phage Fenn, complete genome 51103-51134 10 0.688
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 MK524523 Mycobacterium phage Naira, complete genome 51235-51266 10 0.688
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NC_002656 Mycobacterium phage Bxb1, complete genome 47531-47562 10 0.688
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 540772-540803 10 0.688
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1386585-1386616 10 0.688
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NC_019202 Pseudomonas aeruginosa plasmid pKLC102, complete sequence 93894-93925 10 0.688
NZ_LN868939_11 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140524-2140555 32 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 175166-175197 10 0.688
NZ_LN868939_12 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT 2142440-2142471 32 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 54693-54724 10 0.688
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP029363 Streptomyces globisporus strain TFH56 plasmid pTFSG2, complete sequence 29834-29865 10 0.688
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_015147 Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence 38014-38045 10 0.688
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1338243-1338274 10 0.688
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_019331 Arthrobacter sp. J3-40 plasmid pJ340-114, complete sequence 48587-48618 10 0.688
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_019332 Arthrobacter sp. J3-53 plasmid pJ353-116, complete sequence 76698-76729 10 0.688
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_007950 Polaromonas sp. JS666 plasmid 2, complete sequence 257334-257365 10 0.688
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 NZ_CP044333 Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence 42707-42738 10 0.688
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP020811 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence 27256-27287 10 0.688
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 81021-81052 10 0.688
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_AP018829 Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence 255865-255896 10 0.688
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 166237-166268 10 0.688
NZ_LN868939_13 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT 2153977-2154008 32 MH744423 Mycobacterium phage Saguaro, complete genome 10095-10126 10 0.688
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 553758-553789 10 0.688
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 315189-315220 10 0.688
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 285299-285330 10 0.688
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 122528-122559 10 0.688
NZ_LN868939_13 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT 2154099-2154130 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 412870-412901 10 0.688
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1376894-1376925 10 0.688
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1777631-1777662 10 0.688
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 842577-842608 10 0.688
NZ_LN868939_13 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT 2154160-2154191 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1289802-1289833 10 0.688
NZ_LN868939_14 14.15|2164484|34|NZ_LN868939|PILER-CR 2164484-2164517 34 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1148851-1148884 10 0.706
NZ_LN868939_14 14.15|2164484|34|NZ_LN868939|PILER-CR 2164484-2164517 34 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1963879-1963912 10 0.706
NZ_LN868939_14 14.17|2164606|34|NZ_LN868939|PILER-CR 2164606-2164639 34 MN445183 Salmonella phage vB_SalM_SA002, complete genome 77552-77585 10 0.706
NZ_LN868939_14 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder 2163815-2163846 32 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 301707-301738 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1602839-1602870 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1403679-1403710 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1355025-1355056 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1602966-1602997 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1354995-1355026 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1099067-1099098 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 743839-743870 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1355032-1355063 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1602526-1602557 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1602468-1602499 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1280933-1280964 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1090072-1090103 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1226983-1227014 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 MK279862 Arthrobacter phage Lennox, complete genome 38200-38231 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NC_041944 Arthrobacter phage Preamble, complete genome 38266-38297 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 MH744421 Arthrobacter phage Moki, complete genome 37976-38007 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1379104-1379135 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 567659-567690 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1319354-1319385 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1506765-1506796 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP044329 Methylocystis rosea strain BRCS1 plasmid unnamed1, complete sequence 73239-73270 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1076427-1076458 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1251809-1251840 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1794202-1794233 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1762321-1762352 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1327997-1328028 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1439688-1439719 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 694718-694749 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1041965-1041996 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1293422-1293453 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1439523-1439554 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1769439-1769470 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1222536-1222567 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1327986-1328017 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1439490-1439521 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1309717-1309748 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1339954-1339985 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1438296-1438327 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1337176-1337207 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1236247-1236278 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1309717-1309748 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1339954-1339985 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1438332-1438363 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1309717-1309748 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1236269-1236300 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1309721-1309752 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1339954-1339985 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1339954-1339985 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1339954-1339985 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1438332-1438363 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 203213-203244 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 716883-716914 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1438321-1438352 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1236269-1236300 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1249901-1249932 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1230564-1230595 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1278242-1278273 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1324679-1324710 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 845206-845237 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1438321-1438352 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1236269-1236300 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1309716-1309747 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1439488-1439519 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1236269-1236300 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1236269-1236300 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1438332-1438363 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1339957-1339988 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 707692-707723 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1438343-1438374 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1438321-1438352 10 0.688
NZ_LN868939_14 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder 2163876-2163907 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 707692-707723 10 0.688
NZ_LN868939_14 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder 2164059-2164090 32 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 317114-317145 10 0.688
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 814045-814076 10 0.688
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 806010-806041 10 0.688
NZ_LN868939_14 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder 2164303-2164334 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 509138-509169 10 0.688
NZ_LN868939_14 14.35|2163631|33|NZ_LN868939|CRT 2163631-2163663 33 NC_017543 Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence 189645-189677 10 0.697
NZ_LN868939_15 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder 2278560-2278591 32 NC_013193 Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence 133061-133092 10 0.688
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 440028-440059 10 0.688
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 439237-439268 10 0.688
NZ_LN868939_15 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder 2278923-2278954 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 243886-243917 10 0.688
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 NZ_CP050072 Klebsiella aerogenes strain 035 plasmid p35_E, complete sequence 2212-2243 10 0.688
NZ_LN868939_15 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder 2278984-2279015 32 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 2521-2552 10 0.688
NZ_LN868939_15 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder 2279289-2279320 32 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 236112-236143 10 0.688
NZ_LN868939_15 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder 2279350-2279380 31 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 108826-108856 10 0.677
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1645552-1645585 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 915335-915368 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1074400-1074433 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 766014-766047 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 785197-785230 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1092346-1092379 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 773937-773970 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1267552-1267585 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 760488-760521 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 762664-762697 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 746845-746878 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1420713-1420746 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 783273-783306 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 993350-993383 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 776992-777025 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 785197-785230 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1336505-1336538 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1082151-1082184 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 746845-746878 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 762664-762697 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 797005-797038 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1005769-1005802 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 907823-907856 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1002469-1002502 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1000632-1000665 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1082140-1082173 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1087823-1087856 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1115462-1115495 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 758935-758968 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1092361-1092394 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 965900-965933 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1087823-1087856 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1115462-1115495 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1087823-1087856 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 965923-965956 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1087827-1087860 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1115462-1115495 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1115462-1115495 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1115462-1115495 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 965923-965956 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1004942-1004975 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 985617-985650 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1033563-1033596 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1079719-1079752 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 965923-965956 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1087822-1087855 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 965923-965956 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 965923-965956 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1115463-1115496 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1637561-1637594 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1420661-1420694 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1026293-1026326 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 839754-839787 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 124655-124688 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 803518-803551 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 129389-129422 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1621780-1621813 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 33937-33970 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 570565-570598 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1166614-1166647 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 84887-84920 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 986894-986927 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1166581-1166614 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1165386-1165419 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1165423-1165456 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1165423-1165456 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 961835-961868 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1165412-1165445 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1069696-1069729 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1165412-1165445 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1093752-1093785 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1166579-1166612 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1165423-1165456 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 948041-948074 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1165434-1165467 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1165412-1165445 10 0.706
NZ_LN868939_15 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder 2279410-2279443 34 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 948041-948074 10 0.706
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 989900-989931 10 0.688
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 AP013686 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS *** 30462-30493 10 0.688
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 AP013685 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS *** 11729-11760 10 0.688
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 AP013676 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS *** 13856-13887 10 0.688
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 HM486077 Tsukamurella phage TPA2, complete sequence 42129-42160 10 0.688
NZ_LN868939_15 15.28|2278681|32|NZ_LN868939|PILER-CR 2278681-2278712 32 NC_015210 Tsukamurella phage TPA2, complete genome 42129-42160 10 0.688
NZ_LN868939_15 15.33|2278983|35|NZ_LN868939|PILER-CR 2278983-2279017 35 NC_012523 Rhodococcus opacus B4 plasmid pKNR, complete sequence 29335-29369 10 0.714
NZ_LN868939_15 15.39|2279349|34|NZ_LN868939|PILER-CR 2279349-2279382 34 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 13784-13817 10 0.706
NZ_LN868939_15 15.39|2279349|34|NZ_LN868939|PILER-CR 2279349-2279382 34 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 5542-5575 10 0.706
NZ_LN868939_15 15.39|2279349|34|NZ_LN868939|PILER-CR 2279349-2279382 34 NZ_CP015032 Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence 225805-225838 10 0.706
NZ_LN868939_15 15.39|2279349|34|NZ_LN868939|PILER-CR 2279349-2279382 34 NZ_CP011771 Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence 156240-156273 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 MT897910 Mycobacterium phage VioletZ, complete genome 68838-68871 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 MN428050 Mycobacterium phage Apex, complete genome 68789-68822 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 NC_023600 Mycobacterium phage Jolie1, complete genome 68681-68714 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 MN234171 Mycobacterium phage Magpie, complete genome 68447-68480 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 MH513970 Mycobacterium phage Hangman, complete genome 68898-68931 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 MT639648 Mycobacterium phage Heath, complete genome 66668-66701 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 68502-68535 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 NC_008195 Mycobacterium phage Cooper, complete genome 67906-67939 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 67360-67393 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 NC_022061 Mycobacterium phage KayaCho, complete genome 68497-68530 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 KJ433975 Mycobacterium phage 40BC, complete genome 69308-69341 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 NC_011044 Mycobacterium phage Nigel, complete genome 66985-67018 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 NC_022331 Mycobacterium phage Bane1, complete genome 66727-66760 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 KF279413 Mycobacterium phage Bane2, complete genome 66703-66736 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 KJ433973 Mycobacterium phage 39HC, complete genome 69308-69341 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 KF493881 Mycobacterium phage JAMaL, complete genome 68217-68250 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 MT310870 Mycobacterium phage RawrgerThat, complete genome 68229-68262 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 KF279411 Mycobacterium phage Adawi, complete genome 67334-67367 10 0.706
NZ_LN868939_15 15.42|2278377|34|NZ_LN868939|CRT 2278377-2278410 34 NC_024145 Mycobacterium phage Hosp, complete genome 66612-66645 10 0.706
NZ_LN868939_15 15.45|2278560|34|NZ_LN868939|CRT 2278560-2278593 34 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 77704-77737 10 0.706
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 HM486077 Tsukamurella phage TPA2, complete sequence 42130-42160 10 0.677
NZ_LN868939_15 15.47|2278682|31|NZ_LN868939|CRT 2278682-2278712 31 NC_015210 Tsukamurella phage TPA2, complete genome 42130-42160 10 0.677
NZ_LN868939_15 15.52|2278984|34|NZ_LN868939|CRT 2278984-2279017 34 MH077578 Mycobacterium phage DillTech15, complete genome 56879-56912 10 0.706
NZ_LN868939_15 15.52|2278984|34|NZ_LN868939|CRT 2278984-2279017 34 MT684586 Mycobacterium phage Gandalph, complete genome 54055-54088 10 0.706
NZ_LN868939_15 15.52|2278984|34|NZ_LN868939|CRT 2278984-2279017 34 MH371120 Mycobacterium phage OlympiaSaint, complete genome 57378-57411 10 0.706
NZ_LN868939_15 15.52|2278984|34|NZ_LN868939|CRT 2278984-2279017 34 KT281795 Mycobacterium phage XFactor, complete genome 54698-54731 10 0.706
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NZ_CP033037 Agrobacterium fabrum strain 12D13 plasmid pAt12D13b, complete sequence 95141-95174 10 0.706
NZ_LN868939_16 16.9|2651527|42|NZ_LN868939|CRT 2651527-2651568 42 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13805-13846 10 0.762
NZ_LN868939_6 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder 1457258-1457289 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 693983-694014 11 0.656
NZ_LN868939_11 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT 2140463-2140494 32 NC_022753 Mycobacterium phage Fredward, complete genome 26475-26506 11 0.656
NZ_LN868939_12 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT 2142562-2142593 32 NC_019338 Arthrobacter sp. J3-37 plasmid pJ337-114, complete sequence 31603-31634 11 0.656
NZ_LN868939_12 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT 2142806-2142837 32 NC_011981 Agrobacterium vitis S4 plasmid pAtS4e, complete sequence 631069-631100 11 0.656
NZ_LN868939_14 14.1|2163630|34|NZ_LN868939|PILER-CR 2163630-2163663 34 NC_017543 Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence 189644-189677 11 0.676
NZ_LN868939_14 14.8|2164057|34|NZ_LN868939|PILER-CR 2164057-2164090 34 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 61825-61858 11 0.676
NZ_LN868939_14 14.39|2163875|33|NZ_LN868939|CRT 2163875-2163907 33 MK279862 Arthrobacter phage Lennox, complete genome 38200-38232 11 0.667
NZ_LN868939_14 14.39|2163875|33|NZ_LN868939|CRT 2163875-2163907 33 NC_041944 Arthrobacter phage Preamble, complete genome 38266-38298 11 0.667
NZ_LN868939_14 14.39|2163875|33|NZ_LN868939|CRT 2163875-2163907 33 MH744421 Arthrobacter phage Moki, complete genome 37976-38008 11 0.667
NZ_LN868939_15 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder 2278682-2278710 29 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 212172-212200 11 0.621
NZ_LN868939_15 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder 2278801-2278832 32 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 201085-201116 11 0.656
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 672568-672601 11 0.676
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NC_008242 Chelativorans sp. BNC1 plasmid 1, complete sequence 246299-246332 11 0.676
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 347366-347399 11 0.676
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 263609-263642 11 0.676
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 174168-174201 11 0.676
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 198497-198530 11 0.676
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NC_009669 Ochrobactrum anthropi ATCC 49188 plasmid pOANT01, complete sequence 169195-169228 11 0.676
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NZ_LR594664 Variovorax sp. RA8 plasmid 3 124673-124706 11 0.676
NZ_LN868939_15 15.58|2279350|33|NZ_LN868939|CRT 2279350-2279382 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 843977-844009 11 0.667
NZ_LN868939_14 14.5|2163874|34|NZ_LN868939|PILER-CR 2163874-2163907 34 MK279862 Arthrobacter phage Lennox, complete genome 38200-38233 12 0.647
NZ_LN868939_14 14.5|2163874|34|NZ_LN868939|PILER-CR 2163874-2163907 34 NC_041944 Arthrobacter phage Preamble, complete genome 38266-38299 12 0.647
NZ_LN868939_14 14.5|2163874|34|NZ_LN868939|PILER-CR 2163874-2163907 34 MH744421 Arthrobacter phage Moki, complete genome 37976-38009 12 0.647
NZ_LN868939_15 15.57|2279289|34|NZ_LN868939|CRT 2279289-2279322 34 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 236110-236143 12 0.647

1. spacer 14.24|2163998|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 0, identity: 1.0

acggtcgcccgagcgatcaacgagctacagaa	CRISPR spacer
acggtcgcccgagcgatcaacgagctacagaa	Protospacer
********************************

2. spacer 14.24|2163998|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acggtcgcccgagcgatcaacgagctacagaa	CRISPR spacer
acggtcgcccgagcgatcaacgagctacagaa	Protospacer
********************************

3. spacer 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 0, identity: 1.0

cagccagcagcgaatgcgttggcggtcagcat	CRISPR spacer
cagccagcagcgaatgcgttggcggtcagcat	Protospacer
********************************

4. spacer 14.41|2163997|33|NZ_LN868939|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 0, identity: 1.0

cacggtcgcccgagcgatcaacgagctacagaa	CRISPR spacer
cacggtcgcccgagcgatcaacgagctacagaa	Protospacer
*********************************

5. spacer 14.41|2163997|33|NZ_LN868939|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cacggtcgcccgagcgatcaacgagctacagaa	CRISPR spacer
cacggtcgcccgagcgatcaacgagctacagaa	Protospacer
*********************************

6. spacer 14.51|2164607|33|NZ_LN868939|CRT matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccagcagcgaatgcgttggcggtcagcat	CRISPR spacer
ccagccagcagcgaatgcgttggcggtcagcat	Protospacer
*********************************

7. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

8. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

9. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

10. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

11. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

12. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

13. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

14. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

15. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

16. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

17. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

18. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

19. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

20. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

21. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

22. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

23. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

24. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

25. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

26. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

27. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
******************************

28. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
******************************

29. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
******************************

30. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
******************************

31. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
******************************

32. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

ggaggaccaggtgtgggcccaggtggaggaccaggtggggga	CRISPR spacer
ggaggaccaggtgtgggcccaggtggaggaccaggtggggga	Protospacer
******************************************

33. spacer 14.7|2163996|34|NZ_LN868939|PILER-CR matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971

ccacggtcgcccgagcgatcaacgagctacagaa	CRISPR spacer
acacggtcgcccgagcgatcaacgagctacagaa	Protospacer
 *********************************

34. spacer 14.7|2163996|34|NZ_LN868939|PILER-CR matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 1, identity: 0.971

ccacggtcgcccgagcgatcaacgagctacagaa	CRISPR spacer
acacggtcgcccgagcgatcaacgagctacagaa	Protospacer
 *********************************

35. spacer 14.17|2164606|34|NZ_LN868939|PILER-CR matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 1, identity: 0.971

cccagccagcagcgaatgcgttggcggtcagcat	CRISPR spacer
accagccagcagcgaatgcgttggcggtcagcat	Protospacer
 *********************************

36. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

37. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

38. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
*************.****************

39. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
*************.****************

40. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

41. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

42. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

43. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
*************.****************

44. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
*************.****************

45. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

46. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

47. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

48. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
*************.****************

49. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggga	Protospacer
*************.****************

50. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
**************************.***

51. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
tggggaccaggtgcgggcccaggtggggga	Protospacer
 *****************************

52. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

53. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

54. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

55. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

56. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

57. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

58. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

59. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
tggggaccaggtgcgggcccaggtggggga	Protospacer
 *****************************

60. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

61. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

62. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

63. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

64. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

65. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

66. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggggga	Protospacer
*************.****************

67. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.976

ggaggaccaggtgtgggcccaggtggaggaccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggaggaccaggtggggga	Protospacer
**.***************************************

68. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
tggggaccaggtgcgggcccaggtggggga	Protospacer
 ************.****************

69. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
ggaggaccaggtgtgggcccaggtggagga	Protospacer
**.***********************.***

70. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga	Protospacer
* *** ************************

71. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
tggggaccaggtgcgggcccaggtggggga	Protospacer
 ************.****************

72. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
ggaggaccaggtgtgggcccaggtggagga	Protospacer
**.***********************.***

73. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga	Protospacer
* *** ************************

74. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
tggggaccaggtgcgggcccaggtggggga	Protospacer
 ************.****************

75. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
ggaggaccaggtgtgggcccaggtggagga	Protospacer
**.***********************.***

76. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga	Protospacer
* *** ************************

77. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggac	Protospacer
****************************. 

78. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

79. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

80. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

81. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggac	Protospacer
****************************. 

82. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

83. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

84. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggagga	Protospacer
*************.************.***

85. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.952

ggaggaccaggtgtgggcccaggtggaggaccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtgggggaccaggtggggga	Protospacer
**.***********************.***************

86. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 3, identity: 0.906

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
gcgacgccgaagaaggctcaggtcacgatgcg	Protospacer
*. * ***************************

87. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 3, identity: 0.906

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
gccacgccgaagaaggcgcaggtcacgatgcg	Protospacer
*.** ************ **************

88. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggac	Protospacer
*************.**************. 

89. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggac	Protospacer
*************.**************. 

90. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggtgcgggcccaggtggggac	Protospacer
*************.**************. 

91. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga	Protospacer
* *** *******.****************

92. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga	Protospacer
* *** *******.****************

93. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.929

ggaggaccaggtgtgggcccaggtggaggaccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggaggaccaggtgtgggc	Protospacer
**.********************************** *** 

94. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

95. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

96. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

97. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

98. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

99. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

100. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

101. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

102. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

103. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

104. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

105. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

106. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

107. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

108. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

109. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

110. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

111. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

112. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

113. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MF141540 (Mycobacterium phage Avocado, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

114. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KR080198 (Mycobacterium phage Cambiare, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
tccacgccgaagaaggcgcaggtcacgatgcg	Protospacer
 .** ************ **************

115. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

116. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

117. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
tccacgccgaagaaggcgcaggtcacgatgcg	Protospacer
 .** ************ **************

118. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

119. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

120. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

121. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

122. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

123. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

124. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

125. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

126. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

127. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

128. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

129. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

130. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

131. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

132. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

133. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

134. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

135. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

136. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

137. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

138. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

139. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

140. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

141. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

142. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

143. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 4, identity: 0.875

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** ************ **************

144. spacer 14.11|2164240|34|NZ_LN868939|PILER-CR matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 4, identity: 0.882

cggcg-agacccacggccgcaccatcggcatcggc	CRISPR spacer
-ggtgccgacccacggcctcaccatcggcatcggc	Protospacer
 **.*  *********** ****************

145. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 4, identity: 0.862

gccaaacccaccaccaccaccg-cggcgac	CRISPR spacer
accaaacccaccacctccaccgtcggcgg-	Protospacer
.************** ****** *****. 

146. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 5, identity: 0.844

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
tcgacgccgaagaaggcgcaggtcacgatgcg	Protospacer
 . * ************ **************

147. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX641266 (Mycobacterium phage Terror, complete genome) position: , mismatch: 5, identity: 0.844

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
tcgacgccgaagaaggcgcaggtcacgatgcg	Protospacer
 . * ************ **************

148. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 5, identity: 0.844

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
tcgacgccgaagaaggcgcaggtcacgatgcg	Protospacer
 . * ************ **************

149. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX641265 (Mycobacterium phage Taheera, complete genome) position: , mismatch: 5, identity: 0.844

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
tcgacgccgaagaaggcgcaggtcacgatgcg	Protospacer
 . * ************ **************

150. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779514 (Mycobacterium phage Paito, complete genome) position: , mismatch: 5, identity: 0.844

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcacaccgaagaaggcgcaggtcacgatgcg	Protospacer
. ** .*********** **************

151. spacer 6.9|1457380|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.844

cgcagggtgttcgtgaacagcgtgtgcgacct	CRISPR spacer
cggcgcgtgttcgtgaacagcatgtccgacct	Protospacer
**  * ***************.*** ******

152. spacer 6.9|1457380|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.844

cgcagggtgttcgtgaacagcgtgtgcgacct	CRISPR spacer
cggcgcgtgttcgtgaacagcatgtccgacct	Protospacer
**  * ***************.*** ******

153. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.844

--ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ccggc--gacgaagcgggcgatggccgccgccag	Protospacer
  ***  *.************** ****** ***

154. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.844

--ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ctggc--gacgaagcgggcgatggccgccgccag	Protospacer
  ***  *.************** ****** ***

155. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.844

--ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ctggc--gacgaagcgggcgatggccgccgccag	Protospacer
  ***  *.************** ****** ***

156. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.844

--ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ctggc--gacgaagcgggcgatggccgccgccag	Protospacer
  ***  *.************** ****** ***

157. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.844

--ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ccggc--gacgaagcgggcgatggccgccgccag	Protospacer
  ***  *.************** ****** ***

158. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

159. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

160. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

161. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

162. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

163. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

164. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

165. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

166. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

167. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

168. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

169. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

170. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

171. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

172. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

173. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

174. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

175. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

176. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

177. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

178. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

179. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

180. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

181. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

182. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

183. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

184. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

185. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

186. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

187. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

188. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

189. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

190. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

191. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

192. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

193. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

194. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

195. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

196. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

197. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

198. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

199. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

200. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

201. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

202. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

203. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

204. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

205. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

206. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

207. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

208. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

209. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

210. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

211. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

212. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

213. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

214. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

215. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

216. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt	Protospacer
*   ********** ************ **** 

217. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

-gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cgggcgc-agacggaggccgcggtgcggtgggt	Protospacer
 ****** ****** *** ************  

218. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 5, identity: 0.844

gacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
gatcagaccctgcagcgcatcgtcatcgcctg	Protospacer
**.  ************ ***** ********

219. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.844

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tgccgacccacggcctcaccatcggcatcggc	Protospacer
    *********** ****************

220. spacer 14.45|2164241|33|NZ_LN868939|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.848

ggcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
gtgccgacccacggcctcaccatcggcatcggc	Protospacer
*    *********** ****************

221. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 5, identity: 0.828

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
gcccggcccaccaccacgaccgcggcgcc	Protospacer
*** ..*********** ********* *

222. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.828

gccaaacccaccaccaccaccgcggcgac-	CRISPR spacer
cccatacccaccaccagcaccgc-gcaacg	Protospacer
 *** *********** ****** **.** 

223. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 5, identity: 0.828

--gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
cggcc--gcccaccgccaccaccgcggcggc	Protospacer
  ***  .******.**************.*

224. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.853

ccggtaccgccgccgccacc-cccccgcccccgcc	CRISPR spacer
ccgctaccgccgccgccacctccctcgccaccgt-	Protospacer
*** **************** ***.**** ***. 

225. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.853

ccggtaccgccgccgccacc-cccccgcccccgcc	CRISPR spacer
ccgctaccgccgccgccacctccctcgccaccgt-	Protospacer
*** **************** ***.**** ***. 

226. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.853

ccggtaccgccgccgccacc-cccccgcccccgcc	CRISPR spacer
ccgctaccgccgccgccacctccctcgccaccgt-	Protospacer
*** **************** ***.**** ***. 

227. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 5, identity: 0.844

cgccaaacccaccaccaccaccgcgg-cgacgc	CRISPR spacer
cgccacacccaccgccaccaccgcgaccgatg-	Protospacer
***** *******.***********. ***.* 

228. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 5, identity: 0.839

gccaaacccaccaccaccaccgcgg-cgacgc	CRISPR spacer
gccacacccaccgccaccaccgcgaccgatg-	Protospacer
**** *******.***********. ***.* 

229. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.839

gccaaacccaccaccaccaccgcggcgacgc-	CRISPR spacer
cccatacccaccaccagcaccgc-gcaacgcg	Protospacer
 *** *********** ****** **.**** 

230. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gcaggcccaggtgtgggcccaggtgtgggc	Protospacer
* .** ******************* *** 

231. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gcaggcccaggtgtgggcccaggtgtgggc	Protospacer
* .** ******************* *** 

232. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gcaggcccaggtgtgggcccaggtgtgggc	Protospacer
* .** ******************* *** 

233. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 6, identity: 0.812

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcaccccgaagaagacgcaggtcacgatgcg	Protospacer
. **  *********.* **************

234. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KJ410133 (Mycobacterium phage Jolie2, complete genome) position: , mismatch: 6, identity: 0.812

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcactccgaagaagacgcaggtcacgatgcg	Protospacer
. **  *********.* **************

235. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 6, identity: 0.812

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
agcaccccgaagaagacgcaggtcacgatgcg	Protospacer
. **  *********.* **************

236. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KR053197 (Gordonia phage GRU3, complete genome) position: , mismatch: 6, identity: 0.812

-gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
tctgctggt-gtcgcggcggggtccggcggcgg	Protospacer
   *****. *******.*********** ***

237. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 6, identity: 0.812

gtcga-gggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
-tcgatgacggtgcgggtgccggcggcggcgcg	Protospacer
 **** *. ************ ****** *** 

238. spacer 6.11|1457502|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.812

agcaatgttttcacgaccttcgagcaccgcct	CRISPR spacer
cacgatgttttctcggccttcgagcaccgccg	Protospacer
 .*.******** **.*************** 

239. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.8

acggaggccgccccggtcgggcgcaaatgg	CRISPR spacer
ccggaggccgccccggccgggcgcgagatg	Protospacer
 ***************.*******.*.  *

240. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.8

acggaggccgccccggtcgggcgcaaatgg	CRISPR spacer
tcggacgccgccccggtcggtcgcgcattg	Protospacer
 **** ************** ***. ** *

241. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019313 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-1, complete sequence) position: , mismatch: 6, identity: 0.812

---ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
gatccgc---gccgtcgccgaggccgaaggactcg	Protospacer
   ****   *** ***************** ** 

242. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cggcgctcccttcgccgaggccgaagggctcc	Protospacer
* ***   *******************. ***

243. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcgaagccttcgccgaggc--cgaaggaatcc	CRISPR spacer
ccgcgaggccttggccgaggccgcgcaggaac--	Protospacer
******.***** ********  ** *****.  

244. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cgatggtggcgatcctcgtcgccctgaccggc	Protospacer
.***   *********** ****** ******

245. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 6, identity: 0.812

---tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
acctgat---ggcgatcctcgacgcccaccccgcc	Protospacer
   ****   ***************** * *** *

246. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 6, identity: 0.812

-gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
ctggaagcc-atcgtcgccggccgcttcacgct	Protospacer
  .*****. **********.** *********

247. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 6, identity: 0.812

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
ccgggggagacggtggtgccggtgcggtggcg	Protospacer
  * * **********.* *************

248. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 6, identity: 0.812

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
acgggcgaggcggtggcggcggtgcgg-ggcat	Protospacer
. * *****.***************** ***. 

249. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gggcgcgagacggtggcggcggtgcggtggcg-	CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcat	Protospacer
*   ********** ************ ***. 

250. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.812

---gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gccgggc---agacggtgtcgccggtgcggtggag	Protospacer
   ****   ******** ** *********** *

251. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP037914 (Sphingomonas sp. AAP5 plasmid p213, complete sequence) position: , mismatch: 6, identity: 0.812

gggcgcgagacggtggcggcggtg-cggtggcg	CRISPR spacer
aggcgcgagagagtggcggcggtgtcggcggt-	Protospacer
.********* .************ ***.**. 

252. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

gggcgcgagacggtggcggcggt----gcggtggcg	CRISPR spacer
ggtcccgagacggtggcggcggtcgaggcggt----	Protospacer
** * ******************    *****    

253. spacer 14.6|2163935|34|NZ_LN868939|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.824

--ccagcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
ggccag--cagctcggcgaccacccgaccaggggcg	Protospacer
  ****  **** *.***************** * *

254. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812

cgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
cggcgggtgctggagcgggtgatgaagagccg	Protospacer
**  .*.*********** ********* ***

255. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.812

ggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
ggcggcatcatcggcaccgtcacca---aggtcgg	Protospacer
**********.* ************   ** *   

256. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

ggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
ggcggcatcatcggcaccgtcacca---aggtggg	Protospacer
**********.* ************   ** *   

257. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

ggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
ggcggcatcatcggcaccgtcacca---aggtcgg	Protospacer
**********.* ************   ** *   

258. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.812

ggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
ggcggcatcatcggcaccgtcacca---aggtggg	Protospacer
**********.* ************   ** *   

259. spacer 14.38|2163814|33|NZ_LN868939|CRT matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 6, identity: 0.818

cgacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
ggatcagaccctgcagcgcatcgtcatcgcctg	Protospacer
 **.  ************ ***** ********

260. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818

cagcc--cagcgcagcgaccacccgaccaggtggg	CRISPR spacer
--gccagcagctcggcgaccacccgaccaggggcg	Protospacer
  ***  **** *.***************** * *

261. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.818

cggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
cggcggcatcatcggcaccgtcacca---aggtcgg	Protospacer
***********.* ************   ** *   

262. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818

cggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
cggcggcatcatcggcaccgtcacca---aggtggg	Protospacer
***********.* ************   ** *   

263. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818

cggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
cggcggcatcatcggcaccgtcacca---aggtcgg	Protospacer
***********.* ************   ** *   

264. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.818

cggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
cggcggcatcatcggcaccgtcacca---aggtggg	Protospacer
***********.* ************   ** *   

265. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to KX452697 (UNVERIFIED: Serratia phage KPN4 genomic sequence) position: , mismatch: 6, identity: 0.812

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
gtgccaaggctggtgttgatcgtgctgatctg	Protospacer
*.* . *************** .*********

266. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to JX878496 (Serratia phage phiMAM1, complete genome) position: , mismatch: 6, identity: 0.812

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
gtgccaaggctggtgttgatcgtgctgatctg	Protospacer
*.* . *************** .*********

267. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
cccggcggcaccaccaccaccgcggcgac	Protospacer
 **..   *********************

268. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agtgaacccaccaccaccaccgaggcggc	Protospacer
. ..****************** ****.*

269. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agcgacaccaccaccaccacggcggcgac	Protospacer
. *.*  ************* ********

270. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agcgacaccaccaccaccacggcggcgac	Protospacer
. *.*  ************* ********

271. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agcgacaccaccaccaccacggcggcgac	Protospacer
. *.*  ************* ********

272. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agcgacaccaccaccaccacggcggcgac	Protospacer
. *.*  ************* ********

273. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
gccacacccaccgccaccaccgcgaccga	Protospacer
**** *******.***********.* . 

274. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agcgacaccaccaccaccacggcggcgac	Protospacer
. *.*  ************* ********

275. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agcgacaccaccaccaccacggcggcgac	Protospacer
. *.*  ************* ********

276. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agcgacaccaccaccaccacggcggcgac	Protospacer
. *.*  ************* ********

277. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
agcgacaccaccaccaccacggcggcgac	Protospacer
. *.*  ************* ********

278. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to MN694695 (Marine virus AFVG_250M866, complete genome) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
accaaaaccaccaccaccaccgccaccag	Protospacer
.***** **************** .* * 

279. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.793

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
ccaaaacgcaccagcaccaccgcggcaat	Protospacer
 * **** ***** ************.*.

280. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NC_048021 (Gordonia phage Daredevil, complete genome) position: , mismatch: 6, identity: 0.812

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
gtggtgtcgattccacgggcatcggcgtaggc	Protospacer
 .*. *********.*****.***********

281. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 6, identity: 0.812

ccgaggtcgattccgcgggcgtcggcgtaggc-	CRISPR spacer
ccgaggtcgaagccgcgggcgtc-gcgcagcgg	Protospacer
**********  *********** ***.**   

282. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

-tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
gtcaccgg-atgcccgagaagctggccgatgcg	Protospacer
 **.**.* .****** **** ***********

283. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.812

-tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
gtcaccgg-atgcccgagaagctggccgatgcg	Protospacer
 **.**.* .****** **** ***********

284. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

-tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
gtcaccgg-atgcccgagaagctggccgatgcg	Protospacer
 **.**.* .****** **** ***********

285. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.812

gacgtc-gagaaggcgcaggcccaggtcaactt	CRISPR spacer
-gcgccggagaacgcgcaggcccaggccaacct	Protospacer
 .**.* ***** *************.****.*

286. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.806

-gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
ggcgcgc-ggcgccgccgtcgttggtgaagat	Protospacer
 *** .* **************.** ***** 

287. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.824

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
ccaggcccgccgccgccagcaccccgcccccgac	Protospacer
**.*  ************ * *********** *

288. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

--cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gacgcc--accgcccaccaccaccgcggcgagga	Protospacer
  ****  ***  ****************** * 

289. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 6, identity: 0.812

cgccaaacccaccaccaccaccgcggcgacgc-	CRISPR spacer
gcccatacccaccaccagcaccgc-gcaacgcg	Protospacer
  *** *********** ****** **.**** 

290. spacer 15.45|2278560|34|NZ_LN868939|CRT matches to KX452697 (UNVERIFIED: Serratia phage KPN4 genomic sequence) position: , mismatch: 6, identity: 0.824

gcggtcaggctggtgttgatctcgctgatctggc	CRISPR spacer
gtgccaaggctggtgttgatcgtgctgatctggc	Protospacer
*.* . *************** .***********

291. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 6, identity: 0.806

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cccggcggcaccaccaccaccgcggcgacgc	Protospacer
 **..   ***********************

292. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 6, identity: 0.806

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cccagggcctccagcaccaccgcggcgacgc	Protospacer
 ***.. ** *** *****************

293. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.806

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gcccggcccaccaccacgaccgcggcgccgg	Protospacer
*** ..*********** ********* ** 

294. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 6, identity: 0.806

--gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cggcc--gcccaccgccaccaccgcggcggcga	Protospacer
  ***  .******.**************.** 

295. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 6, identity: 0.806

---gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
ggggcca---ccaccgcgaccaccgcggcgacga	Protospacer
   ****   *****.* *************** 

296. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 6, identity: 0.806

--gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
ctgccga--ccaccaccaccacgggggcgacga	Protospacer
  ***.*  ************* * ******* 

297. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 6, identity: 0.806

---gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
ggggcca---ccaccgcgaccaccgcggcgacga	Protospacer
   ****   *****.* *************** 

298. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AF311651 (Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds) position: , mismatch: 6, identity: 0.806

gccaaacccaccaccaccaccgcggcgacgc-	CRISPR spacer
gccaagcccaccgccaccaccgcctc-ccgct	Protospacer
*****.******.**********  *  *** 

299. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gcaggcccaggtgcgggcccaggtgcaggc	Protospacer
* .** ******************* .** 

300. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.8

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
ggtggaccaggtgctggcccaggcgatggc	Protospacer
** *********** ********.*. ** 

301. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gcgcgcccaggtgcgggcgcgggtgggggc	Protospacer
* * * ************ *.******** 

302. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 6, identity: 0.8

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gcgcgcccaggtgcgggcgcgggtgggggc	Protospacer
* * * ************ *.******** 

303. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gcaggcccaggtgcgggcccaggtgcaggc	Protospacer
* .** ******************* .** 

304. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.8

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
ggtggaccaggtgctggcccaggcgatggc	Protospacer
** *********** ********.*. ** 

305. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gcgcgcccaggtgcgggcgcgggtgggggc	Protospacer
* * * ************ *.******** 

306. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 6, identity: 0.8

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
gcgcgcccaggtgcgggcgcgggtgggggc	Protospacer
* * * ************ *.******** 

307. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 7, identity: 0.781

gggct---ggcggtcgcggtggggtccggcgccgg	CRISPR spacer
---ctcgaggcggtcgaggtggggttcggcgcctc	Protospacer
   **   ******** ********.*******  

308. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031752 (Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence) position: , mismatch: 7, identity: 0.781

gggct---ggcggtcgcggtggggtccggcgccgg	CRISPR spacer
---ctcgaggcggtcgaggtggggttcggcgcctc	Protospacer
   **   ******** ********.*******  

309. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.774

tgctcgaaggagacgacaaagccgcaatccg	CRISPR spacer
gtctcgacggcgacgacaaagccgcagatcg	Protospacer
  ***** ** ***************. .**

310. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.774

tgctcgaaggagacgacaaagccgcaatccg--	CRISPR spacer
cagtcggaggagatgacaaagccgca--ccggc	Protospacer
.. ***.******.************  ***  

311. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.774

tgctcgaaggagacgacaaagccgcaatccg--	CRISPR spacer
cagtcggaggagatgacaaagccgca--ccggc	Protospacer
.. ***.******.************  ***  

312. spacer 6.3|1457014|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF621618 (Aeromonas salmonicida subsp. salmonicida strain HER1084 plasmid pAsaXII, complete sequence) position: , mismatch: 7, identity: 0.781

ttgaggctggagcgggaactccggcctcaagg	CRISPR spacer
ctgagcctggagcgggaactgcggcgtggtgg	Protospacer
.**** ************** **** * . **

313. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
ccgaccacactgctcgacggccttctgagcgg	Protospacer
 * . ***.************.******** *

314. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
ccgaccacactgctcgacggccttctgagcgg	Protospacer
 * . ***.************.******** *

315. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
ccgaccacactgctcgacggccttctgagcgg	Protospacer
 * . ***.************.******** *

316. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

317. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

318. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

319. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

320. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

321. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

322. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

323. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

324. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

325. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 7, identity: 0.781

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg	Protospacer
 **************** *** ** .*  ***

326. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
ctgaccggggtgccggtccccgcggcgccgcc	Protospacer
 * .  ******* *** **************

327. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
acggtgagggtgcgggtgcccgccgccccgcc	Protospacer
.. * *.**************** ** *****

328. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MT074151 (Bacteroides phage SJC13, complete genome) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
ggtgagggggtgcgggttcccgtggcgcatgc	Protospacer
* .************** ****.*****   *

329. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MT074159 (Bacteroides phage SJC23, complete genome) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
ggtgagggggtgcgggttcccgtggcgcatgc	Protospacer
* .************** ****.*****   *

330. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
gcccagggggtgcgggtgccggcggggcggtg	Protospacer
*.* **************** **** ** *. 

331. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_HG917973 (Mycobacterium marinum E11 plasmid pRAW, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
gacctgcggctgcgggggcccgcggcgccgca	Protospacer
* *  * ** ****** ************** 

332. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018497 (Mycobacterium marinum strain ATCC 927 plasmid pMMRN, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
gacctgcggctgcgggggcccgcggcgccgca	Protospacer
* *  * ** ****** ************** 

333. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013255 (Kocuria flava strain HO-9041 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggc--gccgcc	CRISPR spacer
ctggagggcctgcgggtgcccgcggccaaccg--	Protospacer
 * *****  ****************  .***  

334. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
attgcggtggtgcgggtgcgcgcggcgcaccc	Protospacer
.*.* ** *********** ********  **

335. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_006824 (Aromatoleum aromaticum EbN1 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

gtcgagggggtgcgggtgcccgcgg-cgccgcc	CRISPR spacer
ggcgacggggtgcgggtggccgcggtcggtga-	Protospacer
* *** ************ ****** ** .*  

336. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.781

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcgaagccatcgccgaggccgacgtggtgg	Protospacer
********** ************* * ..*  

337. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.781

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcgaagccatcgccgaggccgacgtggtgg	Protospacer
********** ************* * ..*  

338. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcgaagccatcgccgaggcggaccgcaccg	Protospacer
********** ********** **  * *.* 

339. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcgaagcccgcgccgaggccgatgaacacg	Protospacer
**********. ************ *.*  * 

340. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046321 (Gordonia bronchialis strain FDAARGOS_676 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
cgcgtcacccccgccgacgtcgacgccgcacg	Protospacer
* *.* ******.**** ***********..*

341. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_013442 (Gordonia bronchialis DSM 43247 plasmid pGBRO01, complete sequence) position: , mismatch: 7, identity: 0.781

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
cgcgtcacccccgccgacgtcgacgccgcacg	Protospacer
* *.* ******.**** ***********..*

342. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
gtcgcggccaagcgggcgatgcgcgccgccgg	Protospacer
* *. *** ************* ***** *.*

343. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagggcgaagcgggcgatgcccgccgacag-	CRISPR spacer
tgcaggacgaagcggtcgatgccc-tcgacgtc	Protospacer
 *****.******** ******** .****.  

344. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
gtcgcggccaagcgggcgatgcgcgccgccgg	Protospacer
* *. *** ************* ***** *.*

345. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagggcgaagcgggcgatgcccgccgacag-	CRISPR spacer
tgcaggacgaagcggtcgatgccc-tcgacgtc	Protospacer
 *****.******** ******** .****.  

346. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
gtcgcggccaagcgggcgatgcgcgccgccgg	Protospacer
* *. *** ************* ***** *.*

347. spacer 11.5|2140585|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.781

-tacgagagcaaggggatcggcctggtcctcat	CRISPR spacer
atgccag-gcgaggggatcggccgggtcctcga	Protospacer
 *.* ** **.************ *******. 

348. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 7, identity: 0.781

gagccgctgctgaccgaggagcacctggccgg	CRISPR spacer
gtgccggtgcttaccgaggagcaccccgtcgt	Protospacer
* **** **** *************. *.** 

349. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_031265 (Gordonia phage Guacamole, complete genome) position: , mismatch: 7, identity: 0.781

gagccgct----gctgaccgaggagcacctggccgg	CRISPR spacer
----cgcttccggctgaccgacgaggacctggccgc	Protospacer
    ****    ********* *** ********* 

350. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK967389 (Gordonia phage JasperJr, complete genome) position: , mismatch: 7, identity: 0.781

gagccgct----gctgaccgaggagcacctggccgg	CRISPR spacer
----cgcttccggctgaccgacgaggacctggccgc	Protospacer
    ****    ********* *** ********* 

351. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT723936 (Gordonia phage Hitter, complete genome) position: , mismatch: 7, identity: 0.781

gagccgct----gctgaccgaggagcacctggccgg	CRISPR spacer
----cgcttccggctgaccgacgaggacctggccgc	Protospacer
    ****    ********* *** ********* 

352. spacer 12.2|2142501|32|NZ_LN868939|CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.781

tcttcga--cctcccgatcaaaagccctccacca	CRISPR spacer
--ctcgacgcctgccgatcaaaagccctcaacgc	Protospacer
  .****  *** **************** **  

353. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
ccgaccgggcgaccctggacgccctcaccgcc	Protospacer
. . ********.*** ************* *

354. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 7, identity: 0.781

---tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
ccaagacc---gcgatcctcgccgccctgaccggc	Protospacer
    **.*   ********** ****** ******

355. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tgatccgggagatcctcgccgccggccccacc	Protospacer
********* ******** ****  * **. *

356. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tgagccgggcgatcctggacgccgttcccaac	Protospacer
*** ************ ****** *. **..*

357. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.781

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tgatccgggcggccctcgacgccggtgcccgc	Protospacer
***********..**********  ..** **

358. spacer 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 7, identity: 0.781

cggccacggcgtcgcgtgtggaccggcggctc	CRISPR spacer
cgattatggcgtcgcgggtggacgggcggcgc	Protospacer
**...*.********* ****** ****** *

359. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT701591 (Burkholderia phage Mana, complete genome) position: , mismatch: 7, identity: 0.781

gagaagctgatcgtcgccgacctcttc-acgct	CRISPR spacer
ggcgcgctgatcggcggcgacctcttcaacgc-	Protospacer
*. . ******** ** ********** **** 

360. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KP966108 (Burkholderia phage vB_BceM_AP3, complete genome) position: , mismatch: 7, identity: 0.781

gagaagctgatcgtcgccgacctcttc-acgct	CRISPR spacer
ggcgcgctgatcggcggcgacctcttcaacgc-	Protospacer
*. . ******** ** ********** **** 

361. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN234192 (Streptomyces phage Animus, complete genome) position: , mismatch: 7, identity: 0.781

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
aacgccaacgccacgctcggcgcgacgtacat	Protospacer
..*** ******.************* . ***

362. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MF766047 (Streptomyces phage SqueakyClean, complete genome) position: , mismatch: 7, identity: 0.781

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
aacgccaacgccacgctcggcgcgacgtacat	Protospacer
..*** ******.************* . ***

363. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcgcgaacgccgcgctcggcgcg-actctcat	CRISPR spacer
tgcgcgaacgccgcggtcggcccgtggtctcg-	Protospacer
 ************** ***** ** . ****. 

364. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

ggcgcgaacgccgcgctcggcgcga-ctctcat	CRISPR spacer
accgcgagcaccgcgctcggcgcgagcccgca-	Protospacer
. *****.*.*************** *.* ** 

365. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH513974 (Gordonia phage LastResort, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

366. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KX557283 (Gordonia phage Remus, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

367. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MF668282 (Gordonia phage ShayRa, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

368. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KX557280 (Gordonia phage JSwag, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

369. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_030698 (Gordonia phage Soups, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

370. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KU998251 (Gordonia phage KatherineG, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

371. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_042123 (Gordonia phage Waits, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

372. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN284898 (Gordonia phage MinecraftSteve, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

373. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_041886 (Gordonia phage Strosahl, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

374. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_030694 (Gordonia phage Rosalind, complete genome) position: , mismatch: 7, identity: 0.781

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt	Protospacer
* *** ************.*******. . **

375. spacer 14.4|2163813|34|NZ_LN868939|PILER-CR matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 7, identity: 0.794

ccgacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
tggatcagaccctgcagcgcatcgtcatcgcctg	Protospacer
. **.  ************ ***** ********

376. spacer 14.9|2164118|34|NZ_LN868939|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794

ccgcaggcgcgagcgcagctcgcgaacgacggcg-	CRISPR spacer
ccacaggcgcgcgcgcagctcgcgcgcg-tagcgt	Protospacer
**.******** ************ .** ..*** 

377. spacer 14.11|2164240|34|NZ_LN868939|PILER-CR matches to NC_010604 (Mycobacterium marinum M plasmid pMM23, complete sequence) position: , mismatch: 7, identity: 0.794

---cggcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
atacgacgaa---cacggccgcatcatcggcagcggc	Protospacer
   **.***.   **********.******** ****

378. spacer 14.11|2164240|34|NZ_LN868939|PILER-CR matches to NZ_CP034180 (Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence) position: , mismatch: 7, identity: 0.794

---cggcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
atacgacgaa---cacggccgcatcatcggcagcggc	Protospacer
   **.***.   **********.******** ****

379. spacer 14.11|2164240|34|NZ_LN868939|PILER-CR matches to NC_010394 (Mycobacterium abscessus plasmid, complete sequence) position: , mismatch: 7, identity: 0.794

---cggcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
atacgacgaa---cacggccgcatcatcggcagcggc	Protospacer
   **.***.   **********.******** ****

380. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.794

ccggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
gcggcggcatcatcggcaccgtcacca---aggtggg	Protospacer
 ***********.* ************   ** *   

381. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.794

ccggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
gcggcggcatcatcggcaccgtcacca---aggtcgg	Protospacer
 ***********.* ************   ** *   

382. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794

ccggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
gcggcggcatcatcggcaccgtcacca---aggtggg	Protospacer
 ***********.* ************   ** *   

383. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794

ccggcggcatcacccgcaccgtcaccatccagct---	CRISPR spacer
gcggcggcatcatcggcaccgtcacca---aggtcgg	Protospacer
 ***********.* ************   ** *   

384. spacer 14.14|2164423|34|NZ_LN868939|PILER-CR matches to MT936332 (Streptomyces phage phiRKBJ001, complete genome) position: , mismatch: 7, identity: 0.794

ccccgatgaccgccatcccgccac---ccaagcggac	CRISPR spacer
cctcgatggccgccatcccgccacggttccagcg---	Protospacer
**.*****.***************   .* ****   

385. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 7, identity: 0.781

----cgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
gcctcgcg----cctggaccgcctgatgaagacccg	Protospacer
    ****     ***** ** **************

386. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.781

gacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
gacacgaccctgcagcgcaccgtgcggacatg	Protospacer
***************** *.****   .* **

387. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.781

gacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
gacacgaccctgcagcgcaccgtgcggacatg	Protospacer
***************** *.****   .* **

388. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 7, identity: 0.781

gacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
gacacgaccctgcagcgcaccgtgcggacatg	Protospacer
***************** *.****   .* **

389. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to KX576640 (Arthrobacter phage RcigaStruga, complete genome) position: , mismatch: 7, identity: 0.781

cagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
gagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
 ************.**.********  * **. 

390. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MG210949 (Arthrobacter phage Huntingdon, complete genome) position: , mismatch: 7, identity: 0.781

cagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
gagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
 ************.**.********  * **. 

391. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MK112529 (Arthrobacter phage BigMack, complete genome) position: , mismatch: 7, identity: 0.781

cagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
gagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
 ************.**.********  * **. 

392. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MH179474 (Aeromonas phage 62AhydR11PP, complete genome) position: , mismatch: 7, identity: 0.781

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
caagccccgctcattaccggcgaggaacagta	Protospacer
**. * ******** *.************ .*

393. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
cgcccagcgcagcgaccaggcgaccagcggca	Protospacer
 *****************  *******  * .

394. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 7, identity: 0.781

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
agcccggcgccgcgaccacccgacgtgcagcg	Protospacer
*****.**** *************  *  * *

395. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 7, identity: 0.781

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
agcccggcgccgcgaccacccgacgtgcagcg	Protospacer
*****.**** *************  *  * *

396. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.781

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
ggcttcgaccgggccgacatgatcgccgtcca	Protospacer
* ******** ***********.*****. . 

397. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 7, identity: 0.781

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gtcttcgacccggccgacgagaccgccgtcgt	Protospacer
*.****************. ********.  .

398. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
ccgttcaacccggccggcatgaccgccgtccc	Protospacer
 * ***.*********.***********. .*

399. spacer 14.27|2164181|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcgtgcgggaaaaggtgcaggccgtggta	CRISPR spacer
ccgaactgctgcaaaaggtgcaggccgtgctg	Protospacer
***.  *** * ***************** *.

400. spacer 14.27|2164181|32|NZ_LN868939|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcgtgcgggaaaaggtgcaggccgtggta	CRISPR spacer
ccgaactgctgcaaaaggtgcaggccgtgctg	Protospacer
***.  *** * ***************** *.

401. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_010604 (Mycobacterium marinum M plasmid pMM23, complete sequence) position: , mismatch: 7, identity: 0.781

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
acgacgaacacggccgcatcatcggcagcggc	Protospacer
.*** .  **********.******** ****

402. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP034180 (Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence) position: , mismatch: 7, identity: 0.781

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
acgacgaacacggccgcatcatcggcagcggc	Protospacer
.*** .  **********.******** ****

403. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_010394 (Mycobacterium abscessus plasmid, complete sequence) position: , mismatch: 7, identity: 0.781

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
acgacgaacacggccgcatcatcggcagcggc	Protospacer
.*** .  **********.******** ****

404. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.781

gcgagacc---cacggccgcaccatcggcatcggc	CRISPR spacer
---aggcccagcatggccgcagcatcggcatcggt	Protospacer
   **.**   **.******* ************.

405. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 7, identity: 0.781

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ggcggtaacacccgcaccgtcaccacgccgta	Protospacer
*****.* *****************. * *. 

406. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ggcggcaacacacgcaccgtcaccacgccgta	Protospacer
******* *** *************. * *. 

407. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 7, identity: 0.781

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ggcggcatcatccgcaccatcaccgtgacgcg	Protospacer
**********.*******.*****.*   ** 

408. spacer 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 7, identity: 0.781

cagccagcagcgaatgcgttggcggtcagcat-	CRISPR spacer
tcacccgcagcgaatgcgttagcggtta-catg	Protospacer
. .** **************.*****.* *** 

409. spacer 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder matches to NC_018696 (Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence) position: , mismatch: 7, identity: 0.781

cagccagcagcgaatgcgttggcggtcagcat-	CRISPR spacer
tcacccgcagcgaatgcgttagcggtta-catg	Protospacer
. .** **************.*****.* *** 

410. spacer 14.35|2163631|33|NZ_LN868939|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788

ccgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
acggcgggtgctggagcgggtgatgaagagccg	Protospacer
 **  .*.*********** ********* ***

411. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 7, identity: 0.788

cagcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
cagcccggcgccgcgaccacccgacgtgcagcg	Protospacer
******.**** *************  *  * *

412. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 7, identity: 0.788

cagcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
cagcccggcgccgcgaccacccgacgtgcagcg	Protospacer
******.**** *************  *  * *

413. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788

-cgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gcgcc-tcgacccggccgacgtcaccgccgaacg	Protospacer
 **** **************.* ******* .. 

414. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 7, identity: 0.781

-cgaattgggtatcgaaatggtttgccacgtca	CRISPR spacer
gcgta-tgggcatcgaaatgggttgccacgggg	Protospacer
 ** * ****.********** ********  .

415. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 7, identity: 0.781

--gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
tgacgg--aggctggcgctgatctcgctgatgtt	Protospacer
  .***  *******.*.************* * 

416. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
cacgacagcaccaccaccacctcggcgac	Protospacer
  *.*   ************* *******

417. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
acgccaccgcccaccaccaccgcggcgag	Protospacer
.*   ***  ****************** 

418. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
ttctcatgcacgaccaccaccgcggcgac	Protospacer
 .*  *. *** *****************

419. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
ttctcatgcacgaccaccaccgcggcgac	Protospacer
 .*  *. *** *****************

420. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
ttctcatgcacgaccaccaccgcggcgac	Protospacer
 .*  *. *** *****************

421. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
accgccatcaccaccaccaccgccgcgac	Protospacer
.**.   .*************** *****

422. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
accgccatcaccaccaccaccgccgcgac	Protospacer
.**.   .*************** *****

423. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
accccacccaccaccaccaccgccgccgt	Protospacer
.**  ****************** ** ..

424. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AP013686 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
gggaaacccaccaccaccacctctgccca	Protospacer
*  ****************** * **   

425. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AP013685 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
gggaaacccaccaccaccacctctgccca	Protospacer
*  ****************** * **   

426. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AP013676 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
gggaaacccaccaccaccacctctgccca	Protospacer
*  ****************** * **   

427. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AF311651 (Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds) position: , mismatch: 7, identity: 0.759

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
gccaagcccaccgccaccaccgcctcccg	Protospacer
*****.******.**********  *   

428. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 7, identity: 0.781

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
agtcggaccggttgggcgtcgtcctcgaagag	Protospacer
  *. *******.***************.** 

429. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 7, identity: 0.781

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
ccggggatgggttgggcgtcgtcctcgacgac	Protospacer
**   **. ***.*************** ***

430. spacer 15.14|2279045|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044987 (Deinococcus sp. AJ005 plasmid p96k, complete sequence) position: , mismatch: 7, identity: 0.781

gggttcacgggctgggcgaccgggaagcggtt	CRISPR spacer
ggttgaccgggctgagcgaccgggacgcggtg	Protospacer
** *   *******.********** ***** 

431. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
acgccagcgcgcccgagaaggtggcgctggcg	Protospacer
 ********.***** *********    ***

432. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.781

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
gcggtcgagcaggcgcaggcgcaggtcggcgt	Protospacer
*  ****** ********** ******..* *

433. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to MT310863 (Streptomyces phage Issmi, complete genome) position: , mismatch: 7, identity: 0.781

gacgtcgagaaggcgcaggcccaggtcaactt--	CRISPR spacer
cacgtcgagcaggcgcaggctcagctt--cttgg	Protospacer
 ******** **********.*** *.  ***  

434. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 7, identity: 0.774

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
gcgcacgggcgccgacgtcgtcgggccttcg	Protospacer
*** ********** **********     *

435. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.774

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
gcgcacgggcgccgacgtcgtcgggccttcg	Protospacer
*** ********** **********     *

436. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.794

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
ccggtaccgccgcggccaccccccgcccggccgc	Protospacer
************* **********  **  *  *

437. spacer 15.26|2278559|35|NZ_LN868939|PILER-CR matches to KX452697 (UNVERIFIED: Serratia phage KPN4 genomic sequence) position: , mismatch: 7, identity: 0.8

cgcggtcaggctggtgttgatctcgctgatctggc	CRISPR spacer
ggtgccaaggctggtgttgatcgtgctgatctggc	Protospacer
 *.* . *************** .***********

438. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 7, identity: 0.781

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
acccggcggcaccaccaccaccgcggcgacgc	Protospacer
  **..   ***********************

439. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 7, identity: 0.781

-----cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gaagtcgccg-----accaccaccaccgcgacgacgc	Protospacer
     ****.     ***************.******

440. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.781

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gcccagggcctccagcaccaccgcggcgacgc	Protospacer
  ***.. ** *** *****************

441. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 7, identity: 0.781

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
tgcccggcccaccaccacgaccgcggcgccgg	Protospacer
.*** ..*********** ********* ** 

442. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 7, identity: 0.781

cgccaaacc---caccaccaccaccgcggcgacgc	CRISPR spacer
---ccgaccgggcaccaccacaaccgcggcggcgc	Protospacer
   * .***   ********* *********.***

443. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 7, identity: 0.781

---cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
tggggcca---ccaccgcgaccaccgcggcgacga	Protospacer
    ****   *****.* *************** 

444. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.781

--cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gctgccga--ccaccaccaccacgggggcgacga	Protospacer
  .***.*  ************* * ******* 

445. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 7, identity: 0.781

---cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
tggggcca---ccaccgcgaccaccgcggcgacga	Protospacer
    ****   *****.* *************** 

446. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 7, identity: 0.781

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
caccacgaccagcacgaccaccgcggcgacgg	Protospacer
*.*** . *** *** *************** 

447. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AF311651 (Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds) position: , mismatch: 7, identity: 0.781

cgccaaacccaccaccaccaccgcggcgacgc-	CRISPR spacer
agccaagcccaccgccaccaccgcctc-ccgct	Protospacer
 *****.******.**********  *  *** 

448. spacer 15.45|2278560|34|NZ_LN868939|CRT matches to JX878496 (Serratia phage phiMAM1, complete genome) position: , mismatch: 7, identity: 0.794

gcggtcaggctggtgttgatctcgctgatctggc	CRISPR spacer
gtgccaaggctggtgttgatcgtgctgatctgac	Protospacer
*.* . *************** .*********.*

449. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agtgaacccaccaccaccaccgaggcggcga	Protospacer
. ..****************** ****.** 

450. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
atcaccgccacgaccaccagcgcggcgacgc	Protospacer
..**   **** ******* ***********

451. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
accgtcgccaccgtcaccaccgcggcgacgc	Protospacer
.**.   *****..*****************

452. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcgacaccaccaccaccacggcggcgactc	Protospacer
. *.*  ************* ******** *

453. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcgacaccaccaccaccacggcggcgactc	Protospacer
. *.*  ************* ******** *

454. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcgacaccaccaccaccacggcggcgactc	Protospacer
. *.*  ************* ******** *

455. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcgacaccaccaccaccacggcggcgactc	Protospacer
. *.*  ************* ******** *

456. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcgacaccaccaccaccacggcggcgactc	Protospacer
. *.*  ************* ******** *

457. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcgacaccaccaccaccacggcggcgactc	Protospacer
. *.*  ************* ******** *

458. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcgacaccaccaccaccacggcggcgactc	Protospacer
. *.*  ************* ******** *

459. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcgacaccaccaccaccacggcggcgactc	Protospacer
. *.*  ************* ******** *

460. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 7, identity: 0.774

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
accacgaccagcacgaccaccgcggcgacgg	Protospacer
.*** . *** *** *************** 

461. spacer 15.49|2278801|34|NZ_LN868939|CRT matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 7, identity: 0.794

ccgaggtcgattccgcgggcgtcg-gcgtaggcat	CRISPR spacer
ccgaggtcgaagccgcgggcgtcgcgcagcggcg-	Protospacer
**********  ************ **.  ***. 

462. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

gcgaacg-ggcgccgccgtcgtcggggaagaggt	CRISPR spacer
-cgatcacttcgccgccgtcgtcgggtacgaggt	Protospacer
 *** *.   **************** * *****

463. spacer 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggccacacccagagcgaggaagttgcggc	CRISPR spacer
ggccgccacacccacagcgaggaggatctgcg	Protospacer
*** ********** ********.* * .*  

464. spacer 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggccacacccagagcgaggaagttgcggc	CRISPR spacer
ggccgccacacccacagcgaggaggatctgcg	Protospacer
*** ********** ********.* * .*  

465. spacer 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggccacacccagagcgaggaagttgcggc	CRISPR spacer
ggccgccacacccacagcgaggaggatctgcg	Protospacer
*** ********** ********.* * .*  

466. spacer 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggccacacccagagcgaggaagttgcggc	CRISPR spacer
ggccgccacacccacagcgaggaggatctgcg	Protospacer
*** ********** ********.* * .*  

467. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
ctcgtcgcggtagcggtggggtccggcggcgc	Protospacer
    * ***** **************** ** 

468. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
gtgccggcggtcgcggcggggtccgtcctcca	Protospacer
* **.***********.******** * .* .

469. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 8, identity: 0.75

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
ggtcctctcgtcgcggtggggggcggcgccgg	Protospacer
** *.  . ************  *********

470. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tgctcgaaggagacgacaaagccgcaatccg	CRISPR spacer
gtctcgtaggagacgacaatgccgcgctcga	Protospacer
  **** ************ *****. ** .

471. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

accggcacgctgctcgacggctt---tctgagctg	CRISPR spacer
accggcacgctgtccgacggcttctactcgag---	Protospacer
************..*********   ...***   

472. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MK801721 (Gordonia phage William, complete genome) position: , mismatch: 8, identity: 0.75

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
accggcaccctgctcgacgggttcttccgcac	Protospacer
******** *********** **..*  **  

473. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 8, identity: 0.75

acctacgaggtccctgaccccgacggcggcga	CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct	Protospacer
** . *** *****.*************.*  

474. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 8, identity: 0.75

acctacgaggtccctgaccccgacggcggcga	CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct	Protospacer
** . *** *****.*************.*  

475. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_048791 (Corynebacterium phage Adelaide, complete genome) position: , mismatch: 8, identity: 0.75

acctacgaggtccctgaccccgacggcggcga	CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct	Protospacer
** . *** *****.*************.*  

476. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 8, identity: 0.75

acctacgaggtccctgaccccgacggcggcga	CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct	Protospacer
** . *** *****.*************.*  

477. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_048790 (Corynebacterium phage Lederberg, complete genome) position: , mismatch: 8, identity: 0.75

acctacgaggtccctgaccccgacggcggcga	CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct	Protospacer
** . *** *****.*************.*  

478. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
cgccggggggagcgggtggccgcggcgcaggc	Protospacer
  * .***** ******* ********* * *

479. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
ctgccgacggtgcaggtgcccgaggcgccgcc	Protospacer
 *   *. *****.******** *********

480. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
ggtgcgagggtgcgggtgcgcgccgcgccgga	Protospacer
* .* *.************ *** ******  

481. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
ctgcgcgaggtgcggctgcccgcggcgctgcc	Protospacer
 *  . *.******* ************.***

482. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagg----gggtgcgggtgcccgcggcgccgcc	CRISPR spacer
----aggctgctggcgcgggtgcccgcggcgcggct	Protospacer
    ***     **.***************** **.

483. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
gccgacggggcgcgggtgcccgcgggcgagac	Protospacer
*.*** ****.**************    * *

484. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_020542 (Sphingomonas sp. MM-1 plasmid pISP0, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagg----gggtgcgggtgcccgcggcgccgcc	CRISPR spacer
----aggctgctggcgcgggtgcccgcggcgcggct	Protospacer
    ***     **.***************** **.

485. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
gccgagcgggtgcgggtgccggcgggcgtgct	Protospacer
*.**** ************* ****   .**.

486. spacer 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder matches to MK479295 (Salmonella phage SEE-1, complete genome) position: , mismatch: 8, identity: 0.758

cccgcaggccgccccgctcacgcgaagaacggc	CRISPR spacer
ccaggctgccgccctgctcacgcgcagaacgaa	Protospacer
** *   *******.********* ******. 

487. spacer 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder matches to MT012729 (Salmonella phage vB_SenTO17, complete genome) position: , mismatch: 8, identity: 0.758

cccgcaggccgccccgctcacgcgaagaacggc	CRISPR spacer
ccaggctgccgccctgctcacgcgcagaacgaa	Protospacer
** *   *******.********* ******. 

488. spacer 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder matches to MK214385 (Salmonella phage TS6, complete genome) position: , mismatch: 8, identity: 0.758

cccgcaggccgccccgctcacgcgaagaacggc	CRISPR spacer
ccaggctgccgccctgctcacgcgcagaacgaa	Protospacer
** *   *******.********* ******. 

489. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cgtcgaagcgctcgccgaggccgaaggagaaa	Protospacer
*  ****** .*****************.   

490. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cgtcgaagcgctcgccgaggccgaaggagaaa	Protospacer
*  ****** .*****************.   

491. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cggcgcagccttcgccgaggacgaagccgttg	Protospacer
* *** ************** *****  .*. 

492. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cgatgaagcattcgccgcggccgaaggcggcc	Protospacer
* ..***** ******* ********* . **

493. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc------	CRISPR spacer
ccgcgaaggcttctccgaggccg------tccacgaca	Protospacer
******** **** *********      ***      

494. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cgccgatgccttcgccgtggccgaagcgctcg	Protospacer
*  *** ********** ******** . ** 

495. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcgatgccttcgccgcggccggtgaagccg	Protospacer
****** ********** *****. *.*..* 

496. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc------	CRISPR spacer
ccgcgaaggcttctccgaggccg------tccacgaca	Protospacer
******** **** *********      ***      

497. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cgccgatgccttcgccgtggccgaagcgctcg	Protospacer
*  *** ********** ******** . ** 

498. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041744 (Paraburkholderia megapolitana strain LMG 23650 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ctacgaagccttcgcagaggacgaagatttac	Protospacer
*..************ **** *****.  * *

499. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MH590601 (Streptomyces phage Haizum, complete genome) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgagg------ccgaaggaatcc	CRISPR spacer
ccgcgaagcctgcgccgaagccggccccgaag------	Protospacer
*********** ******.*      ******      

500. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MK392364 (Streptomyces phage Nishikigoi, complete genome) position: , mismatch: 8, identity: 0.75

ccgcgaagccttcgccgagg------ccgaaggaatcc	CRISPR spacer
ccgcgaagcctgcgccgaagccggccccgaag------	Protospacer
*********** ******.*      ******      

501. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
cagatcacccccgccgaggtcgacgccgaact	Protospacer
*  ** ******.*************** .. 

502. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

503. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

504. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

505. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

506. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

507. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

508. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

509. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

510. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

511. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

512. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg	Protospacer
  **. .* *******.** ************

513. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
cgcgtcacccgcaccgaggtcgacggcgcaat	Protospacer
* *.* **** ************** ***.  

514. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
cgcgtcacccgcaccgaggtcgacggcgcaat	Protospacer
* *.* **** ************** ***.  

515. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
accccgccccccaccgaggtcgccaccgcgcc	Protospacer
 ** .* *************** *.*****. 

516. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
cgcgtcacccgcaccgaggtcgacggcgcaat	Protospacer
* *.* **** ************** ***.  

517. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to CP003950 (Rhodococcus opacus PD630 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
aacgtcagcctcaccgaggtcgaggccgcgtt	Protospacer
  *.* * **.************ ******* 

518. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
acggtggtgaagcgggcgatgcccgccgcccg	Protospacer
.  . **.******************** * *

519. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ggcagggcgaagagggcgatgccgatggccga	Protospacer
************ ********** .. * *..

520. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
tcctgggcgaagcgggcgatgtcggccgcgat	Protospacer
  * *****************.* ****  * 

521. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
tcctgggcgaagcgggcgatgtcggccgcgat	Protospacer
  * *****************.* ****  * 

522. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
tgcaggccgtagcgggcgatgcccttggcccg	Protospacer
 ***** ** ************** . * * *

523. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014679 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_5) position: , mismatch: 8, identity: 0.75

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ggcagggcgaagagagcgatgccggttgatca	Protospacer
************ *.******** *..**. .

524. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
tgcaacctgacgcgggcgatggccgccgacaa	Protospacer
 ***.  .** ********** *********.

525. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP039914 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625c, complete sequence) position: , mismatch: 8, identity: 0.75

gagccgctgctgaccgaggagcacctggccgg	CRISPR spacer
aagccgctgctgatcgtggagcacgaaggccg	Protospacer
.************.** *******  .* * *

526. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gagccgct--gctgaccgaggagcacctggccgg	CRISPR spacer
--gtcggcgggctgaacgaggagcatctggccgt	Protospacer
  *.** .  ***** *********.******* 

527. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 8, identity: 0.75

gagccgctgctgaccgaggagcacctggccgg	CRISPR spacer
gcccgggagctggccgaggagcacctgaccgt	Protospacer
*  * *  ****.**************.*** 

528. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_LR134470 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 28, complete sequence) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cgcagtgggcgatcctcgtcgcccgcaccgac	Protospacer
.*   .************ ***** *****.*

529. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
ggtgccgggcgatccacgacgacctcacgcga	Protospacer
 *  *********** ***** ******  * 

530. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tgatccgggcgatcgccgacgccaaccgcacc	Protospacer
************** .*******  *  *. *

531. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tgcgcaaggcgatcctcgacgcccacgccgca	Protospacer
**  * .***************** *.***  

532. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cgtccgtggcgatcctcgacgcgctcaacgcc	Protospacer
.* .*  *************** **** ** *

533. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
acgtgcgctcgatcctcgacgccggcaccggc	Protospacer
  .* **  **************  *******

534. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP003958 (Rhodococcus opacus PD630 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
acctcatggcgatcctcgacgcccaccccgcc	Protospacer
   **  ***************** * *** *

535. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP003952 (Rhodococcus opacus PD630 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
acctcatggcgatcctcgacgcccaccccgcc	Protospacer
   **  ***************** * *** *

536. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75

tgatccg--ggcgatcctcgacgccctcaccggc	CRISPR spacer
--gctcgtcggcggtcctcgacgcgctcaccgac	Protospacer
  ...**  ****.********** *******.*

537. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cggatcaggcgatccgcgacgcgctcaccgac	Protospacer
.*. .*.******** ****** *******.*

538. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 8, identity: 0.75

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cggatcaggcgatccgcgacgcgctcaccgac	Protospacer
.*. .*.******** ****** *******.*

539. spacer 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 8, identity: 0.75

cggccacggcgtcgcgtgtggaccggcggctc	CRISPR spacer
gcgacacggcggcgcgtgtcgaccggcgcttg	Protospacer
  * ******* ******* ******** .* 

540. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
gacgggctgatcggcgccgagctcttcaccgc	Protospacer
** ..******** ****** ********  .

541. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN204496 (Streptomyces phage Kardashian, complete genome) position: , mismatch: 8, identity: 0.75

gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
ggaaggatgatggttgccgacctcttcacgac	Protospacer
*..*.* **** **.*************** .

542. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gggcgcgagacgctggcggcggtcctccccca	Protospacer
************ ********** *  .  *.

543. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
ctgcgcgacacggtgacggcggtgcgcacgct	Protospacer
  ****** ******.**********   ** 

544. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gcgatcgtgagggtggcggcggtgcggtcgtc	Protospacer
* *  ** ** ***************** *. 

545. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP040995 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg	Protospacer
*.******* ************ ** .*. .*

546. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg	Protospacer
*.******* ************ ** .*. .*

547. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg	Protospacer
*.******* ************ ** .*. .*

548. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg	Protospacer
*.******* ************ ** .*. .*

549. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg	Protospacer
*.******* ************ ** .*. .*

550. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP011044 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gcttgcgagacggtggtggcggggcggggcgg	Protospacer
*  .************.***** **** *  *

551. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021035 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gcttgcgagacggtggtggcggggcggggcgg	Protospacer
*  .************.***** **** *  *

552. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021039 (Clavibacter michiganensis subsp. insidiosus strain ATCC 10253 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gcttgcgagacggtggtggcggggcggggcgg	Protospacer
*  .************.***** **** *  *

553. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

-gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
tgagca-atgacggtggcggaggagcggtggca	Protospacer
 *.**. . *********** ** ********.

554. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cgggcctcaacggcggcgtcggtgcggtggcg	Protospacer
 **  *  .****.**** *************

555. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cgggcctcaacggcggcgtcggtgcggtggcg	Protospacer
 **  *  .****.**** *************

556. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cgggcctcaacggcggcgtcggtgcggtggcg	Protospacer
 **  *  .****.**** *************

557. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 8, identity: 0.75

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cgggcctcaacggcggcgtcggtgcggtggcg	Protospacer
 **  *  .****.**** *************

558. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_017311 (Desulfovibrio vulgaris RCH1 plasmid pDEVAL01, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
gagaaggtcgccgcgctgggcgcgacgctcat	Protospacer
*. . *. ********* ******** *****

559. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_005863 (Desulfovibrio vulgaris str. Hildenborough plasmid pDV, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
gagaaggtcgccgcgctgggcgcgacgctcat	Protospacer
*. . *. ********* ******** *****

560. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_008741 (Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
gagaaggtcgccgcgctgggcgcgacgctcat	Protospacer
*. . *. ********* ******** *****

561. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
agcgcgaaggccgcgcccggcgcgctgctgac	Protospacer
.******* *******.******* . ** *.

562. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgaacgacgcgctcgacgccatgggcct	Protospacer
********** ********.*** *.   * *

563. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
tgcgcggacgccgcgctcgccgcgtccgtact	Protospacer
 *****.************ **** *. *  *

564. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
cgcgcaaacggcgcgctcggcgcggcgcgcgg	Protospacer
 ****.**** *************.* * *. 

565. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat--	CRISPR spacer
ggcgcgaaggccgcgctcgccgc--cttcgacca	Protospacer
******** ********** ***  **.. *.  

566. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
gctgcgagcgccgcgcccggcgcgaccggcac	Protospacer
* .****.********.*********.  **.

567. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022197 (Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
cgggcgatcgtcgcgctcggcgcgacggccct	Protospacer
 * **** **.***************  .* *

568. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75

-ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
cagcg-aaacgccgcgctcggcgagcctctttg	Protospacer
 .*** .**************** * ****.  

569. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021117 (Rhodobacteraceae bacterium strain G7 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
cgggcgatcgtcgcgctcggcgcgacggccct	Protospacer
 * **** **.***************  .* *

570. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP004396 (Celeribacter indicus strain P73 plasmid pP73C, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
cgggcgatcgtcgcgctcggcgcgacggccct	Protospacer
 * **** **.***************  .* *

571. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP053565 (Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
gtggcgaacgccgcgatcagcgcgaccttctg	Protospacer
*  ************ **.*******..**  

572. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_009956 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence) position: , mismatch: 8, identity: 0.75

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
tcggtcacggtgaccggcccgccccggcggat	Protospacer
 .*. ****************. ***** * *

573. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT522007 (Gordonia phage Epsocamisio, complete genome) position: , mismatch: 8, identity: 0.75

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtacctagcctt	Protospacer
* *** ************.****** . . **

574. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK967382 (Gordonia phage ReMo, complete genome) position: , mismatch: 8, identity: 0.75

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
gggaagacggtgaccggctcgtacctagcctt	Protospacer
* *** ************.****** . . **

575. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tccaggccgccgcccgtgatgctgaccgcgcc	Protospacer
 .**  ************.**.********. 

576. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
gccagtccgccgccattggtgttgaccgcaag	Protospacer
*.** .********  *************. .

577. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcccgccgcccgtggtgttgaccgcgta-	CRISPR spacer
ccgctctcgccgcccgtgctgttgacc-cgtgc	Protospacer
 .  **.*********** ******** ***. 

578. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
gcgacgccgccgcccgtggtgtcgatcgccca	Protospacer
*. *. ****************.**.*** .*

579. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP010871 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
gacaggccgccgccgttggtgttgaccgccag	Protospacer
* **  ********  *************  .

580. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
ggcatcccgctgccggtggtgttgatgctgtt	Protospacer
* ********.*** **********.  .** 

581. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.765

cccgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
gacggcgggtgctggagcgggtgatgaagagccg	Protospacer
  **  .*.*********** ********* ***

582. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.765

cccgcgagatgctggagcggctga---tgaagacccg	CRISPR spacer
cccgcgagatgacggagcggctgagcgtcgcgac---	Protospacer
*********** .***********   * . ***   

583. spacer 14.4|2163813|34|NZ_LN868939|PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.765

ccgacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
cggacacgaccctgcagcgcaccgtgcggacatg	Protospacer
* ***************** *.****   .* **

584. spacer 14.4|2163813|34|NZ_LN868939|PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.765

ccgacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
cggacacgaccctgcagcgcaccgtgcggacatg	Protospacer
* ***************** *.****   .* **

585. spacer 14.4|2163813|34|NZ_LN868939|PILER-CR matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 8, identity: 0.765

ccgacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
cggacacgaccctgcagcgcaccgtgcggacatg	Protospacer
* ***************** *.****   .* **

586. spacer 14.6|2163935|34|NZ_LN868939|PILER-CR matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 8, identity: 0.765

ccagcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
gcagcccggcgccgcgaccacccgacgtgcagcg	Protospacer
 ******.**** *************  *  * *

587. spacer 14.6|2163935|34|NZ_LN868939|PILER-CR matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 8, identity: 0.765

ccagcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
gcagcccggcgccgcgaccacccgacgtgcagcg	Protospacer
 ******.**** *************  *  * *

588. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.765

ccggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ccggcggcatcacccgccgcgtcaccgcggagaa	Protospacer
*****************  *******..  **  

589. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP033221 (Parasedimentitalea marina strain W43 plasmid pW43B, complete sequence) position: , mismatch: 8, identity: 0.765

ccggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ccggcagcatcacccgcaccggcattcatcatct	Protospacer
*****.*************** **..  .** **

590. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP033222 (Parasedimentitalea marina strain W43 plasmid pW43C, complete sequence) position: , mismatch: 8, identity: 0.765

ccggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ccggcagcatcacccgcaccggcattcatcatct	Protospacer
*****.*************** **..  .** **

591. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgagatgctggagcggctga---tgaagacccg	CRISPR spacer
cgagagatgctggagcggctgatcgtgcgagc---	Protospacer
** *******************   ** ...*   

592. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
ttccgggccctggagcggctggtgaagacccg	Protospacer
. * .*.. ************.**********

593. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NC_015852 (Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
cgggagaagctggagcggctgattcatgacgg	Protospacer
** **** ***************  * . * *

594. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgagatgctggagcggctgatgaa--gacccg	CRISPR spacer
ggcgagatgctcgaccggctgatgggtcggcc--	Protospacer
 ********** ** *********..  *.**  

595. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
cgcgacatgctggcgcggctgatctacggcgg	Protospacer
***** ******* *********  * . * *

596. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgagatgctggagcggctgatgaa--gacccg	CRISPR spacer
ggcgagatgctcgaccggctgatgggtcggcc--	Protospacer
 ********** ** *********..  *.**  

597. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
gccacggccctgctgcggatcgtgatgctcca	Protospacer
* ****.****** ************  .*..

598. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75

gacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
gccacggccctgctgcggatcgtgatgctcca	Protospacer
* ****.****** ************  .*..

599. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP042265 (Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
cacgcgccgctcatgatcggccgggaagccga	Protospacer
**  ***************** .****  . *

600. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
gggccgctggtcatgatcggcgagg-gcggcac	Protospacer
 .*****.* *************** .*. ** 

601. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
ccagcagctcggcgaccacccgaccaggggcg	Protospacer
    **** *.***************** * *

602. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 8, identity: 0.75

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
ggcccagcgcatcgaccacccggccgagccag	Protospacer
.********** **********.**..*. .*

603. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
ctggtcaacccggccgacctgaccgccgagac	Protospacer
 .  **.*********** ********* * *

604. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
ctggtcaacccggccgacctgaccgccgagac	Protospacer
 .  **.*********** ********* * *

605. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
ctggtcaacccggccgacctgaccgccgagac	Protospacer
 .  **.*********** ********* * *

606. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
cccggcgtcccggccgacaagaccgccgccgt	Protospacer
 **  ** *********** *********  .

607. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gatctggtgccggccgacatgatcgccgtgtc	Protospacer
* ..* *  *************.*****.***

608. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gccttcgacccgtccgacaggacgtaggtgcc	Protospacer
************ ****** ***    *.*.*

609. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834599 (Microbacterium phage Bernstein, complete genome) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat	Protospacer
*.****** ********** ***** * .* .

610. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834602 (Microbacterium phage Brahms, complete genome) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat	Protospacer
*.****** ********** ***** * .* .

611. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat	Protospacer
*.****** ********** ***** * .* .

612. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834626 (Microbacterium phage Rollins, complete genome) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat	Protospacer
*.****** ********** ***** * .* .

613. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834604 (Microbacterium phage Coltrane, complete genome) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat	Protospacer
*.****** ********** ***** * .* .

614. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 8, identity: 0.75

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gtcttcgaaccggccgacaagaccggcctgat	Protospacer
*.****** ********** ***** * .* .

615. spacer 14.26|2164120|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gcaggcgcgagcgcagctcgcgaacgacggcg	CRISPR spacer
cccagcgcgcgcgcagatcgcgaacgaaaccg	Protospacer
 * .***** ****** ********** . **

616. spacer 14.26|2164120|32|NZ_LN868939|CRISPRCasFinder matches to HM461982 (Burkholderia phage KS14, complete genome) position: , mismatch: 8, identity: 0.75

gcaggcgcgagcgcagctcgcgaacgacggcg	CRISPR spacer
aaaggcgcgtgcgcagctcgcgcaccttgtcg	Protospacer
. ******* ************ **  .* **

617. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tcacgcactacggccgcaccatcggcgacggc	Protospacer
 *. *  *.*****************. ****

618. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-----gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tgaccgtga-----acggccgcgccatcggcatccgc	Protospacer
     *.**     ********.*********** **

619. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

-----gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tgaccgtga-----acggccgcgccatcggcatccgc	Protospacer
     *.**     ********.*********** **

620. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
gcatcaaggacgggcgcatcatcggcatcggc	Protospacer
**.  *   **** ****.*************

621. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
gcatccgcgacggccgcatcgtcggcatcggc	Protospacer
**.    * *********.*.***********

622. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tcgagaaccacggcctcaccatcgccgtggcg	Protospacer
 ***** ******** ******** *.* *  

623. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ggcggcatcacccgccgcgtcaccgcggagaa	Protospacer
***************  *******..  **  

624. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ggcggcatcacgctcaccgtcaccgacaacgg	Protospacer
*********** * **********. * *   

625. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ggcggcagcacccgcaccgccacgaccgacgc	Protospacer
******* ***********.*** *.* *  .

626. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP054600 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
agcggcatcagccgcaccggcaccggctggcg	Protospacer
.********* ******** ****. *..** 

627. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
gtcgggatcacccgcaccgtcaacactgggcg	Protospacer
* *** **************** **.. .** 

628. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
gtcgggatcacccgcaccgtcaacactgggcg	Protospacer
* *** **************** **.. .** 

629. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggcatcacccgcaccgtcacc--atccagct	CRISPR spacer
cgcgccatcacccgcaccttcaccgaggtcag--	Protospacer
 *** ************* *****  . .***  

630. spacer 14.31|2164425|32|NZ_LN868939|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 8, identity: 0.75

ccgatgaccgccatcccgccacccaagcggac	CRISPR spacer
tcgatgaccgacaacccgccacccgtgcacaa	Protospacer
.********* ** **********. **. * 

631. spacer 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 8, identity: 0.75

cggtcctcacccgtgtcgggcccg----cggtactg	CRISPR spacer
cggtcctcacccgtgacgggaccgttgacgac----	Protospacer
*************** **** ***    **..    

632. spacer 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 8, identity: 0.75

cggtcctcacccgtgtcgggcccg----cggtactg	CRISPR spacer
cggtcctcacccgtgacggggccgttgacgac----	Protospacer
*************** **** ***    **..    

633. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgaacggcagcgtccagaggtcgccctcggt	CRISPR spacer
acgaacagcagcgtcctgaggtcgagcgcgag	Protospacer
 *****.********* *******  * **. 

634. spacer 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 8, identity: 0.75

cagccagcagcgaatgcgttggcggtcagcat	CRISPR spacer
aagccagcaacgaatgcgatggcggtggttgt	Protospacer
 ********.******** ******* . ..*

635. spacer 14.35|2163631|33|NZ_LN868939|CRT matches to NC_015852 (Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence) position: , mismatch: 8, identity: 0.758

ccgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
ccgggagaagctggagcggctgattcatgacgg	Protospacer
*** **** ***************  * . * *

636. spacer 14.38|2163814|33|NZ_LN868939|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.758

cgacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
ggacacgaccctgcagcgcaccgtgcggacatg	Protospacer
 ***************** *.****   .* **

637. spacer 14.38|2163814|33|NZ_LN868939|CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 8, identity: 0.758

cgacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
ggacacgaccctgcagcgcaccgtgcggacatg	Protospacer
 ***************** *.****   .* **

638. spacer 14.38|2163814|33|NZ_LN868939|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.758

cgacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
ggacacgaccctgcagcgcaccgtgcggacatg	Protospacer
 ***************** *.****   .* **

639. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to KX576640 (Arthrobacter phage RcigaStruga, complete genome) position: , mismatch: 8, identity: 0.758

ccagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
ggagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
  ************.**.********  * **. 

640. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to MG210949 (Arthrobacter phage Huntingdon, complete genome) position: , mismatch: 8, identity: 0.758

ccagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
ggagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
  ************.**.********  * **. 

641. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to MK112529 (Arthrobacter phage BigMack, complete genome) position: , mismatch: 8, identity: 0.758

ccagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
ggagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
  ************.**.********  * **. 

642. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758

cagcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
tcgcccagcgcagcgaccaggcgaccagcggca	Protospacer
. *****************  *******  * .

643. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 8, identity: 0.758

cagcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
cggcccagcgcatcgaccacccggccgagccag	Protospacer
*.********** **********.**..*. .*

644. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.758

cgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gccgttcaacccggccggcatgaccgccgtccc	Protospacer
  * ***.*********.***********. .*

645. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

cgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
cgccttcgacccgtccgacaggacgtaggtgcc	Protospacer
************* ****** ***    *.*.*

646. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.758

cgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
cctggtcaacccggccgacctgaccgccgagac	Protospacer
* .  **.*********** ********* * *

647. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.758

cgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
cctggtcaacccggccgacctgaccgccgagac	Protospacer
* .  **.*********** ********* * *

648. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 8, identity: 0.758

cgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
cctggtcaacccggccgacctgaccgccgagac	Protospacer
* .  **.*********** ********* * *

649. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 8, identity: 0.758

cgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
ccccggcgtcccggccgacaagaccgccgccgt	Protospacer
* **  ** *********** *********  .

650. spacer 14.45|2164241|33|NZ_LN868939|CRT matches to NZ_CP034180 (Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tacgacgaacacggccgcatcatcggcagcggc	Protospacer
 .*** .  **********.******** ****

651. spacer 14.45|2164241|33|NZ_LN868939|CRT matches to NC_010394 (Mycobacterium abscessus plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tacgacgaacacggccgcatcatcggcagcggc	Protospacer
 .*** .  **********.******** ****

652. spacer 14.45|2164241|33|NZ_LN868939|CRT matches to NC_010604 (Mycobacterium marinum M plasmid pMM23, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tacgacgaacacggccgcatcatcggcagcggc	Protospacer
 .*** .  **********.******** ****

653. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

cggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
cggcggcatcacccgccgcgtcaccgcggagaa	Protospacer
****************  *******..  **  

654. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 8, identity: 0.758

cggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
gggcggtaacacccgcaccgtcaccacgccgta	Protospacer
 *****.* *****************. * *. 

655. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

cggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
gggcggcaacacacgcaccgtcaccacgccgta	Protospacer
 ******* *** *************. * *. 

656. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 8, identity: 0.758

cggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
cggcggcagcacccgcaccgccacgaccgacgc	Protospacer
******** ***********.*** *.* *  .

657. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 8, identity: 0.758

cggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
tggcggcatcatccgcaccatcaccgtgacgcg	Protospacer
.**********.*******.*****.*   ** 

658. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 8, identity: 0.75

gcatggaccccggccacatgcgcg-----gcttcata	CRISPR spacer
ccaaggaccccggccacatccgcgcaaacgct-----	Protospacer
 ** *************** ****     ***     

659. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.75

gcatggaccccggccacatgcgcg-----gcttcata	CRISPR spacer
ccaaggaccccggccacatccgcgcaaacgct-----	Protospacer
 ** *************** ****     ***     

660. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.75

gcatggaccccggccacatgcgcg-----gcttcata	CRISPR spacer
ccaaggaccccggccacatccgcgcaaacgct-----	Protospacer
 ** *************** ****     ***     

661. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.75

gcatggaccccggccacatgcgcg-----gcttcata	CRISPR spacer
ccaaggaccccggccacatccgcgcaaacgct-----	Protospacer
 ** *************** ****     ***     

662. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgaattggg-tatcgaaatggtttgccacgtca	CRISPR spacer
-gaacgaggctatcgaaatggttcgccacgatc	Protospacer
 ***. .** *************.****** . 

663. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.75

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
tggcgcaggctggcgctgatctcgctgatgtt	Protospacer
  *  ********.*.************* * 

664. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.75

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
gcggtcagtgtggtgttgatctccggcatcgc	Protospacer
********  *************    ***  

665. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.724

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
ctgtttgccaccaccaccaccgccgcgac	Protospacer
 .     **************** *****

666. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.724

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
aatccacccagcagcaccaccgcggcgat	Protospacer
. .  ***** ** **************.

667. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026696 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence) position: , mismatch: 8, identity: 0.724

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
accaatcccaccaccaccgccgcgattgg	Protospacer
.**** ************.*****.. . 

668. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.724

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
ttctcgtgcacgaccaccaccgcggcgac	Protospacer
 .*  .. *** *****************

669. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.724

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
ttctcgtgcacgaccaccaccgcggcgac	Protospacer
 .*  .. *** *****************

670. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.724

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
ttaccccccaccaacaccaccgcgtcgac	Protospacer
 .    ******* ********** ****

671. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 8, identity: 0.724

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
aagtcgccgaccaccaccaccgcgacgac	Protospacer
.    .** ***************.****

672. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to KT997874 (Uncultured Mediterranean phage uvDeep-CGR2-KM23-C198, complete genome) position: , mismatch: 8, identity: 0.724

gccaaacccaccaccaccaccgcggcgac	CRISPR spacer
catagacccaccaccaccgccgcggccca	Protospacer
  .*.*************.*******   

673. spacer 15.9|2278740|32|NZ_LN868939|CRISPRCasFinder matches to MH316566 (Gordonia phage Nedarya, complete genome) position: , mismatch: 8, identity: 0.75

gccgactccttggactcgacgtagttcttcag	CRISPR spacer
cccgcgaccttggtgtcgacgtagttcttcgt	Protospacer
 ***   ******  ***************. 

674. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
acgttctcgattgcgtgggcgtcggcgtacgt	Protospacer
 **   ****** **.************* *.

675. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
atgcgggcgatcccgcgggcgtcggcggccgc	Protospacer
 .* ** ****.***************   **

676. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
acgttctcgattgcgtgggcgtcggcgtacgt	Protospacer
 **   ****** **.************* *.

677. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
atgcgggcgatcccgcgggcgtcggcggccgc	Protospacer
 .* ** ****.***************   **

678. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75

ttccgcttctgacgagccgaacgcc--gctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgcctg--	Protospacer
  ***.************** ****  **..*  

679. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to MH077578 (Mycobacterium phage DillTech15, complete genome) position: , mismatch: 8, identity: 0.75

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggac	Protospacer
.. *.*  ****  ******************

680. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to MT684586 (Mycobacterium phage Gandalph, complete genome) position: , mismatch: 8, identity: 0.75

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggac	Protospacer
.. *.*  ****  ******************

681. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to MH371120 (Mycobacterium phage OlympiaSaint, complete genome) position: , mismatch: 8, identity: 0.75

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggac	Protospacer
.. *.*  ****  ******************

682. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to KT281795 (Mycobacterium phage XFactor, complete genome) position: , mismatch: 8, identity: 0.75

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggac	Protospacer
.. *.*  ****  ******************

683. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
gcttcgaccgcgcgggcgtcgtccacccggcg	Protospacer
 *********  ************ *  **  

684. spacer 15.14|2279045|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75

gggttcacgggctgggcgaccgg----gaagcggtt	CRISPR spacer
ggcttcacgggctcggcgaccggctccgtcgc----	Protospacer
** ********** *********    *  **    

685. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 8, identity: 0.75

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
tcaggggcgtgcgcacgaaggtggccgatgta	Protospacer
**.  .****** *.***************..

686. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
aggccagcgtgcgcgcgtaggtggccacgccg	Protospacer
  ********** **** ********.   **

687. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
ccacgaaggtgcccgtgaaggcggccgatgca	Protospacer
.*.* *. *******.*****.*********.

688. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 8, identity: 0.75

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
tcttgagcgggcccgcgaagctggccgaacca	Protospacer
** . **** ********** *******  *.

689. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.75

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
gcgtcgtgatggccgcgaaggcggccgatgcg	Protospacer
 **.*.  .** *********.**********

690. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 8, identity: 0.75

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
accttggccaaggcgcaggccaaggtcgactt	Protospacer
. * * *  ************ *****.****

691. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 8, identity: 0.742

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
gcgcacgggcgccgacgtcgtcggcccttcg	Protospacer
*** ********** *********      *

692. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.742

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
gcgcacgggcgccgacgtcgtcggtccttcg	Protospacer
*** ********** *********      *

693. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 8, identity: 0.742

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
gcgcacgggcgccgacgtcgtcggcccttcg	Protospacer
*** ********** *********      *

694. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
caagacgggcgccgacgtcgtcggggtcgcg	Protospacer
  ..********** ***********  * *

695. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NC_048046 (Caulobacter phage CcrPW, complete genome) position: , mismatch: 8, identity: 0.742

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
acggcgtggcgccgccgacgtcggcgaagat	Protospacer
.**.   ********** ****** ***** 

696. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to JX100810 (Caulobacter phage CcrColossus, complete genome) position: , mismatch: 8, identity: 0.742

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
acggcgtggcgccgccgacgtcggcgaagat	Protospacer
.**.   ********** ****** ***** 

697. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 8, identity: 0.742

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
gcatgtcggcgtcgccgtcgtcgaggaagac	Protospacer
**. .. ****.***********.****** 

698. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.765

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
cggcaactcacgccgccgcacccccgcccccgcc	Protospacer
* *  **.  *******.* **************

699. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.765

ccggta-ccgccgccgccacccccccgcccccgcc	CRISPR spacer
-cgctgcccgccgccgccagcaccccgccccacca	Protospacer
 ** *. ************ * *********  * 

700. spacer 15.26|2278559|35|NZ_LN868939|PILER-CR matches to JX878496 (Serratia phage phiMAM1, complete genome) position: , mismatch: 8, identity: 0.771

cgcggtcaggctggtgttgatctcgctgatctggc	CRISPR spacer
ggtgccaaggctggtgttgatcgtgctgatctgac	Protospacer
 *.* . *************** .*********.*

701. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gagtgaacccaccaccaccaccgaggcggcga	Protospacer
 . ..****************** ****.** 

702. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gatcaccgccacgaccaccagcgcggcgacgc	Protospacer
 ..**   **** ******* ***********

703. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gaccgtcgccaccgtcaccaccgcggcgacgc	Protospacer
 .**.   *****..*****************

704. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cgcgccctccaccaccacctccgcggtgacgg	Protospacer
***    .*********** ******.**** 

705. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP023670 (Methylomonas koyamae strain LM6 plasmid pLM6, complete sequence) position: , mismatch: 8, identity: 0.75

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cgccaaaaccacctccaccaccgtagccgccg	Protospacer
******* ***** *********..** .*  

706. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to KU984979 (Propionibacterium phage PFR1, complete genome) position: , mismatch: 8, identity: 0.75

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cgcaccggccaccatcaccacggcggcgacga	Protospacer
***   . ******.****** ********* 

707. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_031108 (Propionibacterium phage PFR2, complete genome) position: , mismatch: 8, identity: 0.75

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cgcaccggccaccatcaccacggcggcgacga	Protospacer
***   . ******.****** ********* 

708. spacer 15.30|2278800|35|NZ_LN868939|PILER-CR matches to NC_048021 (Gordonia phage Daredevil, complete genome) position: , mismatch: 8, identity: 0.771

gccgaggtcgattccgcgggcgtcggcgtaggcat	CRISPR spacer
ggtggtgtcgattccacgggcatcggcgtaggcga	Protospacer
* .*. *********.*****.***********. 

709. spacer 15.37|2279227|35|NZ_LN868939|PILER-CR matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.771

ctcgccagcgtgcccgcgaaggtggccgatgcggt	CRISPR spacer
cgcgtcgtgatggccgcgaaggcggccgatgcggt	Protospacer
* **.*.  .** *********.************

710. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cgcgaacg-ggcgccgccgtcgtcggggaagaggt	CRISPR spacer
-tcgatcacttcgccgccgtcgtcgggtacgaggt	Protospacer
  *** *.   **************** * *****

711. spacer 15.44|2278499|34|NZ_LN868939|CRT matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 8, identity: 0.765

-cgaattgggtatcgaaatggtttgccacgtcagc	CRISPR spacer
gcgta-tgggcatcgaaatgggttgccacggggtc	Protospacer
 ** * ****.********** ********  . *

712. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
aagtcgccgaccaccaccaccgcgacgacgc	Protospacer
.    .** ***************.******

713. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cacgacagcaccaccaccacctcggcgacgg	Protospacer
  *.*   ************* ******** 

714. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to MN694695 (Marine virus AFVG_250M866, complete genome) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
accaaaaccaccaccaccaccgccaccagca	Protospacer
.***** **************** .* *   

715. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
ccaaaacgcaccagcaccaccgcggcaatcg	Protospacer
 * **** ***** ************.*.  

716. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
acgccaccgcccaccaccaccgcggcgagga	Protospacer
.*   ***  ****************** * 

717. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742

--gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cgaccggg--caccaccacaaccgcggcggcgc	Protospacer
  .**...  ********* *********.***

718. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP026696 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
accaatcccaccaccaccgccgcgattgggc	Protospacer
.**** ************.*****.. . **

719. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gcgcgggccaccgccaccacggcggcgacgt	Protospacer
**  .. *****.******* *********.

720. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gcgccctccaccaccacctccgcggtgacgg	Protospacer
**    .*********** ******.**** 

721. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to KU984979 (Propionibacterium phage PFR1, complete genome) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gcaccggccaccatcaccacggcggcgacga	Protospacer
**   . ******.****** ********* 

722. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_031108 (Propionibacterium phage PFR2, complete genome) position: , mismatch: 8, identity: 0.742

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gcaccggccaccatcaccacggcggcgacga	Protospacer
**   . ******.****** ********* 

723. spacer 15.49|2278801|34|NZ_LN868939|CRT matches to NC_048021 (Gordonia phage Daredevil, complete genome) position: , mismatch: 8, identity: 0.765

ccgaggtcgattccgcgggcgtcggcgtaggcat	CRISPR spacer
gtggtgtcgattccacgggcatcggcgtaggcga	Protospacer
 .*. *********.*****.***********. 

724. spacer 15.51|2278923|34|NZ_LN868939|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.765

ttccgcttctgacgagccgaacgc---cgctcggtat	CRISPR spacer
ctcagcttctgaggagccgaacgcccactctcga---	Protospacer
.** ******** ***********   * ****.   

725. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 8, identity: 0.765

ccttcgaccggtcgggcgtcgtcctcgaggacat	CRISPR spacer
ccggggatgggttgggcgtcgtcctcgacgacaa	Protospacer
**   **. ***.*************** **** 

726. spacer 15.56|2279228|34|NZ_LN868939|CRT matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccagcgtgcccgcgaaggtggccgatgcggt	CRISPR spacer
gcgtcgtgatggccgcgaaggcggccgatgcggt	Protospacer
 **.*.  .** *********.************

727. spacer 15.56|2279228|34|NZ_LN868939|CRT matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccagcgtgcccgcgaaggtggccgatgcggt	CRISPR spacer
acgccagcgcgcccgagaaggtggcgctggcgtt	Protospacer
 ********.***** *********    *** *

728. spacer 15.56|2279228|34|NZ_LN868939|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccagcgtgcccgcgaaggtggccgatgcggt	CRISPR spacer
tcaggggcgtgcgcacgaaggtggccgatgtagt	Protospacer
**.  .****** *.***************..**

729. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 8, identity: 0.758

gcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
gcgcacgggcgccgacgtcgtcgggccttcgat	Protospacer
*** ********** **********     *.*

730. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 8, identity: 0.758

gcgaacgggcgccgccgtcgtcggg-----gaagaggt	CRISPR spacer
gcgcacgggcgccgacgtcgtcgggccttcgag-----	Protospacer
*** ********** **********     **.     

731. spacer 15.59|2279410|36|NZ_LN868939|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.778

ccggtaccgccgccgccacccccccgcccccgccgt	CRISPR spacer
ccaggcccgccgccgccagcaccccgcccccgacca	Protospacer
**.*  ************ * *********** *  

732. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.733

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggcgtggtcccaggtccctac	Protospacer
***********.**** *******    . 

733. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.733

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggcgtggtcccaggtccctac	Protospacer
***********.**** *******    . 

734. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.733

gggggaccaggtgtgggcccaggtggggga	CRISPR spacer
gggggaccaggcgtggtcccaggtccctac	Protospacer
***********.**** *******    . 

735. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 9, identity: 0.719

gtcaagccgaagaaggctcaggtcacgatgcg	CRISPR spacer
tggaagccgaagaaggcccaggtcccgtgggc	Protospacer
   **************.****** **  *  

736. spacer 5.3|1449490|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 9, identity: 0.719

ttaccggtctcgttgcggaccagtgtcaaccc	CRISPR spacer
aatagggtctcgttgctgaccagtatcagtcc	Protospacer
     *********** *******.***..**

737. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
gacctggcggtcgcggttcggtccggctgtca	Protospacer
*. **************  ********  . .

738. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
gcctcggcggtcgcggtggggagcggcgcgcc	Protospacer
*  ..****************  ******   

739. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to CP054928 (Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
tccctttgtgtcgcggtgcggtccggcggcgg	Protospacer
   **    ********* ********* ***

740. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039426 (Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
gctgtggcggtcgcggtggtggccggcccacc	Protospacer
*   *************** * ***** *   

741. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
ggcgcctcggtcgggctggggtccggcgccaa	Protospacer
**  .  ****** * **************..

742. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 9, identity: 0.719

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
ctgctggcggtcgcggtggcgttcgcggtgag	Protospacer
  ***************** **.**  *. .*

743. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039431 (Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gggctggcggtcgcggtggggtccggcgccgg	CRISPR spacer
gctgtggcggtcgcggtggtggccggcccacc	Protospacer
*   *************** * ***** *   

744. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NZ_CP023492 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tgctcgaaggagacgacaaagccgcaatccg	CRISPR spacer
tgatcgaaggagacgacaaagcaaggctttc	Protospacer
** ******************* . . *.. 

745. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NZ_CP026507 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tgctcgaaggagacgacaaagccgcaatccg	CRISPR spacer
tgatcgaaggagacgacaaagcaaggctttc	Protospacer
** ******************* . . *.. 

746. spacer 6.2|1456953|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 9, identity: 0.719

tgcggcgtgccgaaacggggaatc--gagcagcc	CRISPR spacer
ggcggcgtgccgcaacgaggaatcttcgacaa--	Protospacer
 *********** ****.******   ..**.  

747. spacer 6.3|1457014|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgaggctggagcgggaactccggcctcaagg	CRISPR spacer
gggaggctggagcgggaactgcggcagggcag	Protospacer
  ****************** ****   . .*

748. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
aacggcacgctgctctatggctttcatcccga	Protospacer
* ************* *.*******    * .

749. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
tccggcacgctgctcgagggcattgccctgtg	Protospacer
 **************** *** ** .    **

750. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MN234161 (Gordonia phage Toast, complete genome) position: , mismatch: 9, identity: 0.719

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
accggcaccctgctcgacgggttcttccgtac	Protospacer
******** *********** **..*  *.  

751. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021407 (Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence) position: , mismatch: 9, identity: 0.719

acctacgaggtccctgaccccgacggcggcga	CRISPR spacer
gccgctcaggaccccgaccccgacggcggctc	Protospacer
.**  . *** ***.***************  

752. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719

acctacgaggtccctgaccccgacggcggcga	CRISPR spacer
gtggtcggtgtcccggaccccgactgcggcga	Protospacer
..   **. ***** ********* *******

753. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 9, identity: 0.719

acctacg-----aggtccctgaccccgacggcggcga	CRISPR spacer
-----cggattcaggtctatgaccccgacggcggcct	Protospacer
     **     *****. ****************  

754. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7

acggaggccgccccggtcgggcgcaaatgg	CRISPR spacer
gagcaggccgcgccggtcgggcgcatgctc	Protospacer
. * ******* ************* ..  

755. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

acggaggccgccccggtcgggcgcaaatgg	CRISPR spacer
gcgaaggccgccccggtcgcgcgccctcac	Protospacer
.**.*************** ****   .. 

756. spacer 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743

tcggatcggcctgagccggggcgccctgcgtggtg-	CRISPR spacer
ccggatcggccagggccggggcgcccc-cgctctac	Protospacer
.********** *.************. **.  *. 

757. spacer 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.743

tcggatcggcctgagccggggcgccctgcgtggtg-	CRISPR spacer
ccggatcggccagggccggggcgcccc-cgctctac	Protospacer
.********** *.************. **.  *. 

758. spacer 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743

tcggatcggcctgagccggggcgccctgcgtggtg-	CRISPR spacer
ccggatcggccagggccggggcgcccc-cgctctac	Protospacer
.********** *.************. **.  *. 

759. spacer 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743

tcggatcggcctgagccggggcgccctgcgtggtg	CRISPR spacer
ccggatcggccagggccggggcgcccgctctactg	Protospacer
.********** *.************  . *. **

760. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcgacgcattcgccgaggccgtcgcggccg	Protospacer
****** ** *************  * ...* 

761. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
gcgcgaagccgtcgccgaagccgaggaaggga	Protospacer
 ********* *******.*****.*.*.   

762. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cgccgacgccttcgcccaggccgaagcccgcg	Protospacer
*  *** ********* *********    * 

763. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to JQ067087 (Pseudomonas phage PaMx11, complete genome) position: , mismatch: 9, identity: 0.719

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
gtacgacgccttcgccgaggccggagaggtgc	Protospacer
 ..*** ****************.**...* *

764. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MT664984 (Xanthomonas phage Xp12, complete genome) position: , mismatch: 9, identity: 0.719

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
cctcgacgccttcgccgaggccgcgttctccc	Protospacer
** *** **************** .    .**

765. spacer 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.719

gggaccgacgtggcgcgtgccgaggaattcga	CRISPR spacer
ctggacgacgtggagcgcgccgaggaatcagt	Protospacer
  *. ******** ***.**********. * 

766. spacer 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.719

gggaccgacgtggcgcgtgccgaggaattcga	CRISPR spacer
ctggacgacgtggagcgcgccgaggaatcagt	Protospacer
  *. ******** ***.**********. * 

767. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
cgcggcacccgcaccgaggccgacgccgccgt	Protospacer
* *.  **** ********.*********   

768. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_009660 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD02, complete sequence) position: , mismatch: 9, identity: 0.719

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
accgcagcccccaccgaggacgacgcctcggt	Protospacer
 **....************ ******* **  

769. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc	Protospacer
* *  ***** *********** *****. . 

770. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc	Protospacer
* *  ***** *********** *****. . 

771. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ttctgggcgaagcgggcgagggccgccgggcc	Protospacer
  * *************** * ******.   

772. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc	Protospacer
* *  ***** *********** *****. . 

773. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ttctgggcgaagcgggcgagggccgccgggcc	Protospacer
  * *************** * ******.   

774. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
accttggcgacgccggcgatgcccgccgccga	Protospacer
. *  ***** ** ************** *..

775. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044475 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

776. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044446 (Acinetobacter indicus strain CMG3-2 plasmid pCMG3-2-1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

777. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049912 (Diaphorobacter sp. HDW4A plasmid p_unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
agcggcgcgaagcgggcgatgcccagcgcttc	Protospacer
.**.* ******************. ** .  

778. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044484 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

779. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc	Protospacer
* *  ***** *********** *****. . 

780. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044451 (Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

781. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc	Protospacer
* *  ***** *********** *****. . 

782. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047350 (Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

783. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047345 (Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

784. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047353 (Proteus mirabilis strain ZA25 plasmid pZA25-tetX-168kb, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

785. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
accttggcgacgccggcgatgcccgccgccga	Protospacer
. *  ***** ** ************** *..

786. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

787. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
accttggcgacgccggcgatgcccgccgccga	Protospacer
. *  ***** ** ************** *..

788. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to CP046596 (Acinetobacter indicus strain FS42-2 plasmid pFS42-2-1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

789. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
accttggcgacgccggcgatgcccgccgccga	Protospacer
. *  ***** ** ************** *..

790. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat	Protospacer
 *   **** **.*************** .* 

791. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
accttggcgacgccggcgatgcccgccgccga	Protospacer
. *  ***** ** ************** *..

792. spacer 11.5|2140585|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_002112 (Streptomyces cyaneus plasmid pSA1.1, complete sequence) position: , mismatch: 9, identity: 0.719

tacgagagcaaggggatcggcctggtcctcat	CRISPR spacer
cagcgggtcaagggcgtcggcctggtcctcaa	Protospacer
.*  .*. ****** .*************** 

793. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 9, identity: 0.719

gagccgctgctgaccgaggagcacctggccgg	CRISPR spacer
ctgaagctgctgaccgaggagcacggggcgat	Protospacer
  *  *******************  *** . 

794. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gagccgctgctgaccgaggagcacctggccgg	CRISPR spacer
tgccgggagctgaccgaggaggtcctggccgt	Protospacer
 . * *  *************  ******** 

795. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 9, identity: 0.719

gagccgctgctgaccgaggagcacctggccgg	CRISPR spacer
gagccgctgctgaccgtcgagcagccaaaggt	Protospacer
****************  ***** *...  * 

796. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_047851 (Brevibacterium phage LuckyBarnes, complete genome) position: , mismatch: 9, identity: 0.719

gagccgctgctgaccgaggagcacctggccgg	CRISPR spacer
ggatgccacctgatcgagtagcacctggccgg	Protospacer
*...  *  ****.**** *************

797. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN813684 (Microbacterium phage Terij, complete genome) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
gcatccgcgcgatccgcgacgccctcggtcgg	Protospacer
  ***** ******* **********. . * 

798. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
gggcggaggcgatcctcgacgaccccaccgtc	Protospacer
 *..  .************** **.***** *

799. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_011991 (Agrobacterium vitis S4 plasmid pAtS4b, complete sequence) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
gcaccttggcgatcctcgacgcgttcaccgca	Protospacer
  *.*. *************** .******  

800. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
gcgtcgcggccaccctcgacgccctcaccgag	Protospacer
  .**  *** *.*****************. 

801. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH834618 (Arthrobacter phage Lunar, complete genome) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tcgagcgggccatcctcgacgctctcactgct	Protospacer
* .  ***** ***********.*****.* .

802. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN234214 (Arthrobacter phage Amelia, complete genome) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tcgagcgggccatcctcgacgctctcactgct	Protospacer
* .  ***** ***********.*****.* .

803. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH834624 (Arthrobacter phage Polka, complete genome) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tcgagcgggccatcctcgacgctctcactgct	Protospacer
* .  ***** ***********.*****.* .

804. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH834608 (Arthrobacter phage Cote, complete genome) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
tcgagcgggccatcctcgacgctctcactgct	Protospacer
* .  ***** ***********.*****.* .

805. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 9, identity: 0.719

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cggatcaggcgatccgcgatgccctcaccgat	Protospacer
.*. .*.******** ***.**********..

806. spacer 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 9, identity: 0.719

cggccacggcgtcgcgtgtggaccggcggctc	CRISPR spacer
cgcaaccggcgtcgggtgtggatcggcggtga	Protospacer
**    ******** *******.******.  

807. spacer 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccacggcgtcgcgtgtggaccggcggctc	CRISPR spacer
cgcaaccggcgtcgggtgtggatcggcggtga	Protospacer
**    ******** *******.******.  

808. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP015221 (Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
ccgaagctgatcgtcgacaacctctcctgctt	Protospacer
  ************** *.******.*   .*

809. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
acggacctgatcctcgcctacctcttcacaac	Protospacer
. *.* ****** ***** **********. .

810. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
cgcgacctgatcgccgccgaccccttcacacc	Protospacer
 . .* *******.********.******.*.

811. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 9, identity: 0.719

gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
gaggaggtgatcgtcgccgacctggccgaccg	Protospacer
***.** ****************  .*.  * 

812. spacer 13.1|2153855|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 9, identity: 0.719

aggtgtcaaccggggcaccacacaccacaagg	CRISPR spacer
cagcgctgaccggcgcaccactcaccacaaga	Protospacer
 .*.*...***** ******* *********.

813. spacer 13.1|2153855|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 9, identity: 0.719

aggtgtcaaccggggcaccacacaccacaagg	CRISPR spacer
cagcgctgaccggcgcaccactcaccacaaga	Protospacer
 .*.*...***** ******* *********.

814. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
ctgcgcgacacggtgacggcggtgcgcaccct	Protospacer
  ****** ******.**********    * 

815. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021407 (Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gggcgcgagacgctggtggcggtgtcggatga	Protospacer
************ ***.*******. * .  .

816. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
tccccgtcgacggtggcgacggcgcggtggcg	Protospacer
   *    **********.***.*********

817. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
tccaccacgacggtggcggcggtgccgcggcg	Protospacer
     *. ***************** *.****

818. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
ctgcgcgacacggtgacggcggtgcgcaccct	Protospacer
  ****** ******.**********    * 

819. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
ctgcgcgacacggtgacggcggtgcgaaccct	Protospacer
  ****** ******.**********.   * 

820. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gcgcgcgagacgctggcggcgctgcagatcga	Protospacer
* ********** ******** ***.*    .

821. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
ccggtccggacggcggcggcggggcggtggcc	Protospacer
  *  * .*****.******** ******** 

822. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT522004 (Mycobacterium phage Gail, complete genome) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
gcggtggagaaggtggcggcggtgcgctgttc	Protospacer
* *   **** *************** ** . 

823. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacgcc	Protospacer
 .*******.***.***********    ** 

824. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_022063 (Mycobacterium phage Phelemich, complete genome) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgaggcggtggcggcagtgctgacacc	Protospacer
 .*******.**********.**** *  .* 

825. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacgcc	Protospacer
 .*******.***.***********    ** 

826. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacgcc	Protospacer
 .*******.***.***********    ** 

827. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KF024727 (Mycobacterium phage Reprobate, complete genome) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgaggcggtggcggcagtgctgacacc	Protospacer
 .*******.**********.**** *  .* 

828. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 9, identity: 0.719

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacgcc	Protospacer
 .*******.***.***********    ** 

829. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgaacgtcgcgcacggcgcgtcgacggg	Protospacer
**********.***** ******* *  . . 

830. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgaccgccgcgctgggcgcccgcccgag	Protospacer
******* ********* *****   .*. * 

831. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK937601 (Gordonia phage Charming, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

832. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

833. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976510 (Gordonia phage Fosterous, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

834. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH153809 (Gordonia phage Sitar, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

835. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976518 (Gordonia phage Stultus, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

836. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

837. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

838. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH651166 (Gordonia phage Angelicage, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

839. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976506 (Gordonia phage Affeca, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

840. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_042045 (Gordonia phage Lennon, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

841. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976512 (Gordonia phage Geodirt, complete genome) position: , mismatch: 9, identity: 0.719

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga	Protospacer
******  ***************. .  **. 

842. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
ccggtgacgccgcccgtggtgttggccgcgac	Protospacer
 . .*  *****************.*****  

843. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
aacatcccgtcgcccgtggtcttgacgatgcg	Protospacer
. *******.********** ***** ..*..

844. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
aacatcccgtcgcccgtggtcttgacgatgcg	Protospacer
. *******.********** ***** ..*..

845. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

846. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

847. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

848. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

849. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

850. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

851. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

852. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

853. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag	Protospacer
 .*   ************ .********** .

854. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
aacatcccgtcgcccgtggtcttgacgatgcg	Protospacer
. *******.********** ***** ..*..

855. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
aacatcccgtcgcccgtggtcttgacgatgcg	Protospacer
. *******.********** ***** ..*..

856. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcccgccgcccgtggtgttgaccgcgta	CRISPR spacer
tgcggttcgccgcccgtggtgatgcccgcgaa	Protospacer
  *. ..************** ** ***** *

857. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NZ_CP035418 (Leisingera sp. NJS204 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

cccgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
cccgcgacatgctgcagcggctgaccaatgcgga	Protospacer
******* ****** *********. ** .*  .

858. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NC_015852 (Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence) position: , mismatch: 9, identity: 0.735

cccgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
accgggagaagctggagcggctgattcatgacgg	Protospacer
 *** **** ***************  * . * *

859. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.735

cccagccgccgctcatgatcggcgaggaacatca--	CRISPR spacer
cccagtcgccgctgatgatcggcgcg--acggtgat	Protospacer
*****.******* ********** *  **. ..  

860. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to KX576640 (Arthrobacter phage RcigaStruga, complete genome) position: , mismatch: 9, identity: 0.735

cccagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
aggagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
   ************.**.********  * **. 

861. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to MG210949 (Arthrobacter phage Huntingdon, complete genome) position: , mismatch: 9, identity: 0.735

cccagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
aggagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
   ************.**.********  * **. 

862. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to MK112529 (Arthrobacter phage BigMack, complete genome) position: , mismatch: 9, identity: 0.735

cccagccgccgctcatgatcggcgaggaacatca-	CRISPR spacer
tggagccgccgctcacgaccggcgagg-tcttcgt	Protospacer
.  ************.**.********  * **. 

863. spacer 14.6|2163935|34|NZ_LN868939|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ccagcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
atcgcccagcgcagcgaccaggcgaccagcggca	Protospacer
 . *****************  *******  * .

864. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.735

ccgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
tgccgttcaacccggccggcatgaccgccgtccc	Protospacer
.  * ***.*********.***********. .*

865. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ccgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
acgccttcgacccgtccgacaggacgtaggtgcc	Protospacer
 ************* ****** ***    *.*.*

866. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 9, identity: 0.735

ccgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
acctggtcaacccggccgacctgaccgccgagac	Protospacer
 * .  **.*********** ********* * *

867. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 9, identity: 0.735

ccgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
acctggtcaacccggccgacctgaccgccgagac	Protospacer
 * .  **.*********** ********* * *

868. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.735

ccgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
acctggtcaacccggccgacctgaccgccgagac	Protospacer
 * .  **.*********** ********* * *

869. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 9, identity: 0.735

ccgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
gccccggcgtcccggccgacaagaccgccgccgt	Protospacer
 * **  ** *********** *********  .

870. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 9, identity: 0.735

ccggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
tgggcggtaacacccgcaccgtcaccacgccgta	Protospacer
. *****.* *****************. * *. 

871. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ccggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
tgggcggcaacacacgcaccgtcaccacgccgta	Protospacer
. ******* *** *************. * *. 

872. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.735

ccggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
cgggcggcatcacgctcaccgtcaccgacaacgg	Protospacer
* *********** * **********. * *   

873. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 9, identity: 0.735

ccggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
tcggcggcagcacccgcaccgccacgaccgacgc	Protospacer
.******** ***********.*** *.* *  .

874. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 9, identity: 0.735

ccggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
atggcggcatcatccgcaccatcaccgtgacgcg	Protospacer
 .**********.*******.*****.*   ** 

875. spacer 14.14|2164423|34|NZ_LN868939|PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.735

ccccgatgaccgccatcccgccacccaagcggac	CRISPR spacer
ccccgatgcccgccgtcccgccaccatgccgcga	Protospacer
******** *****.**********  . ** . 

876. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NC_017543 (Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence) position: , mismatch: 9, identity: 0.719

cgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
attgagctgctggatcggctgatgaagaaagc	Protospacer
  .*** ******* *************    

877. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_KY000038 (Agrobacterium rhizogenes strain 1724 plasmid pRi_1724, complete sequence) position: , mismatch: 9, identity: 0.719

cgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
ctgtcgctgctggcgctgctgatgaagaccgc	Protospacer
*    * ****** ** *************  

878. spacer 14.19|2163693|32|NZ_LN868939|CRISPRCasFinder matches to KU886270 (Freshwater phage uvFW-CGR-AMD-COM-C429, complete genome) position: , mismatch: 9, identity: 0.719

gcaattttggtggcgtgctcgtagtagaccgg	CRISPR spacer
accaggttggtagcgtgctcgcagtagacacc	Protospacer
.* *  *****.*********.*******   

879. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
ctcgatcagcgcatgatcggcgaggaacttcc	Protospacer
*     * ** ***************** ** 

880. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
accattctgcagcgaccacaggaccaggtggt	Protospacer
* * .  .***********  ********** 

881. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
accattctgcagcgaccacaggaccaggtggt	Protospacer
* * .  .***********  ********** 

882. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NC_018291 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_262, complete sequence) position: , mismatch: 9, identity: 0.719

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
cagtcagcgcagcgaccacaccaccagcggtg	Protospacer
 . .*************** * *****  * *

883. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010596 (Phaeobacter inhibens strain P10 plasmid pP10_a, complete sequence) position: , mismatch: 9, identity: 0.719

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
cagtcagcgcagcgaccacaccaccagcggtg	Protospacer
 . .*************** * *****  * *

884. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP031949 (Phaeobacter inhibens strain BS107 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
cagtcagcgcagcgaccacaccaccagcggtg	Protospacer
 . .*************** * *****  * *

885. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.719

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
accattctgcagcgaccacaggaccaggtggt	Protospacer
* * .  .***********  ********** 

886. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010736 (Phaeobacter inhibens strain P72 plasmid pP72_a, complete sequence) position: , mismatch: 9, identity: 0.719

agcccagcgcagcgaccacccgaccaggtggg	CRISPR spacer
cagtcagcgcagcgaccacaccaccagcggtg	Protospacer
 . .*************** * *****  * *

887. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
cgcctcgacccggccgacgtcaccgccgaacg	Protospacer
  *.**************.* ******* .. 

888. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_024972 (Micrococcus sp. A1 plasmid pLMA1, complete sequence) position: , mismatch: 9, identity: 0.719

gccttcgacccggccgacatgaccgccgcgtc-	CRISPR spacer
cgactcgaccccgccgacaggaccgcc-tgccg	Protospacer
   .******* ******* ******* .*.* 

889. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
aggccggccacggccgcgccaccggcatcgcc	Protospacer
. *  . **********.***.******** *

890. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_048133 (Aeromonas phage ZPAH7, complete genome) position: , mismatch: 9, identity: 0.719

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tggcagacgacggcagcaccatcggcattggc	Protospacer
  * .. * ***** *************.***

891. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to MK330684 (Aeromonas phage ZPAH7B, complete genome) position: , mismatch: 9, identity: 0.719

gcgagacccacggccgcaccatcggcatcggc	CRISPR spacer
tggcagacgacggcagcaccatcggcattggc	Protospacer
  * .. * ***** *************.***

892. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct--	CRISPR spacer
cgcggcagcagccgcaccgtcacc--tcggtcac	Protospacer
 ****** ** *************  .*.*..  

893. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010859 (Marinovum algicola DG 898 plasmid pMaD4, complete sequence) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
gacagcatcacccgcaacatcaccatctccaa	Protospacer
*.*.************ *.********.    

894. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN270889 (Ralstonia phage P-PSG-11, complete genome) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag	Protospacer
  **************  *******  *.*  

895. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN270890 (Ralstonia phage P-PSG-11-1, complete genome) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag	Protospacer
  **************  *******  *.*  

896. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN685189 (UNVERIFIED: Ralstonia phage vRsoP-WF2 genomic sequence) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag	Protospacer
  **************  *******  *.*  

897. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MF979559 (Ralstonia phage DU_RP_I, complete genome) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag	Protospacer
  **************  *******  *.*  

898. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN693531 (Marine virus AFVG_25M28, complete genome) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccat--ccagct	CRISPR spacer
tcaagcatcaccggcaccggcaccatcaccgg--	Protospacer
   .******** ****** ******  **.*  

899. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN685191 (UNVERIFIED: Ralstonia phage vRsoP-WR2 genomic sequence) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag	Protospacer
  **************  *******  *.*  

900. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN685190 (UNVERIFIED: Ralstonia phage vRsoP-WM2 genomic sequence) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag	Protospacer
  **************  *******  *.*  

901. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NC_047946 (Ralstonia phage RsoP1EGY, complete genome) position: , mismatch: 9, identity: 0.719

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag	Protospacer
  **************  *******  *.*  

902. spacer 14.31|2164425|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgatgaccgccatcccgccacccaagcggac	CRISPR spacer
ccgatgcccgccgtcccgccaccatgccgcga	Protospacer
****** *****.**********  . ** . 

903. spacer 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 9, identity: 0.719

cggtcctcacccgtgtcgggcccgcggtactg	CRISPR spacer
ggcgtctctcccgtgtcgggcccgctgtcggg	Protospacer
 *  .*** **************** **   *

904. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaacggcagcgtccagaggtcgccctcggt	CRISPR spacer
tcccgtcccagcgcccaggggtcgccctcggg	Protospacer
**  ..  *****.****.************ 

905. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaacggcagcgtccagaggtcgccctcggt	CRISPR spacer
gctgtcaccagcgtccagagttcgtcctcggg	Protospacer
 * . *. ************ ***.****** 

906. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016291 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaacggcagcgtccagaggtcgccctcggt	CRISPR spacer
tggaattgcagcgtccagaggtcgcagatgcc	Protospacer
* ***. ******************   .* .

907. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaacggcagcgtccagaggtcgccctcggt	CRISPR spacer
tcccgtcccagcgcccaggggtcgccctcggg	Protospacer
**  ..  *****.****.************ 

908. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaacggcagcgtccagaggtcgccctcggt	CRISPR spacer
tcccgtcccagcgcccaggggtcgccctcggg	Protospacer
**  ..  *****.****.************ 

909. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaacggcagcgtccagaggtcgccctcggt	CRISPR spacer
tcccgtcccagcgcccaggggtcgccctcggg	Protospacer
**  ..  *****.****.************ 

910. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

cggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
gggcggcatcacgctcaccgtcaccgacaacgg	Protospacer
 *********** * **********. * *   

911. spacer 14.48|2164424|33|NZ_LN868939|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.727

cccgatgaccgccatcccgccacccaagcggac	CRISPR spacer
cccgatgcccgccgtcccgccaccatgccgcga	Protospacer
******* *****.**********  . ** . 

912. spacer 14.49|2164485|33|NZ_LN868939|CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.727

ccggtcctcacccgtgtcgggcccg----cggtactg	CRISPR spacer
acggtcctcacccgtgacgggaccgttgacgac----	Protospacer
 *************** **** ***    **..    

913. spacer 14.49|2164485|33|NZ_LN868939|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.727

ccggtcctcacccgtgtcgggcccg----cggtactg	CRISPR spacer
gcggtcctcacccgtgacggggccgttgacgac----	Protospacer
 *************** **** ***    **..    

914. spacer 14.51|2164607|33|NZ_LN868939|CRT matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 9, identity: 0.727

ccagccagcagcgaatgcgttggcggtcagcat	CRISPR spacer
gaagccagcaacgaatgcgatggcggtggttgt	Protospacer
  ********.******** ******* . ..*

915. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

916. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

917. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_023600 (Mycobacterium phage Jolie1, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

918. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

919. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

920. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

921. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

922. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_008195 (Mycobacterium phage Cooper, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

923. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

924. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

925. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

926. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

927. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

928. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

929. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

930. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

931. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

932. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

933. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 9, identity: 0.719

gcatggaccccggccacatgcgcggcttcata	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac	Protospacer
 * ***** *** **************  .  

934. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaattgggtatcgaaatggtttgccacgtca	CRISPR spacer
caacgaggctatcgaaatggttcgccacgatc	Protospacer
*.*   ** *************.****** . 

935. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaattgggtatcgaaatggtttgccacgtca	CRISPR spacer
caacgaggctatcgaaatggttcgccacgatc	Protospacer
*.*   ** *************.****** . 

936. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 9, identity: 0.719

cgaattgggtatcgaaatggtttgccacgtca	CRISPR spacer
caacgaggctatcgaaatggttcgccacgatc	Protospacer
*.*   ** *************.****** . 

937. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaattgggtatcgaaatggtttgccacgtca	CRISPR spacer
caacgaggctatcgaaatggttcgccacgatc	Protospacer
*.*   ** *************.****** . 

938. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ggatcgcggctggtgtggatctcgttgatcag	Protospacer
* . .  ********* *******.***** *

939. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ctggctgcgctggtggtgatctggctgatctt	Protospacer
 .**... ******* ****** ******** 

940. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ctcaacgggctggtgttgatctcggcgatccg	Protospacer
 . . *.***************** .****.*

941. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to MN871482 (UNVERIFIED: Pseudomonas virus PaSz-6, complete genome) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc	Protospacer
*   . ****.************** *** * 

942. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to MN871486 (UNVERIFIED: Pseudomonas phage PaSz-9_45_61k, complete genome) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc	Protospacer
*   . ****.************** *** * 

943. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to MN871456 (UNVERIFIED: Pseudomonas phage Pa-C, complete genome) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc	Protospacer
*   . ****.************** *** * 

944. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NC_010116 (Pseudomonas phage YuA, complete genome) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc	Protospacer
*   . ****.************** *** * 

945. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to MT118302 (Pseudomonas phage Epa38, complete genome) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc	Protospacer
*   . ****.************** *** * 

946. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to KC758116 (Pseudomonas phage LKO4, complete genome) position: , mismatch: 9, identity: 0.719

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc	Protospacer
*   . ****.************** *** * 

947. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
tgggtgaagatggcgcgggcgtcggcgtagga	Protospacer
. *. *  ***  ****************** 

948. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013073 (Sphingobium indicum B90A plasmid pSRL3, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

949. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_014005 (Sphingobium japonicum UT26S plasmid pUT1, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

950. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

951. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

952. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_020563 (Sphingomonas sp. MM-1 plasmid pISP4, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

953. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP005088 (Sphingobium sp. TKS plasmid pTK4, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

954. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP005090 (Sphingobium sp. TKS plasmid pTK6, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

955. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_020544 (Sphingomonas sp. MM-1 plasmid pISP3, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

956. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 9, identity: 0.719

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg	Protospacer
  ***.************** **** . * * 

957. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP014597 (Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
atgccagcgtgcccgcgaagggggcacgcaag	Protospacer
 .******************* ***  ... *

958. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
atttcagcttgcccgcgaaggtgcccggcgcc	Protospacer
 . .**** ************** ***..** 

959. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049702 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2c, complete sequence) position: , mismatch: 9, identity: 0.719

tcgccagcgtgcccgcgaaggtggccgatgcg	CRISPR spacer
acccaagcgcgcccgccaaggtggccgagaaa	Protospacer
 * * ****.****** *********** . .

960. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
cgattcgagacggcgcaggcccaggacatcgc	Protospacer
 .  ****** ************** ** * .

961. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
atggtccagcaggcgcaggcccaggtcgagga	Protospacer
.  *** ** *****************.*   

962. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
cgcgtcgagaaggcgctggccaaggttcccgg	Protospacer
 .************** **** ****.  *  

963. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP033037 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13b, complete sequence) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
aaaaccgagaaggcgcagtcgcaggtcaagcg	Protospacer
.* ..************* * ******** . 

964. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
aagaccgagaaggcgcagtcgcaggtcaagcg	Protospacer
.* ..************* * ******** . 

965. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
aagaccgagaaggcgcagtcacaggtcaagcg	Protospacer
.* ..************* * ******** . 

966. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
aagaccgagaaggcgcagtcacaggtcaagcg	Protospacer
.* ..************* * ******** . 

967. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NC_009669 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT01, complete sequence) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
aagaccgagaaggcgcagtcgcaggtcaagcg	Protospacer
.* ..************* * ******** . 

968. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 9, identity: 0.719

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
cgcgtcgagaaggcgctggccaaggttcccgg	Protospacer
 .************** **** ****.  *  

969. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
cgaaacgggcgcggccgtcgtcggcgatcgc	Protospacer
  .********* *********** **  . 

970. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022081 (Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg	Protospacer
 ** ********** *********      *

971. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012984 (Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg	Protospacer
 ** ********** *********      *

972. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012984 (Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg	Protospacer
 ** ********** *********      *

973. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP034556 (Burkholderia cepacia ATCC 25416 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg	Protospacer
 ** ********** *********      *

974. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to MT889376 (Arthrobacter phage Phives, complete genome) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
aggcgtgggcgtcgccgtcgtcgggcaagtc	Protospacer
. * ..*****.************* ***  

975. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_KF418775 (Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
tcgcacgggcgccgacgtcgtcggcccttcg	Protospacer
 ** ********** *********      *

976. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023519 (Burkholderia cepacia strain FDAARGOS_388 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg	Protospacer
 ** ********** *********      *

977. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007745 (Burkholderia cepacia ATCC 25416 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg	Protospacer
 ** ********** *********      *

978. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
ccgaacgggcatcgccgtcgtcggccgaacc	Protospacer
 *********..************  .*.  

979. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.71

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
aacattccgcgccgcggtcgccggggaagag	Protospacer
.  * .  ******* ****.**********

980. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 9, identity: 0.735

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
ccctcatgtgcgacgccgcccccccgcccccgcc	Protospacer
**  .*.   ** ****.****************

981. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 9, identity: 0.735

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
cgcttcccgccgccgccagcaccccgccccacca	Protospacer
*   * ************ * *********  * 

982. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
ccggccgcccaccgccaccaccgcggcggcga	Protospacer
*     .******.**************.** 

983. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cttaccccccaccaacaccaccgcgtcgacgg	Protospacer
* .    ******* ********** ***** 

984. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP027240 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cagcccggccaccagcagcaccgcggcgacgg	Protospacer
*. *  . ****** ** ************* 

985. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP014515 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cgccgaacccaccaccacccccgataccgggt	Protospacer
****.************** ***  .* . *.

986. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP025617 (Micrococcus luteus strain SGAir0127 plasmid pSGAir0127) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cagcccggccaccagcagcaccgcggcgacgg	Protospacer
*. *  . ****** ** ************* 

987. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gccaaaacgcaccagcaccaccgcggcaatcg	Protospacer
  * **** ***** ************.*.  

988. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP026696 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gaccaatcccaccaccaccgccgcgattgggc	Protospacer
 .**** ************.*****.. . **

989. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
ggcgcgggccaccgccaccacggcggcgacgt	Protospacer
 **  .. *****.******* *********.

990. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to JN672684 (Enterobacteria phage F20, partial genome) position: , mismatch: 9, identity: 0.719

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
cgccataaccaccaccaccaccgatcataaac	Protospacer
***** * ***************     * .*

991. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 9, identity: 0.735

cgcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
ggcgcacgggcgccgacgtcgtcgggccttcgat	Protospacer
 *** ********** **********     *.*

992. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 9, identity: 0.735

cgcgaacgggcgccgccgtcgtcggg-----gaagaggt	CRISPR spacer
ggcgcacgggcgccgacgtcgtcgggccttcgag-----	Protospacer
 *** ********** **********     **.     

993. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

cgcg-aacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
-gcgaaacgggcgcggccgtcgtcggcgatcgccc	Protospacer
 *** ********* *********** **  .  .

994. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 9, identity: 0.71

------gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
ctgtttgcca---ccaccaccaccgccgcgacaa---	Protospacer
      ****   ***********.*****.*.*   

995. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.71

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
ttaccccccaccaacaccaccgcgtcgacgg	Protospacer
 .    ******* ********** ***** 

996. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP027240 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcccggccaccagcagcaccgcggcgacgg	Protospacer
. *  . ****** ** ************* 

997. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP025617 (Micrococcus luteus strain SGAir0127 plasmid pSGAir0127) position: , mismatch: 9, identity: 0.71

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
agcccggccaccagcagcaccgcggcgacgg	Protospacer
. *  . ****** ** ************* 

998. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
tcgcgggtcaccaccaccaccgcgccgaggc	Protospacer
 *  .. .**************** *** **

999. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AP013686 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gggaaacccaccaccaccacctctgcccata	Protospacer
*  ****************** * **     

1000. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AP013685 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gggaaacccaccaccaccacctctgcccata	Protospacer
*  ****************** * **     

1001. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AP013676 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

gccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
gggaaacccaccaccaccacctctgcccata	Protospacer
*  ****************** * **     

1002. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 9, identity: 0.735

ccttcgaccggtcgggcgtcgtcctcgaggacat	CRISPR spacer
agtcggaccggttgggcgtcgtcctcgaagaggg	Protospacer
  *. *******.***************.** . 

1003. spacer 15.53|2279045|34|NZ_LN868939|CRT matches to NZ_CP044987 (Deinococcus sp. AJ005 plasmid p96k, complete sequence) position: , mismatch: 9, identity: 0.735

gggttcacgggctgggcgaccgggaagcggttat	CRISPR spacer
ggttgaccgggctgagcgaccgggacgcggtgga	Protospacer
** *   *******.********** ***** . 

1004. spacer 15.56|2279228|34|NZ_LN868939|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccagcgtgcccgcgaaggtggccgatgcggt	CRISPR spacer
aggccagcgtgcgcgcgtaggtggccacgccgga	Protospacer
  ********** **** ********.   *** 

1005. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 9, identity: 0.735

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
accttggccaaggcgcaggccaaggtcgacttgc	Protospacer
. * * *  ************ *****.*****.

1006. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.735

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
gcggtcgagcaggcgcaggcgcaggtcggcgttg	Protospacer
*  ****** ********** ******..* *  

1007. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 9, identity: 0.727

gcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
gcgcacgggcgccgacgtcgtcggcccttcgat	Protospacer
*** ********** *********      *.*

1008. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 9, identity: 0.727

gcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
gcgcacgggcgccgacgtcgtcggtccttcgat	Protospacer
*** ********** *********      *.*

1009. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 9, identity: 0.727

gcgaacgggcgccgccgtcgtcgg-----ggaagaggt	CRISPR spacer
gcgcacgggcgccgacgtcgtcggcccttcgag-----	Protospacer
*** ********** *********      **.     

1010. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

gcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
tccaggtctcgccgccgtcctcggtgaagaggt	Protospacer
 * *.    ********** **** ********

1011. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_CP014769 (Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
cctcgaccagttgcgggccaaggtgggctt	Protospacer
    ****** ******** *******   

1012. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_CP014769 (Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

gggggaccaggtgcgggcccaggtggggga	CRISPR spacer
cctcgaccagttgcgggccaaggtgggctt	Protospacer
    ****** ******** *******   

1013. spacer 5.5|1449612|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 10, identity: 0.688

ctcatgctgtgctcgcgggcggggttggcccg	CRISPR spacer
gcaatgctgtgctcggtggcggggttcttgct	Protospacer
 . ************  *********  . * 

1014. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
ggattagcggcggtcaggccgcctcgaggatc	Protospacer
 *.   .***.****.**************..

1015. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
taaggcacggtggtcaggccgcatcgtttgcg	Protospacer
...************.****** ***   .* 

1016. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018665 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_2, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
ggattagcggcggtcaggccgcctcgaggatc	Protospacer
 *.   .***.****.**************..

1017. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
taaggcacggtggtcaggccgcatcgtttgcg	Protospacer
...************.****** ***   .* 

1018. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1019. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
ggattagcggcggtcaggccgcctcgaggatc	Protospacer
 *.   .***.****.**************..

1020. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1021. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1022. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1023. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1024. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1025. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1026. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1027. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1028. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1029. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1030. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to CP021185 (Sphingomonas wittichii DC-6 plasmid pDC04, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
ggattagcggcggtcaggccgcctcgaggatc	Protospacer
 *.   .***.****.**************..

1031. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
taaggcacggtggtcaggccgcatcgtttgcg	Protospacer
...************.****** ***   .* 

1032. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1033. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
aggggctcggtggtccggccgccttcaccctc	Protospacer
 ***** ******** ********. *   ..

1034. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
ccgggcacggtggtctggcagcctccgatcgg	Protospacer
* ************* *** ***** ..    

1035. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688

cggggcacggtggtcgggccgcctcgaggact	CRISPR spacer
gttcatgcgatggtcgggccgcctcgcggagt	Protospacer
    ...**.**************** *** *

1036. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgagggggtgcgggtgcccgcggcgccgcc	CRISPR spacer
atgatctcggcgcgggtgcccgcggcgtcgcg	Protospacer
.* .    **.****************.*** 

1037. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.688

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcaaagccttcgacgaggccgtcagcggtt	Protospacer
****.********* ********  .* . ..

1038. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 10, identity: 0.688

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcgacgccgtcgccgaggccggttaccccg	Protospacer
****** *** ************.  .  .* 

1039. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccgcgaagccttcgccgcggtcggcacggctc	Protospacer
***************** **.**. . ....*

1040. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ccccgaagccttcgccgatgccgtgaccgaac	Protospacer
** *************** **** ..  .  *

1041. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 10, identity: 0.688

ccgcgaagccttcgccgaggccgaaggaatcc	CRISPR spacer
ggttgctaccttcgacgaggccgaaggattca	Protospacer
   .*  .****** ************* ** 

1042. spacer 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

gggaccgacgtggcgcgtgccgaggaattcga	CRISPR spacer
tttgccgacgtggcgcgtgctgcggaacgcac	Protospacer
   .****************.* ****. *. 

1043. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MK524525 (Mycobacterium phage Ringer, complete genome) position: , mismatch: 10, identity: 0.688

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gacatgacccccgccgaggccgacgagatccg	Protospacer
  **********.******.*****  .. .*

1044. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MH371110 (Mycobacterium phage Magnar, complete genome) position: , mismatch: 10, identity: 0.688

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gacatgacccccgccgaggccgacgagatccg	Protospacer
  **********.******.*****  .. .*

1045. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to AF271693 (Mycobacterium virus Bxb1, complete genome) position: , mismatch: 10, identity: 0.688

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gacatgacccccgccgaggccgacgagatccg	Protospacer
  **********.******.*****  .. .*

1046. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MH697581 (Mycobacterium phage Crispicous1, complete genome) position: , mismatch: 10, identity: 0.688

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gacatgacccccgccgaggccgacgagatccg	Protospacer
  **********.******.*****  .. .*

1047. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_028828 (Mycobacterium phage TheloniousMonk, complete genome) position: , mismatch: 10, identity: 0.688

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gacatgacccccgccgaggccgacgagatccg	Protospacer
  **********.******.*****  .. .*

1048. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MK310141 (Mycobacterium phage Fenn, complete genome) position: , mismatch: 10, identity: 0.688

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gacatgacccccgccgaggccgacgagatccg	Protospacer
  **********.******.*****  .. .*

1049. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MK524523 (Mycobacterium phage Naira, complete genome) position: , mismatch: 10, identity: 0.688

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gacatgacccccgccgaggccgacgagatccg	Protospacer
  **********.******.*****  .. .*

1050. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_002656 (Mycobacterium phage Bxb1, complete genome) position: , mismatch: 10, identity: 0.688

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gacatgacccccgccgaggccgacgagatccg	Protospacer
  **********.******.*****  .. .*

1051. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ctgagggcaaagggggcgatgcccgcccgttc	Protospacer
   *****.*** ************** ..  

1052. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
ggcaggccgaggcgggcgatgccgcttatgtg	Protospacer
****** ***.************  ...   *

1053. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 10, identity: 0.688

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
tcctctatgaatcgggcgatgccctccgacat	Protospacer
  *   ..*** ************ ****** 

1054. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcagggcgaagcgggcgatgcccgccgacag	CRISPR spacer
tcgagggcgaaccgggcgatacccgcacctat	Protospacer
   ******** ********.*****   .* 

1055. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 10, identity: 0.688

gagccgctgctgaccgaggagcacctggccgg	CRISPR spacer
accaagacgctgaccgaggagcagcaggccga	Protospacer
.    * .*************** * *****.

1056. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP029363 (Streptomyces globisporus strain TFH56 plasmid pTFSG2, complete sequence) position: , mismatch: 10, identity: 0.688

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cctggctggtgatcctcgacgacctcaccgat	Protospacer
.    * **.*********** ********..

1057. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_015147 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence) position: , mismatch: 10, identity: 0.688

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cgatcccggcgatcctcgccgccccgggagcg	Protospacer
.***** *********** *****. .  *  

1058. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
gccgcaaggcgatcgtcgacgccatcaccgcg	Protospacer
    * .******* ******** ******  

1059. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_019331 (Arthrobacter sp. J3-40 plasmid pJ340-114, complete sequence) position: , mismatch: 10, identity: 0.688

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cgatcccggcgatcctcgccgcccctggagca	Protospacer
.***** *********** *****...  *  

1060. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_019332 (Arthrobacter sp. J3-53 plasmid pJ353-116, complete sequence) position: , mismatch: 10, identity: 0.688

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cgatcccggcgatcctcgccgcccctggagca	Protospacer
.***** *********** *****...  *  

1061. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
gcgttatggcgatcctcgacggcctcatcgag	Protospacer
  .*.  ************** *****.**. 

1062. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
tttggccggatcgtcgccgacctctgcgcgca	Protospacer
   .. * ***************** *.*** 

1063. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgacacggtggccgcggtgcccgaccc	Protospacer
 .****** ******** *******   . * 

1064. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
ttgcgcgagacggtggagacggtgcccccgat	Protospacer
  ************** *.******  . *  

1065. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 10, identity: 0.688

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cggcgcgacacggtggcggctgtgataggcaa	Protospacer
 ******* *********** ***  . *  .

1066. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 10, identity: 0.688

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgacacggtggccgcggtgcccgaccc	Protospacer
 .****** ******** *******   . * 

1067. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 10, identity: 0.688

gggcgcgagacggtggcggcggtgcggtggcg	CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacacc	Protospacer
 .*******.***.***********    .* 

1068. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
gccgcgaacgcctcgctcggcgtgaagtagcc	Protospacer
* ********** *********.**  .   .

1069. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
agcgcgaacgccgcggtcagcgcggcgaaggc	Protospacer
.************** **.*****.*    ..

1070. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
agcgcgaacgccgcggtcagcgcggccaaggc	Protospacer
.************** **.*****.*.   ..

1071. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
agcgcgaacgccgcggtcagcgcggccaaggc	Protospacer
.************** **.*****.*.   ..

1072. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgcgaacgccgcgctcggcgcgactctcat	CRISPR spacer
agcgcgaacgccgcggtcagcgcggccaaggc	Protospacer
.************** **.*****.*.   ..

1073. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.688

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
agcacggcggtgacccgcccgaaccggctgca	Protospacer
.  *  .******** ***** ********. 

1074. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
agcacggcggtgacccgcccgaaccggctgca	Protospacer
.  *  .******** ***** ********. 

1075. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
agcacggcggtgacccgcccgaaccggctgca	Protospacer
.  *  .******** ***** ********. 

1076. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.688

gtgaacacggtgaccggcccgtaccggctgtt	CRISPR spacer
agcacggcggtgacccgcccgaaccggctgca	Protospacer
.  *  .******** ***** ********. 

1077. spacer 14.15|2164484|34|NZ_LN868939|PILER-CR matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 10, identity: 0.706

cccggtcctcacccgtgtcgggcccg----cggtactg	CRISPR spacer
aacggtcctcacccgtgacgggaccgttgacgac----	Protospacer
  *************** **** ***    **..    

1078. spacer 14.15|2164484|34|NZ_LN868939|PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.706

cccggtcctcacccgtgtcgggcccg----cggtactg	CRISPR spacer
agcggtcctcacccgtgacggggccgttgacgac----	Protospacer
  *************** **** ***    **..    

1079. spacer 14.17|2164606|34|NZ_LN868939|PILER-CR matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 10, identity: 0.706

cccagccagcagcgaatgcgttggcggtcagcat	CRISPR spacer
tgaagccagcaacgaatgcgatggcggtggttgt	Protospacer
.  ********.******** ******* . ..*

1080. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 10, identity: 0.688

gacacgaccctgcagcggatcgtgatcgcctg	CRISPR spacer
aacacgaccctgcagcagatggtggcgcatta	Protospacer
.***************.*** ***..   .*.

1081. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1082. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1083. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcattatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1084. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1085. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1086. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1087. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1088. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcattatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1089. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1090. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1091. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcattatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1092. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1093. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1094. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MK279862 (Arthrobacter phage Lennox, complete genome) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
gagccgccgctcacgaccggcgaggttttcgt	Protospacer
 ************.**.********  . .  

1095. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NC_041944 (Arthrobacter phage Preamble, complete genome) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
gagccgccgctcacgaccggcgaggttttcgt	Protospacer
 ************.**.********  . .  

1096. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MH744421 (Arthrobacter phage Moki, complete genome) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
gagccgccgctcacgaccggcgaggttttcgt	Protospacer
 ************.**.********  . .  

1097. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1098. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1099. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1100. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1101. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044329 (Methylocystis rosea strain BRCS1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
cagctggcgctcatgatcggcgatttctgcaa	Protospacer
****.* ****************    ... *

1102. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1103. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1104. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1105. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1106. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1107. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1108. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
gggccgccgcgcatggtcggcgaggtgcgcat	Protospacer
 .******** ****.********* .*..  

1109. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1110. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1111. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1112. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1113. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1114. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1115. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1116. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1117. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1118. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1119. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1120. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1121. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1122. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1123. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1124. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1125. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1126. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1127. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1128. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1129. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1130. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1131. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
ctcgatccgctcgtggtcggcgaggaacacgc	Protospacer
*     ******.**.*************.  

1132. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1133. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1134. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1135. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1136. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1137. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1138. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1139. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1140. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1141. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1142. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1143. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1144. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1145. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1146. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1147. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1148. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1149. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1150. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1151. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

cagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat	Protospacer
. ************ ***.****** . *   

1152. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688

gccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
tcgcccgacacggccggcatgaccgccggcgg	Protospacer
 * ..**** ******.***********    

1153. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
atcggcatcgcccgcaccgtgaccaagcgcgg	Protospacer
. *******.********** ****  *.   

1154. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
atcggcatcgcccgcaccgtgaccaagcgcgg	Protospacer
. *******.********** ****  *.   

1155. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.688

ggcggcatcacccgcaccgtcaccatccagct	CRISPR spacer
aacgccatcacccgcaccggcaccacgggctt	Protospacer
..** ************** *****.  . .*

1156. spacer 14.35|2163631|33|NZ_LN868939|CRT matches to NC_017543 (Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence) position: , mismatch: 10, identity: 0.697

ccgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
gattgagctgctggatcggctgatgaagaaagc	Protospacer
   .*** ******* *************    

1157. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NC_013193 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence) position: , mismatch: 10, identity: 0.688

gcggtcaggctggtgttgatctcgctgatctg	CRISPR spacer
gcggtcaggctggtgttggtgtccgcagttca	Protospacer
******************.* **  ...*...

1158. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 10, identity: 0.688

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
atggaagagatttcgcgggcgtcggcgtcggt	Protospacer
 .*...  ****.*************** **.

1159. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 10, identity: 0.688

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
atggaagagatttcgcgggcgtcggcgtcggt	Protospacer
 .*...  ****.*************** **.

1160. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688

ttccgcttctgacgagccgaacgccgctcggt	CRISPR spacer
ctcagcttctgaggagccgaacgcccactctc	Protospacer
.** ******** ************  ..  .

1161. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP050072 (Klebsiella aerogenes strain 035 plasmid p35_E, complete sequence) position: , mismatch: 10, identity: 0.688

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
aacgaggttggtcgcgcgtcgtccttgaggac	Protospacer
  .  *...***** **********.******

1162. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 10, identity: 0.688

ccttcgaccggtcgggcgtcgtcctcgaggac	CRISPR spacer
aagccgaccggtgcggcgtcgtcctcggccaa	Protospacer
   .********  *************.  * 

1163. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 10, identity: 0.688

gacgtcgagaaggcgcaggcccaggtcaactt	CRISPR spacer
acggtcgaccaggcgcaggcccaggtcggtcc	Protospacer
.  *****  *****************.....

1164. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 10, identity: 0.677

gcgaacgggcgccgccgtcgtcggggaagag	CRISPR spacer
aatgcagggcgtcgccgtcgacggggaagcc	Protospacer
.  .  *****.******** ********  

1165. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1166. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1167. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1168. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1169. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1170. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1171. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1172. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1173. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1174. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1175. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1176. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1177. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1178. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1179. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1180. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1181. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1182. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1183. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1184. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1185. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1186. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1187. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1188. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1189. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1190. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1191. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1192. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1193. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1194. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccacaccgccgccgccaccgccacgcccttgat	Protospacer
.* ..*************** ** *****..* .

1195. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1196. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1197. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1198. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1199. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1200. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1201. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1202. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1203. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1204. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1205. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1206. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1207. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1208. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1209. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1210. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1211. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1212. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1213. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1214. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1215. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1216. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1217. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1218. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1219. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1220. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac	Protospacer
 *   ****.*************.*****.   *

1221. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1222. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1223. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ccggtacc----gccgccgccacccccccgcccccgcc	CRISPR spacer
----tgacgtgggccgccgccaccgccccgcccgcgat	Protospacer
    *. *    ************ ******** ** .

1224. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1225. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1226. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1227. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1228. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1229. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1230. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1231. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1232. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1233. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1234. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1235. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1236. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1237. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1238. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1239. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1240. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1241. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706

ccggtaccgccgccgccacccccccgcccccgcc	CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat	Protospacer
.* . *************** ** *****..* .

1242. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
atcgcgggtcaccaccaccaccgcgccgaggc	Protospacer
  *  .. .**************** *** **

1243. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AP013686 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
tgggaaacccaccaccaccacctctgcccata	Protospacer
.*  ****************** * **     

1244. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AP013685 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
tgggaaacccaccaccaccacctctgcccata	Protospacer
.*  ****************** * **     

1245. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AP013676 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

cgccaaacccaccaccaccaccgcggcgacgc	CRISPR spacer
tgggaaacccaccaccaccacctctgcccata	Protospacer
.*  ****************** * **     

1246. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to HM486077 (Tsukamurella phage TPA2, complete sequence) position: , mismatch: 10, identity: 0.688

cgccaaacccaccaccaccaccgcggcgacgc---	CRISPR spacer
---cgagttcaccaccaccaccaccgcgccgccga	Protospacer
   *.*...*************.* *** ***   

1247. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_015210 (Tsukamurella phage TPA2, complete genome) position: , mismatch: 10, identity: 0.688

cgccaaacccaccaccaccaccgcggcgacgc---	CRISPR spacer
---cgagttcaccaccaccaccaccgcgccgccga	Protospacer
   *.*...*************.* *** ***   

1248. spacer 15.33|2278983|35|NZ_LN868939|PILER-CR matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 10, identity: 0.714

cccttcgaccggtcgggcgtcgtcctcgaggacat	CRISPR spacer
gagtcggaccggttgggcgtcgtcctcgaagaggg	Protospacer
   *. *******.***************.** . 

1249. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 10, identity: 0.706

cgcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
ggcgcacgggcgccgacgtcgtcggcccttcgat	Protospacer
 *** ********** *********      *.*

1250. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 10, identity: 0.706

cgcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
ggcgcacgggcgccgacgtcgtcggtccttcgat	Protospacer
 *** ********** *********      *.*

1251. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 10, identity: 0.706

cgcgaacgggcgccgccgtcgtcgg-----ggaagaggt	CRISPR spacer
ggcgcacgggcgccgacgtcgtcggcccttcgag-----	Protospacer
 *** ********** *********      **.     

1252. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706

cgcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
atccaggtctcgccgccgtcctcggtgaagaggt	Protospacer
  * *.    ********** **** ********

1253. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1254. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1255. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_023600 (Mycobacterium phage Jolie1, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1256. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1257. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1258. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1259. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1260. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_008195 (Mycobacterium phage Cooper, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1261. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1262. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1263. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1264. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1265. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1266. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1267. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1268. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1269. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1270. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1271. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 10, identity: 0.706

gcatggaccccggccacatgcgcggcttcatagc	CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt	Protospacer
 * ***** *** **************  .  *.

1272. spacer 15.45|2278560|34|NZ_LN868939|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 10, identity: 0.706

gcggtcaggctggtgttgatctcgctgatctggc	CRISPR spacer
tggcgcaggctggcgctgatctcgctgatgttct	Protospacer
  *  ********.*.************* *  .

1273. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to HM486077 (Tsukamurella phage TPA2, complete sequence) position: , mismatch: 10, identity: 0.677

gccaaacccaccaccaccaccgcggcgacgc---	CRISPR spacer
---gagttcaccaccaccaccaccgcgccgccga	Protospacer
   .*...*************.* *** ***   

1274. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_015210 (Tsukamurella phage TPA2, complete genome) position: , mismatch: 10, identity: 0.677

gccaaacccaccaccaccaccgcggcgacgc---	CRISPR spacer
---gagttcaccaccaccaccaccgcgccgccga	Protospacer
   .*...*************.* *** ***   

1275. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to MH077578 (Mycobacterium phage DillTech15, complete genome) position: , mismatch: 10, identity: 0.706

ccttcgaccggtcgggcgtcgtcctcgaggacat	CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggacca	Protospacer
.. *.*  ****  ******************  

1276. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to MT684586 (Mycobacterium phage Gandalph, complete genome) position: , mismatch: 10, identity: 0.706

ccttcgaccggtcgggcgtcgtcctcgaggacat	CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggacca	Protospacer
.. *.*  ****  ******************  

1277. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to MH371120 (Mycobacterium phage OlympiaSaint, complete genome) position: , mismatch: 10, identity: 0.706

ccttcgaccggtcgggcgtcgtcctcgaggacat	CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggacca	Protospacer
.. *.*  ****  ******************  

1278. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to KT281795 (Mycobacterium phage XFactor, complete genome) position: , mismatch: 10, identity: 0.706

ccttcgaccggtcgggcgtcgtcctcgaggacat	CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggacca	Protospacer
.. *.*  ****  ******************  

1279. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP033037 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13b, complete sequence) position: , mismatch: 10, identity: 0.706

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
aaaaccgagaaggcgcagtcgcaggtcaagcgga	Protospacer
.* ..************* * ******** . * 

1280. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.762

ggaggaccaggtgtgggcccaggtggaggaccaggtggggga	CRISPR spacer
gggggaccaggtgtgggcccaggtggaggactggtgcaccgg	Protospacer
**.****************************..*   .  *.

1281. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.656

accggcacgctgctcgacggctttctgagctg	CRISPR spacer
ctcggcgcgctgctcgacggcattcccgagca	Protospacer
 .****.************** ***. .. ..

1282. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_022753 (Mycobacterium phage Fredward, complete genome) position: , mismatch: 11, identity: 0.656

cccatgacccccaccgaggtcgacgccgcgtg	CRISPR spacer
gtgcagacctccaccgaggtcgacaccgatac	Protospacer
 .   ****.**************.***    

1283. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_019338 (Arthrobacter sp. J3-37 plasmid pJ337-114, complete sequence) position: , mismatch: 11, identity: 0.656

tgatccgggcgatcctcgacgccctcaccggc	CRISPR spacer
cgatcccggcgatcctcgccgccccaggatct	Protospacer
.***** *********** *****. .    .

1284. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 11, identity: 0.656

gagaagctgatcgtcgccgacctcttcacgct	CRISPR spacer
ctgaagcggatcgtcgccgatctctctttaga	Protospacer
  ***** ************.****.. ..  

1285. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NC_017543 (Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence) position: , mismatch: 11, identity: 0.676

cccgcgagatgctggagcggctgatgaagacccg	CRISPR spacer
tgattgagctgctggatcggctgatgaagaaagc	Protospacer
.   .*** ******* *************    

1286. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.676

ccgccttcgacccggccgacatgaccgccgcgtc	CRISPR spacer
tgcgcctcgacccggccgacgtcaccgccgaacg	Protospacer
.   *.**************.* ******* .. 

1287. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to MK279862 (Arthrobacter phage Lennox, complete genome) position: , mismatch: 11, identity: 0.667

ccagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
ggagccgccgctcacgaccggcgaggttttcgt	Protospacer
  ************.**.********  . .  

1288. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to NC_041944 (Arthrobacter phage Preamble, complete genome) position: , mismatch: 11, identity: 0.667

ccagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
ggagccgccgctcacgaccggcgaggttttcgt	Protospacer
  ************.**.********  . .  

1289. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to MH744421 (Arthrobacter phage Moki, complete genome) position: , mismatch: 11, identity: 0.667

ccagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
ggagccgccgctcacgaccggcgaggttttcgt	Protospacer
  ************.**.********  . .  

1290. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 11, identity: 0.621

gccaaacccaccaccaccaccgcggcgac---	CRISPR spacer
---cggctcaccacctccaccaccgcggcgag	Protospacer
    ..*.******* *****.* ***.*   

1291. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 11, identity: 0.656

ccgaggtcgattccgcgggcgtcggcgtaggc	CRISPR spacer
attgcgtcgataccgcgggcgtctgcgtccag	Protospacer
 . . ****** *********** ****  . 

1292. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 11, identity: 0.676

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
cgattcgagacggcgcaggcccaggacatcgcca	Protospacer
 .  ****** ************** ** * .  

1293. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
atggtccagcaggcgcaggcccaggtcgaggatc	Protospacer
.  *** ** *****************.*    .

1294. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 11, identity: 0.676

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
cgcgtcgagaaggcgctggccaaggttcccggcg	Protospacer
 .************** **** ****.  *    

1295. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
aagaccgagaaggcgcagtcgcaggtcaagcgta	Protospacer
.* ..************* * ******** .   

1296. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 11, identity: 0.676

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
aagaccgagaaggcgcagtcacaggtcaagcgaa	Protospacer
.* ..************* * ******** . . 

1297. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 11, identity: 0.676

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
aagaccgagaaggcgcagtcacaggtcaagcgaa	Protospacer
.* ..************* * ******** . . 

1298. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NC_009669 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT01, complete sequence) position: , mismatch: 11, identity: 0.676

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
aagaccgagaaggcgcagtcgcaggtcaagcgca	Protospacer
.* ..************* * ******** .   

1299. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 11, identity: 0.676

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
cgcgtcgagaaggcgctggccaaggttcccggcg	Protospacer
 .************** **** ****.  *    

1300. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.667

gcgaacgggcgccgccgtcgtcggggaagaggt	CRISPR spacer
cgaaacgggcgcggccgtcgtcggcgatcgccc	Protospacer
  .********* *********** **  .  .

1301. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to MK279862 (Arthrobacter phage Lennox, complete genome) position: , mismatch: 12, identity: 0.647

cccagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
aggagccgccgctcacgaccggcgaggttttcgt	Protospacer
   ************.**.********  . .  

1302. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to NC_041944 (Arthrobacter phage Preamble, complete genome) position: , mismatch: 12, identity: 0.647

cccagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
aggagccgccgctcacgaccggcgaggttttcgt	Protospacer
   ************.**.********  . .  

1303. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to MH744421 (Arthrobacter phage Moki, complete genome) position: , mismatch: 12, identity: 0.647

cccagccgccgctcatgatcggcgaggaacatca	CRISPR spacer
aggagccgccgctcacgaccggcgaggttttcgt	Protospacer
   ************.**.********  . .  

1304. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 12, identity: 0.647

gacgtcgagaaggcgcaggcccaggtcaacttgt	CRISPR spacer
acggtcgaccaggcgcaggcccaggtcggtccag	Protospacer
.  *****  *****************...... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8095 : 30019 35 Mycobacterium_phage(47.83%) NA NA
DBSCAN-SWA_2 39982 : 58990 20 Gordonia_phage(26.67%) capsid,head,portal NA
DBSCAN-SWA_3 313707 : 323852 10 Staphylococcus_phage(16.67%) tRNA,protease NA
DBSCAN-SWA_4 2580109 : 2585698 9 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_5 2605293 : 2627130 30 Streptomyces_phage(18.75%) tRNA,transposase,portal,terminase NA
DBSCAN-SWA_6 2636375 : 2644876 6 Mycobacterium_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LN868940
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868940_1 13835-14271 Orphan A:N
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LN868940_1 1.4|14056|18|NZ_LN868940|CRT 14056-14073 18 NZ_LN868940.1 13829-13846 0 1.0
NZ_LN868940_1 1.4|14056|18|NZ_LN868940|CRT 14056-14073 18 NZ_LN868939.1 2651587-2651604 0 1.0
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940.1 13829-13858 0 1.0
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868939.1 2651575-2651604 0 1.0
NZ_LN868940_1 1.6|14140|18|NZ_LN868940|CRT 14140-14157 18 NZ_LN868940.1 13829-13846 0 1.0
NZ_LN868940_1 1.6|14140|18|NZ_LN868940|CRT 14140-14157 18 NZ_LN868939.1 2651587-2651604 0 1.0
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940.1 13829-13858 0 1.0
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868939.1 2651575-2651604 0 1.0
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940.1 13829-13858 1 0.967
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868939.1 2651575-2651604 1 0.967

1. spacer 1.4|14056|18|NZ_LN868940|CRT matches to position: 13829-13846, mismatch: 0, identity: 1.0

gcccacacctggtccccc	CRISPR spacer
gcccacacctggtccccc	Protospacer
******************

2. spacer 1.4|14056|18|NZ_LN868940|CRT matches to position: 2651587-2651604, mismatch: 0, identity: 1.0

gcccacacctggtccccc	CRISPR spacer
gcccacacctggtccccc	Protospacer
******************

3. spacer 1.5|14092|30|NZ_LN868940|CRT matches to position: 13829-13858, mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

4. spacer 1.5|14092|30|NZ_LN868940|CRT matches to position: 2651575-2651604, mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

5. spacer 1.6|14140|18|NZ_LN868940|CRT matches to position: 13829-13846, mismatch: 0, identity: 1.0

gcccacacctggtccccc	CRISPR spacer
gcccacacctggtccccc	Protospacer
******************

6. spacer 1.6|14140|18|NZ_LN868940|CRT matches to position: 2651587-2651604, mismatch: 0, identity: 1.0

gcccacacctggtccccc	CRISPR spacer
gcccacacctggtccccc	Protospacer
******************

7. spacer 1.7|14176|30|NZ_LN868940|CRT matches to position: 13829-13858, mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

8. spacer 1.7|14176|30|NZ_LN868940|CRT matches to position: 2651575-2651604, mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

9. spacer 1.3|14008|30|NZ_LN868940|CRT matches to position: 13829-13858, mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
****.*************************

10. spacer 1.3|14008|30|NZ_LN868940|CRT matches to position: 2651575-2651604, mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
****.*************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13937-13989 0 1.0
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14008-14037 0 1.0
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13829-13858 0 1.0
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14032-14061 0 1.0
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14092-14121 0 1.0
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14116-14145 0 1.0
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14176-14205 0 1.0
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14200-14229 0 1.0
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13829-13858 0 1.0
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14032-14061 0 1.0
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14092-14121 0 1.0
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14116-14145 0 1.0
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14176-14205 0 1.0
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14200-14229 0 1.0
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14224-14253 0 1.0
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13829-13858 1 0.967
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13937-13966 1 0.967
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13984-14013 1 0.967
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14032-14061 1 0.967
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14092-14121 1 0.967
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14116-14145 1 0.967
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14176-14205 1 0.967
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14200-14229 1 0.967
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13889-13918 1 0.967
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13913-13942 1 0.967
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14008-14037 1 0.967
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13889-13918 1 0.967
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13913-13942 1 0.967
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14008-14037 1 0.967
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13984-14036 2 0.962
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13913-13965 2 0.962
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14152-14181 2 0.933
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13889-13918 2 0.933
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13913-13942 2 0.933
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14152-14181 2 0.933
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13937-13966 2 0.933
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13984-14013 2 0.933
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14140-14169 2 0.933
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14152-14181 2 0.933
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13937-13966 2 0.933
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13984-14013 2 0.933
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14140-14169 2 0.933
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14008-14060 3 0.943
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13865-13894 3 0.9
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14068-14097 3 0.9
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14140-14169 3 0.9
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13853-13882 3 0.9
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13865-13894 3 0.9
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14056-14085 3 0.9
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14068-14097 3 0.9
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13853-13882 3 0.9
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13865-13894 3 0.9
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14056-14085 3 0.9
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14068-14097 3 0.9
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14092-14144 4 0.925
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14176-14228 4 0.925
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13853-13882 4 0.867
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14056-14085 4 0.867
NZ_LN868940_1 1.5|14092|30|NZ_LN868940|CRT 14092-14121 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14224-14253 4 0.867
NZ_LN868940_1 1.7|14176|30|NZ_LN868940|CRT 14176-14205 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14224-14253 4 0.867
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14212-14241 4 0.867
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13829-13858 4 0.867
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14032-14061 4 0.867
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14092-14121 4 0.867
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14116-14145 4 0.867
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14176-14205 4 0.867
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14200-14229 4 0.867
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14152-14204 5 0.906
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13841-13870 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14020-14049 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14044-14073 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14104-14133 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14128-14157 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14164-14193 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14188-14217 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13877-13906 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 238573-238602 5 0.833
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 161957-161986 5 0.833
NZ_LN868940_1 1.1|13853|66|NZ_LN868940|CRT 13853-13918 66 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13853-13918 6 0.909
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 384021-384050 6 0.8
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13817-13846 6 0.8
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13901-13930 6 0.8
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14080-14109 6 0.8
NZ_LN868940_1 1.1|13853|66|NZ_LN868940|CRT 13853-13918 66 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14056-14121 7 0.894
NZ_LN868940_1 1.3|14008|30|NZ_LN868940|CRT 14008-14037 30 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 344494-344523 7 0.767
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 22738-22767 7 0.767
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_CP017756 Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence 40917-40946 7 0.767
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 102636-102665 7 0.767
NZ_LN868940_1 1.1|13853|66|NZ_LN868940|CRT 13853-13918 66 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14140-14205 8 0.879
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 13829-13881 8 0.849
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14032-14084 8 0.849
NZ_LN868940_1 1.2|13937|53|NZ_LN868940|CRT 13937-13989 53 NZ_LN868940 Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence 14116-14168 8 0.849
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 MN096370 Gordonia phage Squiddly, complete genome 52774-52803 8 0.733
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NZ_CP053906 Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence 22922-22951 8 0.733
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 MK814752 Gordonia phage Lutum, complete genome 30640-30669 8 0.733
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 MH651185 Gordonia phage Phistory, complete genome 30991-31020 8 0.733
NZ_LN868940_1 1.8|14224|30|NZ_LN868940|CRT 14224-14253 30 NC_048141 Gordonia phage Kenna, complete genome 30640-30669 8 0.733

1. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccgcacctggtcccccacctgggcccgcacctggtccccacctgggcccgc	CRISPR spacer
gcccgcacctggtcccccacctgggcccgcacctggtccccacctgggcccgc	Protospacer
*****************************************************

2. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccac	Protospacer
******************************

3. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

4. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

5. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

6. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

7. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

8. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

9. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

10. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

11. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

12. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

13. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

14. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
******************************

15. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctgggcccacacctgggcctgc	Protospacer
******************************

16. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
****.*************************

17. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccgc	Protospacer
****************************.*

18. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccgc	Protospacer
****************************.*

19. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
****.*************************

20. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
****.*************************

21. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
****.*************************

22. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
****.*************************

23. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
****.*************************

24. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcctccacctgggcccac	Protospacer
***************.**************

25. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccgc	Protospacer
****************************.*

26. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccac	Protospacer
****.*************************

27. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcctccacctgggcccac	Protospacer
***************.**************

28. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccgc	Protospacer
****************************.*

29. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccac	Protospacer
****.*************************

30. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.962

gcccgcacctggtcccccacctgggcccgcacctggt-ccccacctgggcccgc	CRISPR spacer
gcccgcacctggtcccccacctgggcccgcacctggtcccccacctgggccca-	Protospacer
************************************* **************. 

31. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.962

gcccgcacctggtcccccacctgggcccgcacctggt-ccccacctgggcccgc	CRISPR spacer
gcccacacctggtcccccacctgggcccgcacctggtcccccacctgggcccg-	Protospacer
****.******************************** *************** 

32. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcccccacctgggcccac	Protospacer
 *** *************************

33. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcctccacctgggcccac	Protospacer
****.**********.**************

34. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctgggcccgc	Protospacer
****.***********************.*

35. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccacacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcccccacctgggcccac	Protospacer
 *** *************************

36. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccgc	Protospacer
****.***********************.*

37. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccgc	Protospacer
****.***********************.*

38. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtccccc	Protospacer
************************ *** *

39. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccacacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcccccacctgggcccac	Protospacer
 *** *************************

40. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccgc	Protospacer
****.***********************.*

41. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccgcacctggtcccccacctgggcccgc	Protospacer
****.***********************.*

42. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtccccc	Protospacer
************************ *** *

43. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.943

gcccgcacctggtcccccacctgggcccgcacctggt-ccccacctgggcccgc	CRISPR spacer
gcccgcacctggtcccccacctgggcccacacctggtcccccacctgggccca-	Protospacer
****************************.******** **************. 

44. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcctccacctgggcccac	Protospacer
 *** **********.**************

45. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcctccacctgggcccac	Protospacer
 *** **********.**************

46. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtccccc	Protospacer
****.******************* *** *

47. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtcctcc	Protospacer
************************ **. *

48. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccacacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcctccacctgggcccac	Protospacer
 *** **********.**************

49. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtcctcc	Protospacer
************************ **. *

50. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccacacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcctccacctgggcccac	Protospacer
 *** **********.**************

51. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtcctcc	Protospacer
************************ **. *

52. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccacacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcctccacctgggcccac	Protospacer
 *** **********.**************

53. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtcctcc	Protospacer
************************ **. *

54. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9

gcccacacctggtcccccacctgggcccac	CRISPR spacer
tcccccacctggtcctccacctgggcccac	Protospacer
 *** **********.**************

55. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.925

gcccgcacctggtcccccacctgggcccgcacctggt-ccccacctgggcccgc	CRISPR spacer
gcccacacctggtcccccacctgggcccacacctggtcccccacctgggccca-	Protospacer
****.***********************.******** **************. 

56. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.925

gcccgcacctggtcccccacctgggcccgcacctggt-ccccacctgggcccgc	CRISPR spacer
gcccacacctggtcccccacctgggcccacacctggtcccccacctgggccca-	Protospacer
****.***********************.******** **************. 

57. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtcctcc	Protospacer
****.******************* **. *

58. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctggtcccccacctggtcctcc	Protospacer
****.******************* **. *

59. spacer 1.5|14092|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctgggcccacacctgggcctgc	Protospacer
************ *** **********..*

60. spacer 1.7|14176|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctggtcccccacctgggcccac	CRISPR spacer
gcccacacctgggcccacacctgggcctgc	Protospacer
************ *** **********..*

61. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcccccacctgggcccacacctgggcccac	Protospacer
 *** **********************..*

62. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
************ *** **********..*

63. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
************ *** **********..*

64. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
************ *** **********..*

65. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
************ *** **********..*

66. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
************ *** **********..*

67. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggtcccccacctgggcccac	Protospacer
************ *** **********..*

68. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.906

gcccgcacctggtcccccacctgggcccgcacctggt-ccccacctgggcccgc	CRISPR spacer
tcccccacctggtcccccacctgggcccacacctggtcccccacctgggccca-	Protospacer
 *** ***********************.******** **************. 

69. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcccccacctgggcccacacctggtccccc	Protospacer
 *** ******************* **. *

70. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcccccacctgggcccacacctggtccccc	Protospacer
 *** ******************* **. *

71. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcccccacctgggcccacacctggtccccc	Protospacer
 *** ******************* **. *

72. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcccccacctgggcccacacctggtccccc	Protospacer
 *** ******************* **. *

73. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcccccacctgggcccacacctggtccccc	Protospacer
 *** ******************* **. *

74. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcccccacctgggcccacacctggtccccc	Protospacer
 *** ******************* **. *

75. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcccccacctgggcccacacctggtccccc	Protospacer
 *** ******************* **. *

76. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcctccacctgggcccacacctggtcctcc	Protospacer
 **. ******************* *** *

77. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacc-tgggcctgc	CRISPR spacer
gcccacaccggggcccacaccgcggggcag-	Protospacer
********* *********** .*** * * 

78. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.833

gcccacacctgggcccacacc-tgggcctgc	CRISPR spacer
gcccacaccggggcccacaccgcggggcag-	Protospacer
********* *********** .*** * * 

79. spacer 1.1|13853|66|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.909

gcccacacctggtcccccacctggtcctccacctgggcccacacctggtcctccacctgg	CRISPR spacer
gcccacacctggtcccccacctggtcctccacctgggcccacacctggtcctccacctgg	Protospacer
************************************************************

80. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 6, identity: 0.8

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
tcccgcacctggtcccacccctgggtcacc	Protospacer
 *************** * ******.*  *

81. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcctccacctgggcccacacctggtccccc	Protospacer
 **. ******************* **. *

82. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcctccacctgggcccacacctggtccccc	Protospacer
 **. ******************* **. *

83. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
tcctccacctgggcccacacctggtccccc	Protospacer
 **. ******************* **. *

84. spacer 1.1|13853|66|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.894

gcccacacctggtcccccacctggtcctccacctgggcccacacctggtcctccacctgg	CRISPR spacer
gcccacacctggtcccccacctggtcctccacctgggcccacacctggtcccccacctgg	Protospacer
***************************************************.********

85. spacer 1.3|14008|30|NZ_LN868940|CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.767

gcccgcacctggtcccccacctgggcccac	CRISPR spacer
gcctgcacctggtccgccacctggccgaga	Protospacer
***.*********** ******** *  . 

86. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 7, identity: 0.767

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
acgcggccctcggcccccacctgggcctgc	Protospacer
.* *.  *** ***** *************

87. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_CP017756 (Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
cttcatccctcggcccacacctgggtctgc	Protospacer
 ..**. *** **************.****

88. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 7, identity: 0.767

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacgcctggtcccacacctgacaccac	Protospacer
******.***** **********.  *..*

89. spacer 1.1|13853|66|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.879

gcccacacctggtcccccacctggtcctccacctgggcccacacctggtcctccacctgg	CRISPR spacer
gcccacacctggtcccccacctggtcccccacctgggcccacacctggtcccccacctgg	Protospacer
***************************.***********************.********

90. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.849

gcccgcacctggtcccccacctgggcccgcacctggtccccacctgggcccgc	CRISPR spacer
gcccacacctggtcccccacctgggcccacacctggtcccccacctggtcctc	Protospacer
****.***********************.************  *. **.** *

91. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.849

gcccgcacctggtcccccacctgggcccgcacctggtccccacctgggcccgc	CRISPR spacer
gcccacacctggtcccccacctgggcccacacctggtcccccacctggtcctc	Protospacer
****.***********************.************  *. **.** *

92. spacer 1.2|13937|53|NZ_LN868940|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.849

gcccgcacctggtcccccacctgggcccgcacctggtccccacctgggcccgc	CRISPR spacer
gcccacacctggtcccccacctgggcccacacctggtcccccacctggtcccc	Protospacer
****.***********************.************  *. **.** *

93. spacer 1.8|14224|30|NZ_LN868940|CRT matches to MN096370 (Gordonia phage Squiddly, complete genome) position: , mismatch: 8, identity: 0.733

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
aaccacacctcggcccacacctcggcggcg	Protospacer
. ******** *********** ***    

94. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gggctggggtgggcccgcacctgggcctgc	Protospacer
*  *  .  *******.*************

95. spacer 1.8|14224|30|NZ_LN868940|CRT matches to MK814752 (Gordonia phage Lutum, complete genome) position: , mismatch: 8, identity: 0.733

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggacccacaccacgcttgac	Protospacer
************.********  * .. .*

96. spacer 1.8|14224|30|NZ_LN868940|CRT matches to MH651185 (Gordonia phage Phistory, complete genome) position: , mismatch: 8, identity: 0.733

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggacccacaccacgcttgac	Protospacer
************.********  * .. .*

97. spacer 1.8|14224|30|NZ_LN868940|CRT matches to NC_048141 (Gordonia phage Kenna, complete genome) position: , mismatch: 8, identity: 0.733

gcccacacctgggcccacacctgggcctgc	CRISPR spacer
gcccacacctggacccacaccacgcttgac	Protospacer
************.********  * .. .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_LN868942
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_LN868938
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868938_1 202642-202722 Orphan A:N
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868938_2 302587-302690 Orphan A:N
1 spacers
csa3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868938_3 3063492-3063598 Orphan A:N
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868938_4 3253219-3253322 Orphan A:N
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN868938_5 3605196-3605302 Orphan A:N
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LN868938_3 3.1|3063522|47|NZ_LN868938|CRISPRCasFinder 3063522-3063568 47 NZ_LN868938.1 3021434-3021480 0 1.0
NZ_LN868938_3 3.1|3063522|47|NZ_LN868938|CRISPRCasFinder 3063522-3063568 47 NZ_LN868938.1 3021512-3021558 1 0.979
NZ_LN868938_3 3.1|3063522|47|NZ_LN868938|CRISPRCasFinder 3063522-3063568 47 NZ_LN868938.1 3287917-3287963 1 0.979
NZ_LN868938_5 5.1|3605225|49|NZ_LN868938|CRISPRCasFinder 3605225-3605273 49 NZ_LN868938.1 3063559-3063607 2 0.959

1. spacer 3.1|3063522|47|NZ_LN868938|CRISPRCasFinder matches to position: 3021434-3021480, mismatch: 0, identity: 1.0

tccgacacagcctgagcgggtcagcggccggaggcggcagcgcagcg	CRISPR spacer
tccgacacagcctgagcgggtcagcggccggaggcggcagcgcagcg	Protospacer
***********************************************

2. spacer 3.1|3063522|47|NZ_LN868938|CRISPRCasFinder matches to position: 3021512-3021558, mismatch: 1, identity: 0.979

tccgacacagcctgagcgggtcagcggccggaggcggcagcgcagcg	CRISPR spacer
tccaacacagcctgagcgggtcagcggccggaggcggcagcgcagcg	Protospacer
***.*******************************************

3. spacer 3.1|3063522|47|NZ_LN868938|CRISPRCasFinder matches to position: 3287917-3287963, mismatch: 1, identity: 0.979

tccgacacagcctgagcgggtcagcggccggaggcggcagcgcagcg	CRISPR spacer
tccaacacagcctgagcgggtcagcggccggaggcggcagcgcagcg	Protospacer
***.*******************************************

4. spacer 5.1|3605225|49|NZ_LN868938|CRISPRCasFinder matches to position: 3063559-3063607, mismatch: 2, identity: 0.959

cagcgcagcgtcaccacgcaggccgccccgctcaggcgaaatccgacac	CRISPR spacer
cagcgcagcgtcaccacgcaggccgccccgcacaggcgaaatccaacac	Protospacer
******************************* ************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LN868938_1 1.1|202666|33|NZ_LN868938|CRISPRCasFinder 202666-202698 33 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 395356-395388 6 0.818
NZ_LN868938_1 1.1|202666|33|NZ_LN868938|CRISPRCasFinder 202666-202698 33 NZ_CP048631 Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence 62164-62196 7 0.788
NZ_LN868938_1 1.1|202666|33|NZ_LN868938|CRISPRCasFinder 202666-202698 33 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 37729-37761 8 0.758
NZ_LN868938_1 1.1|202666|33|NZ_LN868938|CRISPRCasFinder 202666-202698 33 KM389306 UNVERIFIED: Escherichia phage Phi06_2974 B clone contig00001 genomic sequence 5991-6023 9 0.727

1. spacer 1.1|202666|33|NZ_LN868938|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.818

acgtcgctggtcgcgccagcggcggt-gtcggcg	CRISPR spacer
gcgccgctggtcgcgccggcggcggcggccggc-	Protospacer
.**.*************.*******. *.**** 

2. spacer 1.1|202666|33|NZ_LN868938|CRISPRCasFinder matches to NZ_CP048631 (Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence) position: , mismatch: 7, identity: 0.788

acgtcgctggtcgcgccagcggcg-gtgtcggcg	CRISPR spacer
acgtcgctggtcgcgccagcgtcgtgcatgaac-	Protospacer
********************* ** *..* ..* 

3. spacer 1.1|202666|33|NZ_LN868938|CRISPRCasFinder matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

acgtcgctggtcgcgccagcggcggtgtcggcg	CRISPR spacer
accgttgtcgtcgcaccagcgccggtgtcggcg	Protospacer
**  .  * *****.****** ***********

4. spacer 1.1|202666|33|NZ_LN868938|CRISPRCasFinder matches to KM389306 (UNVERIFIED: Escherichia phage Phi06_2974 B clone contig00001 genomic sequence) position: , mismatch: 9, identity: 0.727

acgtcgctggtcgcgccagcggcggtgtcggcg	CRISPR spacer
caaacgtcagtcgctccagcggcggtggcggcg	Protospacer
  . **...***** ************ *****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 179234 : 195556 18 Mycobacterium_phage(58.33%) NA NA
DBSCAN-SWA_2 200711 : 207183 10 Mycobacterium_phage(33.33%) capsid NA
DBSCAN-SWA_3 228868 : 237126 13 Mycobacterium_phage(50.0%) integrase attL 232359:232373|attR 243050:243064
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage