Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011934 Leptospira interrogans serovar Manilae strain UP-MMC-NIID HP chromosome 1, complete sequence 8 crisprs Cas9_archaeal,cas2,cas7,cas8c,cas5,cas3,WYL,csa3,DinG 3 1 3 0
NZ_CP011936 Leptospira interrogans serovar Manilae strain UP-MMC-NIID HP plasmid pLIMHP1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP011935 Leptospira interrogans serovar Manilae strain UP-MMC-NIID HP chromosome 2, complete sequence 0 crisprs csa3 0 0 1 0

Results visualization

1. NZ_CP011934
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011934_1 793171-793273 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011934_2 849264-849360 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011934_3 1271415-1271504 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011934_4 1406068-1406642 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011934_5 1521509-1521713 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011934_6 1647741-1647841 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011934_7 3029067-3029169 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011934_8 3812038-3812127 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP011934_1 1.1|793210|25|NZ_CP011934|CRISPRCasFinder 793210-793234 25 NZ_CP011934.1 1341622-1341646 1 0.96
NZ_CP011934_7 7.1|3029106|25|NZ_CP011934|CRISPRCasFinder 3029106-3029130 25 NZ_CP011934.1 3029528-3029552 2 0.92
NZ_CP011934_5 5.1|1521560|103|NZ_CP011934|CRISPRCasFinder 1521560-1521662 103 NZ_CP011934.1 1521483-1521585 43 0.583

1. spacer 1.1|793210|25|NZ_CP011934|CRISPRCasFinder matches to position: 1341622-1341646, mismatch: 1, identity: 0.96

gaaactcagcaaacacctccctaaa	CRISPR spacer
gaaactcagcaaacacttccctaaa	Protospacer
****************.********

2. spacer 7.1|3029106|25|NZ_CP011934|CRISPRCasFinder matches to position: 3029528-3029552, mismatch: 2, identity: 0.92

acgtaattctgtgggaactactgca	CRISPR spacer
acctaattctgtgggaactactaca	Protospacer
** *******************.**

3. spacer 5.1|1521560|103|NZ_CP011934|CRISPRCasFinder matches to position: 1521483-1521585, mismatch: 43, identity: 0.583

aaaagcgatgttgcaaaaagacaagcgtagcgtagacttttgctttcaacggagttgtaa	CRISPR spacer
aaaagcgatgttgcaaaaagacaagcgtagcgtagacttttgctttcaacggagttgtaa	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011934_1 1.1|793210|25|NZ_CP011934|CRISPRCasFinder 793210-793234 25 NZ_CP020413 Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence 208013-208037 2 0.92
NZ_CP011934_1 1.1|793210|25|NZ_CP011934|CRISPRCasFinder 793210-793234 25 NZ_CP020413 Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence 52676-52700 2 0.92

1. spacer 1.1|793210|25|NZ_CP011934|CRISPRCasFinder matches to NZ_CP020413 (Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

gaaactcagcaaacacctccctaaa	CRISPR spacer
gaaactcagcaaacaccttcctaag	Protospacer
******************.*****.

2. spacer 1.1|793210|25|NZ_CP011934|CRISPRCasFinder matches to NZ_CP020413 (Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

gaaactcagcaaacacctccctaaa	CRISPR spacer
gtaactcagcaaacacctctctaaa	Protospacer
* *****************.*****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2506287 : 2515705 8 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_2 2568697 : 2578309 10 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_3 3222853 : 3237260 7 Leptospira_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP011936
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22269 : 60043 42 Leptospira_phage(62.5%) integrase,transposase attL 21138:21156|attR 46087:46105
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP011935
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 172232 : 259561 60 Pseudomonas_phage(20.0%) tRNA,transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage